CN104004696A - Bacillus anthracis with BA5641 gene deleted and construction method thereof - Google Patents
Bacillus anthracis with BA5641 gene deleted and construction method thereof Download PDFInfo
- Publication number
- CN104004696A CN104004696A CN201310062204.3A CN201310062204A CN104004696A CN 104004696 A CN104004696 A CN 104004696A CN 201310062204 A CN201310062204 A CN 201310062204A CN 104004696 A CN104004696 A CN 104004696A
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- recombinant
- strain
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a bacillus anthracis with BA5641 gene deleted and a construction method thereof. The bacillus anthracis with the BA5641 gene deleted is a recombinant strain obtained by replacing BA5641 in a bacillus anthracis genome with a resistance screening marker gene. A coding region sequence of the BA5641 gene is the sequence 2 in a sequence table; the resistance screening marker gene is spctinomycin-resistant gene; a nucleotide sequence of the spctinomycin-resistant gene is 1,032-2,161 sites of the sequence 1 in the sequence table; and the bacillus anthracis is a bacillus anthracis A16R strain. Experiments demonstrate that compared with the bacillus anthracis A16R strain, the recombinant strain has reduced spore germination rate when the recombinant strain is induced by L-alanine alone, is co-induced by L-alanine and L-proline and is co-induced by L-alanine and L-tryptophane. The bacillus anthracis with BA5641 gene deleted and the construction method thereof provide novel ideas for studying anthrax vaccine with higher security.
Description
Technical field
The invention belongs to biological technical field, relate to anthrax bacillus and the construction process thereof of a strain BA5641 genetically deficient.
Background technology
Anthrax bacillus (Bacillus anthracis) is a kind of shaft-like, Gram-positive bacillus that can form brood cell, can cause people and animals' anthrax, if treatment not in time, mortality ratio is high.Anthrax is one of five large zoonosiss, and hazardness is extremely strong, and human health and livestock industry all over the world has all been formed to serious threat.The gemma of anthrax bacillus touches after skin wound, digestive tube or airway epithelial, by infection and can cause the diseases such as malignant pustule, anthrax pneumonia, enteron aisle anthrax.Anthrax pneumonia is the most serious, will cause very soon disease and death.Anthrax bacillus is also used as biological warfare agent and manufactures bio-terrorism, and social stability is constituted a threat to.Therefore anthrax bacillus correlative study is always extensively concerned.
The research and development of anthrax bacillus vaccine are the focuses that various countries pay close attention to always.Although when butchering, dissecting animal, contact be mainly anthrax propagulum, anthrax infects and mostly to be the passive absorption of gemma, by skin, mucous membrane contact, respiratory tract sucks and gi tract are taken in and infected.When gemma enters after body contact blood, lymph liquid, can, from dormant state recovery in 20～40min, by activating, germinate and grow 3 successive stage formation propaguluies, breed.
Attenuated live spore vaccine adopts without pod membrane low virulent strain, and it is the important channel of Anthrax vaccine development.Consider the potentially dangerous that virulence is recovered, only have Russia and China to adopt.China adopts the tertiary refined A16R strain that waits seed selection of poplar, and the protection result of sheep, rabbit, monkey shows that it is 75%～100% to anthrax strong virus attack protection ratio, and human vaccination's safety is put into operation so far for 1961 years.But because natural cases is few, epidemiologic data is abundant not, inoculation adopts scarification, still exists dosage of inoculation to be difficult to not enough accurately.
Summary of the invention
The object of this invention is to provide a kind of recombinant bacterium and construction process thereof.Recombinant bacterium provided by the present invention is the anthrax bacillus of BA5641 genetically deficient.
Recombinant bacterium provided by the present invention, is to be the DNA fragmentation that contains resistance screening marker gene by the BA5641 Gene Replacement in anthrax bacillus genome, the recombinant bacterium obtaining.
The albumen of described BA5641 genes encoding is the albumen shown in sequence 3 in sequence table.
The coding region sequence of described BA5641 gene is specially the 5126232-5126669 position of sequence 2(GenBank:NC_003997 in sequence table).
