CN104004854A - Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells - Google Patents
Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells Download PDFInfo
- Publication number
- CN104004854A CN104004854A CN201410271048.6A CN201410271048A CN104004854A CN 104004854 A CN104004854 A CN 104004854A CN 201410271048 A CN201410271048 A CN 201410271048A CN 104004854 A CN104004854 A CN 104004854A
- Authority
- CN
- China
- Prior art keywords
- exon7
- abo
- primer pair
- primer
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer set and kit for detecting genetic typing of ABO blood types of human red blood cells, and is mainly applied to Chinese people. The primer set for genetic testing of the ABO blood types comprises an ABOINTRON2396G primer pair, an ABOINTRON2396C primer pair, an ABOEXON7272A primer pair, an ABOEXON7272T primer pair, an ABOEXON7429C primer pair, an ABOEXON7429G primer pair, an ABOEXON 7635G primer pair, an ABOEXON 7635A primer pair, an ABOEXON 622A primer pair, an ABOEXON 7688G primer pair, an ABOEXON 7688C primer pair and internal reference primer pairs. The kit for detecting the genetic typing of the ABO blood types of the human red blood cells breaks various restrictions for identifying the ABO blood types through a serological method, is an indispensable supplementary means for judging the blood types correctly, and has wide application prospects and clinic reference value.
Description
Technical field
The invention belongs to biological technical field, particularly a kind of test kit for detection of human erythrocyte's abo blood group gene type (PCR-SSP method).
Background technology
Mankind ABO locus is in Chromosome 9 (9q34), and A, B, O gene high homology, has 7 exons.The about 1060bp of ABO mrna length, 353 amino acid of encoding.A gene and B genes encoding glycosyltransferase, and O gene is amorph.B gene and A gene are deposited difference in cDNA sequence the 297th, 703,796 and these 4 base sites of 803bp; The difference of O gene and A gene is cDNA 261bp bases G disappearance.A type mainly contains A1 and A2 blood subgroup, also has in addition A3, Am and Ax etc.With A1 genetic comparison, A2 gene exists A/T to replace and 1061bp base C disappearance at cDNA 467bp.O type mainly contains O1 and O2 hypotype.With O1 genetic comparison, except 261bp bases G disappearance, also there are 4 Substitutions such as 646T>A, 681G>A, 771C>T and 829G>A in O2 gene.
The gene product of ABO gene is glycosyltransferase, these enzyme control abo blood group antigens synthetic.The chemical structure of ABO antigen is glycoprotein, and A genetic expression A enzyme (α-3-N-D-galn transferring enzyme), can be added in N-acetyl semi-lactosi on the Fucose end of H material, produces Staphylococal Protein A specificity; B genetic expression B enzyme (α-3-D-galactosyltransferase), can be added in semi-lactosi H material sugar end and produce B antigen-specific.AB type individuality, with A and two kinds of glycosyltransferases of B, therefore has A and B antigen simultaneously on red corpuscle.O type individuality does not have A enzyme and B enzyme, so erythrocyte surface does not show A and B antigen.Serological method is identified abo blood group by detecting the antibody existing in erythrocyte surface antigen and blood conventionally, and by direct-detection ABO gene pairs, it carries out somatotype to the genetics classifying method of abo blood group.
ABO blood group system is the strongest blood group system of immunogenicity in human blood types system, in the clinical medicine such as blood transfusion medical science and organ, stem cell transplantation, plays an important role.Serological technique qualification ABO blood group system can only be identified phenotype, in the time identifying the individuality of unconventionality expression and make genetic analysis, is limited to.Abo blood group genotyping technique can be applied in conjunction with serodiagnosis result in medical science clinical in blood transfusion, ABO gene type result can be used as genetic marker and is applied to that mosaic after stem cell transplantation detects and the family research of hypotype.In addition, abo blood group genotyping technique is not limited by sample, and the material that amniotic fluid, hair etc. includes karyocyte all can be used as sample, makes it aspect fetus an d neonate bracket for blood grouping, have potential and using value widely.When patient is due to disease or aging, ABO gene product expression reduces, and causes A, and when B antigen presentation weakens, genotyping technique becomes the accurately first-selection of sizing of abo blood group because it is not subject to express the advantage affecting.Be not subject to the impact of autoantibodies in serum, irregular antibody, abo blood group genotyping technique has overcome all restrictions of serological method, is correctly to judge the indispensable supplementary means of blood group, is with a wide range of applications and clinical reference value.