Described resistance screening marker gene can be spectinomycin resistance gene.
In one embodiment of the invention, the nucleotide sequence of described spectinomycin resistance gene is specially the 1032-2161 position of sequence 1 in sequence table.
In one embodiment of the invention, the nucleotide sequence that contains the DNA fragmentation of resistance screening marker gene described in is specially the 934-2257 position of sequence 1 in sequence table.
In the present invention, described anthrax bacillus is specially anthrax bacillus A16R strain.
On gene level, more concrete, the following recombinant bacterial strain of recombinant bacterium provided by the present invention: in the genome sequence of described anthrax bacillus A16R strain, by being arranged in nucleotides sequence and classifying as the DNA fragmentation shown in the 1-933 position of sequence table sequence 1, (be upstream homology arm, corresponding to No. GenBank 5125293-5126225 position that is the sequence of NC_003997 " Up date:2012-9-27 ") and nucleotides sequence to classify the DNA fragmentation shown in the 2258-3218 position of sequence 1 in sequence table as (be downstream homology arm, corresponding to No. GenBank, be the 5126645-5127605 position of the sequence of NC_003997 " Up date:2012-9-27 ") between sequence, replace with the 934-2257 position of sequence 1 in sequence table, the recombinant bacterial strain obtaining.
The method of the described recombinant bacterium of preparation provided by the present invention, specifically can comprise the steps:
(a) following nucleotide fragments is cloned in responsive to temperature type shuttle plasmid, obtains recombinant vectors;
Described Nucleotide sheet degree is followed successively by from 5 ' end to 3 ' end: the DNA fragmentation 1 that is positioned at described BA5641 upstream region of gene in the genome sequence at described anthrax bacillus, described resistance screening marker gene, and the DNA fragmentation 2 that is positioned at described BA5641 gene downstream in the genome sequence of described anthrax bacillus;
(b) the described recombinant vectors obtaining in step (a) is imported to described anthrax bacillus, and cultivate at the non-sensitive temperature of described shuttle plasmid, obtain recombinant bacterium intermediate;
(c) the recombinant bacterium intermediate obtaining in step (b) is cultivated under the sensitive temperature of described shuttle plasmid, to remove described recombinant vectors, obtained candidate's recombinant bacterium, from described candidate's recombinant bacterium, obtain described recombinant bacterium.
In aforesaid method, described DNA fragmentation 1 is specially the DNA fragmentation shown in the 1-933 position Nucleotide of sequence 1 in sequence table, and described DNA fragmentation 2 is specially the DNA fragmentation shown in the 2258-3218 position Nucleotide of sequence 1 in sequence table;
More concrete, the sequence of described nucleotide fragments is sequence 1 in sequence table.
Described responsive to temperature type shuttle plasmid is specially pKSV7 plasmid;
In step (b), described non-sensitive temperature can be 30 ℃; In step (c), described sensitive temperature can be 37-40 ℃, in one embodiment of the invention, is specially 40 ℃.
In described method, in step (a), also comprise the step of described recombinant vectors demethylation before.
By the method for described recombinant vectors demethylation, specifically can comprise the steps: described recombinant vectors to import in the intestinal bacteria of methylase defect, obtain recombination bacillus coli; From described recombination bacillus coli, extract plasmid, obtain the recombinant vectors of demethylation;
In the present invention, described intestinal bacteria are specially intestinal bacteria SCS110.
In aforesaid method, in step (c), the method that obtains described recombinant bacterium from described candidate's recombinant bacterium specifically can comprise the steps: by described candidate's recombinant bacterium respectively only contain the substratum of described resistance screening marker (as spectinomycin) and only contain as described in the resistance markers I(of recombinant vectors as paraxin) substratum in cultivate, be chosen at the substratum growth that only contains described resistance screening marker (as spectinomycin), and at the resistance markers I(that only contains described recombinant vectors as paraxin) substratum in the bacterial strain of not growing, obtain described recombinant bacterium.
A further object of the present invention is to provide the biomaterial of (1) or (2) as follows:
(1) DNA molecular, its nucleotides sequence is classified as in sequence table shown in sequence 1;
(2) contain the recombinant vectors of DNA molecular, expression cassette, recombinant cell lines or recombinant bacterium described in (1) in steps;
Described recombinant vectors is specially described DNA molecular is inserted into the recombinant plasmid obtaining in responsive to temperature type shuttle plasmid;
Described responsive to temperature type shuttle plasmid is specially pKSV7 plasmid.
The application of arbitrary described recombinant bacterium in preparing Anthrax vaccine also belongs to protection scope of the present invention above.
Recombinant bacterium provided by the present invention is the BA5641 gene-deleted strain of anthrax bacillus A16R strain, experimental results show that, compare with anthrax bacillus A16R strain, when this recombinant bacterium is induced separately at ALANINE, when ALANINE and L-PROLINE are induced jointly, when ALANINE and L-Trp are induced jointly, and when inosine and L-Trp are induced jointly, its gemma is sprouted speed and is all reduced.The present invention provides new thinking for developing the stronger Anthrax vaccine of security.
Accompanying drawing explanation
Fig. 1 turns the bacterium colony PCR qualification result after escherichia coli DH5a for connecting product.Wherein, the clone that swimming lane 1,2,3,4,5,6,7,8,9,10 is picking (the positive clone of swimming lane 10), the DNA Marker IV of swimming lane M Wei Zhong Ke Ruitai company, object clip size is about 1K.
Fig. 2 turns the enzyme that extracts plasmid after escherichia coli DH5a and cuts qualification result for connecting product.Wherein, swimming lane 1 is the result of Hind III and EcoR I double digestion, the former plasmid of swimming lane 2 for cutting without enzyme, the DNA Marker IV of swimming lane M Wei Zhong Ke Ruitai company.
Fig. 3 is that recombinant vectors pKBA5641USD electricity turns the bacterium colony PCR qualification result after intestinal bacteria SCS110.Wherein, swimming lane 1,2,3,4,5,6 is the clone of picking (swimming lane 1-6 is positive colony), the DNA Marker IV of swimming lane M Wei Zhong Ke Ruitai company, and object clip size is about 1K.
Fig. 4 is that recombinant vectors pKBA5641USD electricity turns the enzyme that extracts plasmid after intestinal bacteria SCS110 and cuts qualification result.Wherein, swimming lane 1 is the result of Hind III and EcoR I double digestion, the former plasmid of swimming lane 2 for cutting without enzyme, the DNA Marker IV of swimming lane M Wei Zhong Ke Ruitai company.
Fig. 5 is that recombinant vectors pKBA5641USD electricity turns the bacterium colony PCR qualification result after anthrax bacillus A16 strain.Wherein, swimming lane 1,2,3,4,5,6,7,8 is the clone of picking (swimming lane 1-8 is positive colony), the positive contrast of swimming lane 9 (take recombinant vectors pKBA5641USD as template), the DNA Marker IV of swimming lane M Wei Zhong Ke Ruitai company, object clip size is about 500bp.
Fig. 6 is positional information and the PCR qualification result thereof of the outside primer of object bacterial strain and inner primer.Wherein, A is the positional information of two pairs of outside primers and a pair of inner primer; B is the PCR qualification result of two pairs of outside primers and a pair of inner primer, the 1st, and the genome of A16R bacterial strain of take is template, the 2nd, the genome of A16R △ BA5641::spc bacterial strain of take is template.
Fig. 7 is the two-dimensional electrophoresis figure of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma albumen.Point G002, G005, G008 and G011 shown in figure are BA5641 protein site.
Fig. 8 is the growth curve of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain.
Fig. 9 is the Physiology and biochemistry qualification result of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain.
Figure 10 is the sprouting curve that the ALANINE (ALANINE of 100mM) of high density induces separately anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma to sprout.BA5641 wherein represents A16R △ BA5641::spc mutant strain.