Summary of the invention
The object of the invention is: overcome deficiency of the prior art, a kind of primer sets for detection of human erythrocyte's abo blood group gene of applicable Chinese population is provided.
Second object of the present invention be to provide having of a kind of applicable Chinese population sensitive, special, economical, easy, fast for detection of the test kit of human erythrocyte's abo blood group gene.
A kind of primer sets for detection of human erythrocyte's abo blood group gene of applicable Chinese population, it is characterized in that comprising ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, ABO EXON7 688C primer pair and internal reference primer pair;
The upstream and downstream primer that described ABO INTRON2 396G is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.2;
The upstream and downstream primer that described ABO INTRON2 396C is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.3;
The upstream and downstream primer that described ABO EXON7 272A is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.5;
The upstream and downstream primer that described ABO EXON7 272T is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.6;
The upstream and downstream primer that described ABO EXON7 429C is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.8;
The upstream and downstream primer that described ABO EXON7 429G is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.9;
The upstream and downstream primer that described ABO EXON7 635G is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.11;
The upstream and downstream primer that described ABO EXON7 635A is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.12;
The upstream and downstream primer that described ABO EXON6 22A is arranged in the primer pair of EXON6 1-22 and INTRON6 124-146 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.13, SEQ ID NO.14;
The upstream and downstream primer that described ABO EXON7 688G is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.16;
The upstream and downstream primer that described ABO EXON7 688C is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.17.
A kind of test kit for detection of human erythrocyte's abo blood group gene of applicable Chinese population, it is characterized in that comprising and be coated with ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, the primer plate of ABO EXON7 688C primer pair and internal reference primer pair and concentrated dNTP-Buffer,
The upstream and downstream primer that described ABO INTRON2 396G is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.2;
The upstream and downstream primer that described ABO INTRON2 396C is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.3;
The upstream and downstream primer that described ABO EXON7 272A is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.5;
The upstream and downstream primer that described ABO EXON7 272T is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.6;
The upstream and downstream primer that described ABO EXON7 429C is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.8;
The upstream and downstream primer that described ABO EXON7 429G is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.9;
The upstream and downstream primer that described ABO EXON7 635G is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.11;
The upstream and downstream primer that described ABO EXON7 635A is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.12;
The upstream and downstream primer that described ABO EXON6 22A is arranged in the primer pair of EXON6 1-22 and INTRON6 124-146 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.13, SEQ ID NO.14;
The upstream and downstream primer that described ABO EXON7 688G is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.16;
The upstream and downstream primer that described ABO EXON7 688C is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.17.
Brief description of the drawings
Fig. 1 is human erythrocyte's abo blood group gene specific primer hole bitmap.
Fig. 2 is experimental result yin and yang attribute interpretation figure.
Fig. 3 is that experimental result somatotype is read paperboard.
Fig. 4 is ABO electrophoresis result glue figure, AO1 type.
Fig. 5 is ABO electrophoresis result glue figure, O1O2 type.
Fig. 6 is ABO electrophoresis result glue figure, BO1 type.
Fig. 7 is ABO electrophoresis result glue figure, A205O1 type.
Fig. 8 is ABO electrophoresis result glue figure, A201O1 type.
Fig. 9 is ABO electrophoresis result glue figure, O1O1 type.
Figure 10 is ABO electrophoresis result glue figure, AO2 type.
Figure 11 is ABO electrophoresis result glue figure, O2O2 type.
Figure 12 is ABO electrophoresis result glue figure, BO2 type.
Figure 13 is ABO electrophoresis result glue figure, A205O2 type.
Figure 14 is ABO electrophoresis result glue figure, A201O2 type.
Figure 15 is ABO electrophoresis result glue figure, AA type.
Figure 16 is ABO electrophoresis result glue figure, A205A205 type.
Figure 17 is ABO electrophoresis result glue figure, A201A201 type.
Figure 18 is ABO electrophoresis result glue figure, A205A type.
Figure 19 is ABO electrophoresis result glue figure, A201A type.
Figure 20 is ABO electrophoresis result glue figure, A201A205 type.
Figure 21 is ABO electrophoresis result glue figure, BB type.
Figure 22 is ABO electrophoresis result glue figure, AB type.
Figure 23 is ABO electrophoresis result glue figure, A201B type.
Figure 24 is ABO electrophoresis result glue figure, A205B type.
Specific embodiment
Below in conjunction with specific embodiment, the present invention will be further described.