Figure 11 is the sprouting curve that ALANINE and L-PROLINE (ALANINE of 1mM and the L-PROLINE of 10mM) induce anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma to sprout jointly.BA5641 wherein represents A16R △ BA5641::spc mutant strain.
Figure 12 is the sprouting curve that ALANINE and L-Trp (ALANINE of 1mM and the L-Trp of 100mM) induce anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma to sprout jointly.BA5641 wherein represents A16R △ BA5641::spc mutant strain.
Figure 13 is the sprouting curve that inosine and L-Trp (inosine of 1mM and the L-Trp of 100mM) induce anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma to sprout jointly.BA5641 wherein represents A16R △ BA5641::spc mutant strain.
Figure 14 is the sprouting curve that inosine (inosine of 1mM) induction anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma are sprouted.BA5641 wherein represents A16R △ BA5641::spc mutant strain.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
PKSV7 plasmid: be documented in " Smith K; Youngman P.Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene[J] .Biochimie; 1992; 74:705-711. " in a literary composition, public Ke Cong Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A obtains.
PT-loxp::spc plasmid: be documented in " Wang Yanchun; Jiang Na; the knocking out of the application of .Cre-LoxP system such as exhibition German etc. in Bacillus anthracis gene knockout and eag gene [J]. Progress in Biochemistry and Biophysics; 2009; 36 (7): 934-940. " in a literary composition, public Ke Cong Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A obtains.
Bacillus anthracis A16R(is anthrax bacillus A16R): be documented in " Gao Meiqin; Liu Xiankai; Feng Erling etc. Bacillus anthracis A16R strain eag gene deletion mutants builds [J]. microorganism journal; 2009; 49 (1): 23-31. " in a literary composition, public Ke Cong Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A obtains.
The structure of the anthrax bacillus A16R △ BA5641::spc of embodiment 1, BA5641 genetically deficient
One, the structure of recombinant vectors pKBA5641USD and demethylation thereof
1, the structure of recombinant vectors pKBA5641USD
(1) temperature sensitive type plasmid linearization
By responsive to temperature type shuttle plasmid pKSV7(6.9Kb) use restriction enzyme Hind III and EcoR I linearization for enzyme restriction, 0.6% agarose gel electrophoresis is separated afterwards, from gel, cut target stripe, with DNA gel, reclaim test kit and reclaim linearizing carrier segments, operation steps is carried out to specifications, obtains linearizing pKSV7 plasmid.
(2) target gene (BA5641) upstream and downstream homology arm obtains
Use Primer premier5.0 software, according to BA5641 gene (sequence 2 on anthrax bacillus Ames strain karyomit(e), the 5126232-5126669 position of GenBank:NC_003997, albumen shown in sequence 3 in code sequence list) upstream and downstream sequence, primer (TBA5641U_F and the TBA5641U_R of design BA5641 gene upstream and downstream homology arm sequence, and TBA5641D_F and TBA5641D_R, as shown in table 1).
The primer using in table 1 research
The genome of anthrax bacillus A16R strain of take is template, take TBA5641U_F and TBA5641U_R as primer, with Pyrobest archaeal dna polymerase amplification BA5641 upstream region of gene homology arm (being called up fragment), take TBA5641D_F and TBA5641D_R as primer, with Pyrobest archaeal dna polymerase amplification BA5641 gene downstream homology arm (being called down fragment).PCR condition is all as follows: 94 ℃ of 10min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min.System is 100 μ L.
After reaction finishes, the agarose gel electrophoresis with 1% detects amplified production.Result shows, obtained the big or small up ' fragment (comprising upstream homology arm-up fragment) that is about 974bp, and size is about the down ' fragment (comprising downstream homology arm-down fragment) of 1002bp.Separated with 0.6% agarose gel electrophoresis, from gel, cut target stripe, with DNA gel, reclaim test kit and reclaim PCR product (operation steps is carried out to specifications).The nucleotides sequence of up ' fragment is classified " 5 '-ACGACGGCCAGTGCC as
aAGCTTthe 1-933 position of+sequence 1 (upstream homology arm)+AGTGTGATGGATAT
cTGCAG-3 ' ", the nucleotides sequence of down ' fragment is classified " 5 '-GTTACTAGT as
gGATCCthe 2258-3218 position of GAGCT+ sequence 1 (downstream homology arm)+
gAATTCgTAATCATGTCATAG-3 ' ".
(3) amplification of resistance screening marker-spectinomycin resistance gene (Spc) fragment
Use Primer premier5.0 software, according to primer (T6spc_F and the T6spc_R of pT-loxp::spc plasmid sequence design amplification spectinomycin resistance gene (Spc) sequence, as shown in table 1), take pT-loxp::spc plasmid as template, by Pyrobest archaeal dna polymerase amplification Spc fragment, PCR condition is as follows: 94 ℃ of 10min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min.System is 100 μ L.
After reaction finishes, the agarose gel electrophoresis with 1% detects amplified production.Result shows, has obtained the big or small Spc ' fragment (comprising spectinomycin resistance gene-Spc fragment) that is about 1365bp.Separated with 0.6% agarose gel electrophoresis, from gel, cut target stripe, with DNA gel, reclaim test kit and reclaim PCR product (operation steps is carried out to specifications).The nucleotides sequence of Spc ' fragment is classified " 934-2257 position (the spectinomycin resistance gene)+AGCAACTTATGCTCCAAGAC of 5 '-GGATTGATAATGAGGAGGGAT+ sequence 1 " as.
(4) connection of the homologous recombination of each fragment and change turn DH5 α
The linearizing pKSV7 plasmid that utilizes the CloneEZ test kit Connection Step (1) of Jin Sirui company to obtain, the up ' fragment that step (2) obtains, down ' fragment, and the Spc ' fragment that obtains of step (3).Plasmid and every kind of each 6 μ L of fragment, CloneEZ enzyme (product in test kit) 1 μ L, damping fluid (product in test kit) 1 μ L, adds water to 30 μ L systems, hatches 30min for 25 ℃.
Get to connect in bacillus coli DH 5 alpha (purchased from Beijing Lot#G1291009 of the Quan Shi King Company) competent cell that product 4 μ L are added to 40 μ L and softly mix, ice bath 30min, 42 ℃ of thermal shock 90s, ice bath 2min, add LB nutrient solution 1mL, 37 ℃ of jolting 1h, are coated with the LB agar plate containing spectinomycin (300 μ g/mL), put in 37 ℃ of incubators and cultivate.
Containing the several single bacterium colonies of difference picking on the LB agar plate of spectinomycin, shake after bacterium, take TBA5641U_F and TBA5641U_R carries out bacterium colony PCR preliminary evaluation as primer (in Table 1), by identifying through bacterium colony PCR after positive single bacterium colony shakes bacterium, extract plasmid, carry out again Hind III and EcoR I double digestion and identify, and will identify correct plasmid sample presentation order-checking.
Bacterium colony PCR qualification result as shown in Figure 1, can amplify the bacterium colony that size is about the object band of 974bp and be accredited as the positive.Bacterium colony PCR identifies after the positive, extraction plasmid carries out enzyme and cuts evaluation, result as shown in Figure 2, after enzyme is cut, obtain two object bands (the 967-972 position of sequence 1 is EcoRI recognition site sequence) that size is about 2200bp and 970bp left and right, and the plasmid identification of the skeleton carrier band of an about 7kb is positive.Further, by identifying positive plasmid sample presentation order-checking, will show to have inserted the positive plasmid called after pKBA5641USD of DNA fragmentation shown in sequence 1 in sequence table between the Hind of pKSV7 plasmid III and EcoR I restriction enzyme site through order-checking.