Embodiment 1
According to the disclosed ABO allelotrope sequence of state-run biotechnology information center of U.S. gene pool (NCBI Gene Bank), design the primer sets for detection of human erythrocyte's abo blood group gene, this primer sets comprises ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, ABO EXON7 688C primer pair and internal reference primer pair.
Embodiment 2
A kind of test kit for detection of human erythrocyte's abo blood group gene, comprise and be coated with ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, the primer plate of ABO EXON7 688C primer pair and internal reference primer pair and concentrated dNTP-Buffer.
Preparation method for detection of the test kit of human erythrocyte's abo blood group gene is:
(1) according to human erythrocyte's abo blood group gene specific primer hole bitmap (see figure 1), respectively by ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, ABO EXON7 688C primer pair and internal reference primer pair are coated with to the corresponding position of primer plate, drying treatment,
(2) according to joining 220mM dNTP, 3.5mM Mg2+, 500mM KCL, 100mM Tris-HCL, 1% TritonX-100 prepares the concentrated dNTP-Buffer of 440 μ l;
(3) every the primer plate that is coated with primer pair person-portion is detected and comprises 11 Auele Specific Primer holes, hole, a kind of test kit for detection of human erythrocyte's abo blood group gene of concentrated dNTP-Buffer composition.
Embodiment 3
Use operating process.
One, the preparation of 2.5% sepharose.
1. will add 2.5g agarose to add 100ml 1 × TBE solution (Tris-borate-EDTA solution), heating is until form uniform gelating soln.Add again appropriate electrophoresis dying agent, mix.
2. gel groove is placed in to level attitude, in gel groove, adds appropriate gelating soln, insert comb.Horizontal shifting gel groove, guarantees that gelating soln covers evenly.
3. after gel solidifies completely, vertically extract comb.
Two, PCR loop parameter is in Table 1(table 1 Amplification mark sheet):
| 1 | 96℃/2 min | 1 cycle |
| 2 | 96℃/20 sec, 68℃/60 sec | 5 cycles |
| 3 | 96℃/20 sec, 65℃/45 sec, 72℃/30 sec | 10 cycles |
| 4 | 96℃/20 sec, 62℃/45 sec, 72℃/30 sec | 15 cycles |
| 5 | 72℃/3 min | 1 cycle |
| 6 | 4 DEG C of preservations |
Three, must satisfied test conditions.
1. take out Taq polysaccharase from refrigeration chamber, be placed on ice.
2. according to experiment desired number, the primer plate of the dry freezing preservation of coated primer is taken out, place room temperature and thaw, for subsequent use.
3. according to experiment desired number, freezing DNA sample, concentrated dNTP-Buffer are taken out, thoroughly melt, mix centrifugal.
Four, the precaution in experimentation.
1. the application of sample utensil using before and after pcr amplification will separate, and must not use with.
2. whole blood goods all should be according to potential infective agent processing.
3. in the time observing and take gel, wear the protective glass of preventing ultraviolet, not look at ultraviolet source straight.
4. reagent and sample should be loaded onto the bottom of microwell plate.
5. for avoiding crossed contamination, between different samples and reagent, to change sample loading gun head.
6. before detection, should be ready to all reagent and sample, Once you begin test, can not interrupt operation for guaranteeing to obtain reliable results.
7. Taq polysaccharase viscosity is very large, in point process of assembling, must careful operation guarantee accurately.
8. in strict accordance with the sequential operation of specifying.
Five, operation steps.
A kind of test kit for detection of human erythrocyte's abo blood group gene of selecting embodiment 2 to prepare
1. preparation dNTP-Buffer working fluid:
μ l sterilized water=1000, concentrated dNTP-Buffer+560 of 440 μ l μ l dNTP-Buffer working fluid
2. preparation Buffer-enzyme mixation:
Every person-portion consumption: 110 μ l dNTP-Buffer working fluid+0.9 μ l Taq enzymes (5 units/ μ l)+10 μ l DNA=120.9 μ l
3. whirlpool mixes Buffer-enzyme mixation, and instantaneous centrifugal,, make liquid be positioned at the pipe end;
4. add respectively the above-mentioned mixed solution of 10 μ l to each primer hole (1-11);
5. every hole adds respectively 15-20 μ l paraffin oil again, seals PCR Sptting plate (primer plate) with sealing membrane;
6. primer plate is put into the PCR instrument that sets loop parameter, be used in conjunction with suitable grillage adapter.PCR loop parameter sees above;
7. PCR sealing load pad is put at Sptting plate top, to prevent liquid evaporation, shuts PCR instrument, and start-up routine is until loop ends;
8. start PCR program, until loop ends;
9. take out primer plate, tear lightly sealing membrane, prevent that sample from spilling.If or electrophoresis immediately not, be placed in 4 DEG C and can preserve 48 hours;
10. according to the order of primer hole bitmap, by each PCR reaction product, (5-10 μ l) transfers in 2.5% sepharose hole;
11. 140-150V electrophoresis 15-20 minute, the clear electrophoresis that separately can stop of internal reference band and These positive bands;
Observations take imaging under 12. UV-light;
13. explain somatotype result according to the paperboard of reading providing.