2, the demethylation of recombinant vectors pKBA5641USD
Because anthrax bacillus, to the methylated DNA of external source, Degradation can occur, the plasmid that therefore enters anthrax bacillus must demethylation.Intestinal bacteria SCS110 is that dam(can introduce methyl on the VITAMIN B4 N-6 position in the GATC sequence of restriction enzyme identification), dcm(can introduce methyl on the CCAGG of restriction enzyme identification or first cytosine(Cyt) C-5 position in CCTGG sequence) methylase defect, thereby plasmid is base can not occur methylate after copying in its body.So plasmid, before turning anthrax, first proceeds in this bacterium and copies, then extract plasmid and transform again anthrax bacillus.Specific as follows:
(1) SCS110 competent cell preparation
1. the fresh intestinal bacteria SCS110(of picking Quan Shijin Bioisystech Co., Ltd, catalog number is CD311-01) single colony inoculation in the test tube of 5mL LB liquid nutrient medium, put 37 ℃ of shaking tables, 225r/min shaking culture 10h; 2. by 1% inoculum size, above-mentioned bacterium liquid is forwarded in the 500mL triangular flask containing 100mL LB liquid nutrient medium, 37 ℃, 225r/min shaking table shaking culture, treats that cell density OD600nm=0.4 left and right stops cultivating; 3. by the omnidistance ice bath of bacterium liquid ice bath 15min(); 4. collect thalline: 4 ℃, the centrifugal 2min of 6000r/min; 5. the 10% aseptic glycerine of using precooling is resuspended thalline gently, and 4 ℃, 6000r/min is centrifugal, and 2min abandons supernatant; 6. repeating step 5.; 7. the 10% aseptic glycerine of using the precooling of 1mL ice is resuspended thalline gently.8. packing thalline: the volume with 40 μ L/ pipes adds 1.5mL centrifuge tube, and-70 ℃ frozen standby, obtains intestinal bacteria SCS110 competent cell.
(2) recombinant vectors pKBA5641USD electricity turns SCS110
The recombinant vectors pKBA5641USD that gets 1 μ L step 1 preparation, is added in the SCS110 competent cell of 40 μ L, ice bath 2min, and (condition: 0.2cm's electric shock shock by electricity glass; 200 Ω resistance; 2.5kv voltage; 25 μ F electric capacity), add LB nutrient solution 1mL, 30 ℃ of jolting 3h, are coated with the LB agar plate containing Amp microbiotic (the skeleton plasmid pKSV7 of recombinant vectors pKBA5641USD carries Amp resistant gene), put in 30 ℃ of incubators and cultivate.
(3) screening positive clone
The several single bacterium colonies of picking, shake after bacterium, take TBA5641U_F and TBA5641U_R to carry out bacterium colony PCR evaluation as primer (in Table 1), and result is (positive colony amplifies the object band that size is about 970bp) as shown in Figure 3.The correct clone of qualification result is inoculated in 5mL substratum, incubated overnight, utilize AXYGEN plasmid extraction kit (concrete steps are with reference to operation instructions) next day, extract plasmid and carry out Hind III and the evaluation of EcoR I double digestion, result as shown in Figure 4, positive plasmid is cut and is obtained two object bands (the 967-972 position of sequence 1 is EcoR I recognition site sequence) that size is about 2200bp and 970bp left and right through enzyme, and the skeleton carrier band of an about 7kb.Through above-mentioned PCR and enzyme, cut and identify that positive plasmid is demethylation recombinant vectors pKBA5641USD.
Two, the acquisition of the anthrax bacillus A16R △ BA5641::spc of BA5641 genetically deficient
1, the competent preparation of anthrax bacillus A16R and electric shock transform
According to Gao Meiqin etc. (referring to " and Gao Meiqin, Liu Xiankai, Feng Erling; Tang Hengming, Zhu Li, Chen Fusheng; Wang Heng Beam. Bacillus anthracis A16R strain eag gene deletion mutants builds [J]. microorganism journal, 2009,49 (1): 23-31. ") prepare anthrax bacillus A16R competence.Get the demethylation recombinant vectors pKBA5641USD that 4 μ L above-mentioned steps one obtain, be added in the anthrax bacillus A16R competent cell of 40 μ L, ice bath 2min, electric shock (condition: voltage 6kV/cm, electric capacity 25 μ F, resistance 500 Ω), add resuscitation fluid 1mL, put 30 ℃ of jolting 3h, be coated with Cm (5 μ g/mL) resistance BHI dull and stereotyped, in 30 ℃ of incubators, cultivate.
2, transform the screening of successful positive colony
Containing the several single bacterium colonies of picking on the antibiotic BHI agar plate of Cm, shake after bacterium, take pKSV7P6_F and pKSV7P6_R as primer (the inside primer of pKSV7 plasmid, can expand one section of sequence on pKSV7) (in Table 1) carry out bacterium colony PCR evaluation, arrange simultaneously and take the positive control that recombinant vectors pKBA5641USD is template, result is (positive colony amplifies the object band that size is about 500bp) as shown in Figure 5.Correct recombinant bacterium called after A16R/ demethylation pKBA5641USD will be identified through PCR.
3, the screening of anthrax bacillus A16R △ BA5641::spc
According to Gao Meiqin etc. (referring to " and Gao Meiqin; Liu Xiankai; Feng Erling; Tang Hengming, Zhu Li, Chen Fusheng; Wang Heng Beam. Bacillus anthracis A16R strain eag gene deletion mutants builds [J]. microorganism journal; 2009,49 (1): 23-31. ") method, carry out the screening of goal gene (BA5641 gene) deletion mutantion strain.Specific as follows:
(1) knock out BA5641 gene
The A16R/ demethylation pKBA5641USD positive colony obtaining in step 2 is inoculated in 5mL LB nutrient solution, and first on shaking table, 30 ℃, 225r/min shake overnight incubation (12h).In this process, recombinant vectors pKBA5641USD carries out homologous recombination by its entrained BA5641 gene upstream and downstream homology arm and the BA5641 gene upstream and downstream homology arm on A16R strain chromosome, thereby make the Spc fragment on recombinant vectors pKBA5641USD substitute the BA5641 gene on A16R strain chromosome, realize knocking out of BA5641 gene.
(2) lose exogenous plasmid
Above-mentioned steps (1) incubated overnight gained bacterium liquid is transferred in the fresh LB nutrient solution of 4mL according to volume ratio 1:100, at 40 ℃, 225r/min concussion cultivation 10～12h, at 40 ℃, repeats to transfer 9 times and cultivate, plasmid is fully lost, obtain plasmid disappearance bacterium.
(3) resistance screening
Select suitable extent of dilution to be coated with respectively Cm (5 μ g/mL), two kinds of antibiotic BHI agar plates of Spc (300 μ g/mL) the plasmid disappearance bacterium obtaining in above-mentioned steps (2), mono-clonal on next day picking Spc microbiotic plate is put respectively Cm, Spc microbiotic plate, growth on screening Spc microbiotic plate and the clone (Spc that do not grow on Cm microbiotic plate
rcm
s).To the Spc obtaining
rcm
sclone repeats scribe point plate screening 3 times.By the above-mentioned clone (Spc screening
rcm
s) inoculation is containing in Spc and the antibiotic 5mL LB of Cm nutrient solution respectively, at 30 ℃, 225r/min, shake overnight incubation, visual inspection test tube, dilutes 10 the bacterium liquid not growing in containing the antibiotic test tube of Cm containing growth in Spc microbiotic test tube
-4rear painting respectively containing Spc and the antibiotic BHI agar plate of Cm, on result Cm microbiotic plate without any clonal growth, on Spc microbiotic plate, there are a lot of clonal growths, tens clones on random picking Spc microbiotic plate, again on Spc and Cm microbiotic BHI agar plate, rule respectively, 30 ℃ of overnight incubation, the Spc now screening
rcm
sclone is all almost successfully clone of restructuring, is A16R △ BA5641::spc mutant strain.