Six, quality control procedure:
The Quality Control means that internal reference quality control band (slowly moving) increases as success, at always visible of negative hole; The internal reference quality control band in positive hole may be very weak or not be existed, this be because in primer amplified process with the result of the reaction raw materials such as internal reference primer competition Taq enzyme.
Seven, the interpretation of experimental result:
Human erythrocyte's abo blood group gene detecting kit electrophoresis result glue figure (seeing Fig. 4-Figure 24).
Experimental result yin and yang attribute interpretation figure (see figure 2).
Positive gene somatotype is read paperboard and (is seen Fig. 3, note: in SSP result, " A " refers to other A genotype except A201, A205; " B " refers to B gene, CisAB, B(A) etc. genotype; " O1 " refers to O01 genotype; " O2 " refers to O02 genotype).
Expected results:
Positive hole: have two bands, one is internal reference band, and another is specific amplification band;
Negative hole: only having a band, is internal reference band, without specific amplification band.
Product size and position, hole: see human erythrocyte's abo blood group gene specific primer hole bitmap (see figure 1).
Carry out the judgement of somatotype result according to human erythrocyte's abo blood group gene specific primer hole bitmap (see figure 1) or this reagent software kit.
This experiment is qualitative test, and specific amplification band power will not affect result interpretation; Amplified production size refers to human erythrocyte's abo blood group gene specific primer hole bitmap (seeing Fig. 1); And meet Human genome seat rule.
The primer pair that each experiment relates to is above as follows:
The upstream and downstream primer that described ABO INTRON2 396G is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.2;
The upstream and downstream primer that described ABO INTRON2 396C is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.3;
The upstream and downstream primer that described ABO EXON7 272A is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.5;
The upstream and downstream primer that described ABO EXON7 272T is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.6;
The upstream and downstream primer that described ABO EXON7 429C is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.8;
The upstream and downstream primer that described ABO EXON7 429G is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.9;
The upstream and downstream primer that described ABO EXON7 635G is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.11;
The upstream and downstream primer that described ABO EXON7 635A is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.12;
The upstream and downstream primer that described ABO EXON6 22A is arranged in the primer pair of EXON6 1-22 and INTRON6 124-146 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.13, SEQ ID NO.14;
The upstream and downstream primer that described ABO EXON7 688G is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.16;
The upstream and downstream primer that described ABO EXON7 688C is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.17.
sequence table
<110> Tianjin Xiupeng Biotechnology Development Co., Ltd.
<120> human erythrocyte abo blood group genetic testing test kit (PCR-SSP method)
<160>17
<210>1
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 1
gaggtgggcaggagggtg 18
<210>2
<211>23
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(23)
<400> 2
ccaagagtgaagtcatctgtcag 23
<210>3
<211>23
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(23)
<400> 3
ccaagagtgaagtcatctgtcac 23
<210>4
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 4
cctggtgagccgctgca 18
<210>5
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(20)
<400>5
cgtggacgtggacatggaga 20
<210>6
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(20)
<400> 6
cgtggacgtggacatggagt 20
<210>7
<211>22
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(22)
<400> 7
cagtgacttctgcgagcggc 22
<210>8
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 8
ccgaccccccgaagaacg 18
<210>9
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 9
ccgaccccccgaagaacc 18
<210>10
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 10
caggccaacggcatcgag 18
<210>11
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(20)
<400> 11
gcagtgaacctcagcttccc 20
<210>12
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(20)
<400> 12
gcagtgaacctcagcttcct 20
<210>13
<211>22
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(22)
<400> 13
taggaaggatgtcctcgtggta 22
<210>14
<211>23
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(23)
<400> 14
tgcatgaatgacctttcccatc 23
<210>15
<211>23
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(23)
<400> 15
aggcttcagttactcacaacagg 23
<210>16
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 16
caggcggtccggaaccg 18
<210>17
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>mutation
<222> (1)……(18)
<400> 17
caggcggtccggaaccc 18
Claims (2)
1. the primer sets for detection of human erythrocyte's abo blood group gene, it is characterized in that comprising ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, ABO EXON7 688C primer pair and internal reference primer pair;
The upstream and downstream primer that described ABO INTRON2 396G is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.2;
The upstream and downstream primer that described ABO INTRON2 396C is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.3;
The upstream and downstream primer that described ABO EXON7 272A is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.5;
The upstream and downstream primer that described ABO EXON7 272T is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.6;
The upstream and downstream primer that described ABO EXON7 429C is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.8;
The upstream and downstream primer that described ABO EXON7 429G is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.9;
The upstream and downstream primer that described ABO EXON7 635G is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.11;
The upstream and downstream primer that described ABO EXON7 635A is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.12;
The upstream and downstream primer that described ABO EXON6 22A is arranged in the primer pair of EXON6 1-22 and INTRON6 124-146 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.13, SEQ ID NO.14;
The upstream and downstream primer that described ABO EXON7 688G is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.16;
The upstream and downstream primer that described ABO EXON7 688C is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.17.
2. the test kit for detection of human erythrocyte's abo blood group gene, it is characterized in that comprising and be coated with ABO INTRON2 396G primer pair, ABO INTRON2 396C primer pair, ABO EXON7 272A primer pair, ABO EXON7 272T primer pair, ABO EXON7 429C primer pair, ABO EXON7 429G primer pair, ABO EXON7 635G primer pair, ABO EXON7 635A primer pair, ABO EXON6 22A primer pair, ABO EXON7 688G primer pair, the primer plate of ABO EXON7 688C primer pair primer pair and internal reference primer pair and dense dNTP-Buffer;
The upstream and downstream primer that described ABO INTRON2 396G is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.2;
The upstream and downstream primer that described ABO INTRON2 396C is arranged in the primer pair of Intron2 520-537 and Intron2 347-369 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.1, SEQ ID NO.3;
The upstream and downstream primer that described ABO EXON7 272A is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.5;
The upstream and downstream primer that described ABO EXON7 272T is arranged in the primer pair of EXON7455-472 and EXON7 253-272 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.4, SEQ ID NO.6;
The upstream and downstream primer that described ABO EXON7 429C is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.8;
The upstream and downstream primer that described ABO EXON7 429G is arranged in the primer pair of EXON7 202-221 and EXON7 429-446 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.7, SEQ ID NO.9;
The upstream and downstream primer that described ABO EXON7 635G is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.11;
The upstream and downstream primer that described ABO EXON7 635A is arranged in the primer pair of EXON7 500-517 and EXON7 635-654 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.10, SEQ ID NO.12;
The upstream and downstream primer that described ABO EXON6 22A is arranged in the primer pair of EXON6 1-22 and INTRON6 124-146 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.13, SEQ ID NO.14;
The upstream and downstream primer that described ABO EXON7 688G is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.16;
The upstream and downstream primer that described ABO EXON7 688C is arranged in the primer pair of 3 ' NCR 97-119 and EXON7 671-688 is respectively the nucleotide sequence shown in sequence table SEQ ID NO.15, SEQ ID NO.17.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410271048.6A CN104004854A (en) | 2014-06-18 | 2014-06-18 | Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410271048.6A CN104004854A (en) | 2014-06-18 | 2014-06-18 | Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104004854A true CN104004854A (en) | 2014-08-27 |
Family
ID=51365760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410271048.6A Pending CN104004854A (en) | 2014-06-18 | 2014-06-18 | Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004854A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694656A (en) * | 2015-03-20 | 2015-06-10 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human erythrocyte Diego blood type genotyping |
| CN106048059A (en) * | 2016-08-10 | 2016-10-26 | 青岛大学附属医院 | SNP sites of A variation blood type for triggering acute hemolytic transfusion reaction |
| WO2017062613A1 (en) * | 2015-10-07 | 2017-04-13 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
| CN108624663A (en) * | 2017-03-23 | 2018-10-09 | 上海市血液中心 | A kind of human erythrocyte's abo blood group antigen multiplex PCR classifying method and kit |
| CN108642163A (en) * | 2018-05-16 | 2018-10-12 | 江苏中济万泰生物医药有限公司 | A kind of human erythrocyte's abo blood group genotyping primer group and application |
-
2014
- 2014-06-18 CN CN201410271048.6A patent/CN104004854A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| AXEL SELTSAM ET AL.: ""Systematic analysis of the ABO gene diversity within exons 6 and 7 by PCR screening reveals new ABO alleles"", 《TRANSFUSION》 * |
| AXEL SELTSAM ET AL.: ""The nature of diversity and diversification at the ABO locus"", 《BLOOD》 * |
| 喻琼等: ""ABO血型基因编码区全长序列的研究及初步应用"", 《中山大学学报（医学科学版）》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694656A (en) * | 2015-03-20 | 2015-06-10 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human erythrocyte Diego blood type genotyping |
| WO2017062613A1 (en) * | 2015-10-07 | 2017-04-13 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
| CN108474032A (en) * | 2015-10-07 | 2018-08-31 | 亿明达股份有限公司 | Capture of missing the target in sequencing technologies reduces |
| US10577643B2 (en) | 2015-10-07 | 2020-03-03 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
| EP3940083A1 (en) * | 2015-10-07 | 2022-01-19 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
| US11624084B2 (en) | 2015-10-07 | 2023-04-11 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
| CN106048059A (en) * | 2016-08-10 | 2016-10-26 | 青岛大学附属医院 | SNP sites of A variation blood type for triggering acute hemolytic transfusion reaction |
| CN106048059B (en) * | 2016-08-10 | 2019-04-09 | 青岛大学附属医院 | A kind of SNP site for the A anomaly blood group causing acute hemolytic transfusion reaction |
| CN108624663A (en) * | 2017-03-23 | 2018-10-09 | 上海市血液中心 | A kind of human erythrocyte's abo blood group antigen multiplex PCR classifying method and kit |
| CN108642163A (en) * | 2018-05-16 | 2018-10-12 | 江苏中济万泰生物医药有限公司 | A kind of human erythrocyte's abo blood group genotyping primer group and application |
| CN108642163B (en) * | 2018-05-16 | 2021-10-22 | 江苏中济万泰生物医药有限公司 | Human erythrocyte ABO blood group genotyping primer set and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schmeer et al. | Plasmid DNA manufacturing for indirect and direct clinical applications | |
| CN104004854A (en) | Primer set and kit for detecting genetic typing of ABO blood types of human red blood cells | |
| CN105039149B (en) | A kind of closed experimental system setup of Rapid identification nucleic acid amplification product and application | |
| CN101892314B (en) | Primer group and kit for detecting human platelet alloantigen gene | |
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN108883137A (en) | Neural organoid composition and application method | |
| CN103255209A (en) | Primer combination and kit for detecting human leucocyte HLA-B27 antigenic gene | |
| CN103820580B (en) | Porcine circovirus 2 type LAMP diagnostic kit | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| CN103361433A (en) | Primer group and kit for detecting genetic typing of human cytochrome P450 enzyme system 3A5(CYP3A5) | |
| US20160258005A1 (en) | Methods for rapid ribonucleic acid fluorescence in situ hybridization | |
| CN104711240B (en) | The application of Avianreovirus σ A albumen and its relevant biological material | |
| CN102206678B (en) | Method for transfecting pig T lymphocytes in vitro by applying nuclear transfection method | |
| CN102002539B (en) | Porcine parvovirus assay kit and application thereof | |
| Lothert et al. | Upstream and downstream processes for viral Nanoplexes as vaccines | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN104762274B (en) | The application of Avianreovirus σ NS albumen and its relevant biological material | |
| CN104694656A (en) | Primer group and kit for detecting human erythrocyte Diego blood type genotyping | |
| CN104372100A (en) | Test kit for detecting thalassemia-related gene mutation and application thereof | |
| CN104388587A (en) | One-step detection kit for influenza B virus and influenza B virus detection method | |
| CN107779503A (en) | The related difference expression gene of Alzheimer and its application | |
| CN110343743A (en) | For identifying primer sets, reagent, kit, application and the identification method of tip of a root dental papilla stem cell | |
| CN104726586A (en) | Primer group and kit for detecting human erythrocyte Kell blood type genotyping | |
| CN104726587A (en) | Primer group and kit for detecting human erythrocyte Kidd blood type genotyping | |
| CN103305631B (en) | Little binodal RNA viruses detection kit and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140827 |