The evaluation of the anthrax bacillus A16R △ BA5641::spc of embodiment 2, BA5641 genetically deficient
One, molecular level is identified
1, the genomic extraction of A16R △ BA5641::spc mutant strain
Extract in accordance with the following steps the genome of the A16R △ BA5641::spc mutant strain of embodiment 1 structure: 1. get the A16R △ BA5641::spc mutant strain bacterium liquid 3mL of incubated overnight, 12000r/min, centrifugal 1min abandons supernatant as far as possible; 2. add 200 μ L containing TE (pH8.0) damping fluid of 20mg/mL N,O-Diacetylmuramidase and the RNaseA solution of 4 μ L100mg/mL, mix, hatch 3h for 37 ℃; 3. 12000r/min, centrifugal 1min abandons supernatant as far as possible; 4. use aseptic washing twice, the centrifugal 1min of 12000r/min abandons supernatant as far as possible; 5. after, utilize TIANGEN bacterial genomes to extract test kit and extract genomic dna.
2, PCR identifies
(1) identify to be result judging criterion with the design of PCR primer
For up fragment (5125293-5126225 of GenBank:NC003997, i.e. the 1-933 position of sequence 1), design outside primer BA5641us_F and BA5641us_R(in Table A in 1, Fig. 6).Wherein, the 5125107-5125124 position that BA5641us_F is GenBank:NC_003997, is positioned at the upstream of up fragment; BA5641us_R is the reverse complementary sequence of the 1105-1123 position of sequence 1, in Spc fragment (the 934-2257 position of sequence 1).
For down fragment (the 5126645-5127605 position of GenBank:NC_003997, i.e. the 2258-3218 position of sequence 1), design outside primer BA5641sd_F and BA5641sd_R(in Table A in 1, Fig. 6).Wherein, BA5641sd_F is the 1934-1952 position of sequence 1, in Spc fragment (the 934-2257 position of sequence 1); BA5641sd_R is the reverse complementary sequence of the 5127888-5127905 position of GenBank:NC_003997, is positioned at the downstream of down fragment.
For BA5641 gene (5126232-5126669 of GenBank:NC_003997, sequence 2), design inner primer BA5641_F and BA5641_R(in Table A in 1, Fig. 6).Wherein, BA5641_F is the 5126271-5126288 position (the 40-57 position of sequence 2) of GenBank:NC_003997, BA5641_R is the reverse complementary sequence of the 5126625-5126642 position (the 394-411 position of sequence 2) of GenBank:NC_003997, and two inner primer sequences are all positioned at BA5641 gene inside.
Design based on above-mentioned three pairs of primers, only has homologous recombination success, and above-mentioned two outside primers could amplify object band from the genome of restructuring.And if the success of BA5641 gene knockout, is intended to identify that the inside primer whether BA5641 gene is lost cannot amplify object band.As long as utilize two pairs of outside primer amplifications to have object band, and utilize inner primer amplification without object band, homologous recombination success is just described.
(2) PCR detects
The A16R △ BA5641::spc mutant strain genome that the step 1 of usining is extracted, as template, carries out PCR checking with two pairs of outside primers (BA5641us_F/BA5641us_R and BA5641sd_F/BA5641sd_R) and a pair of inner primer (BA5641_F/BA5641_R) (in Table 1).Arrange simultaneously and using the contrast of anthrax bacillus A16R pnca gene group as template.PCR condition following (20 μ L system): reaction conditions becomes according to each primer annealing temperature is different, and the extension time is 2min.
After reaction finishes, with 1% agarose gel electrophoresis, detect amplified production, gel imaging system analytical results, (B in Fig. 6) takes pictures.Result demonstration, for control group, outside primer amplification does not have band, and inner primer amplification has band (object stripe size is 372bp); For experimental group, outside primer amplification has band (object stripe size is 1309bp and 1585bp), and inner primer does not have band.These results suggest that in the A16R △ BA5641::spc mutant strain preparing at embodiment 1, BA5641 gene successfully knocks out from karyomit(e).
3, order-checking
The A16R △ BA5641::spc mutant strain genome of take is template, utilize outside primer BA5641us_F and the order-checking of BA5641us_R amplification products therefrom sample presentation, result shows that this product is comprised of 1309 Nucleotide, the 5125107-5125292 position that wherein 1-186 position is GenBank:NC003997 from 5 ' end, 187-1309 position is the 1-1123 position of sequence 1.The A16R △ BA5641::spc mutant strain genome of take is template, utilize outside primer BA5641sd_F and the order-checking of BA5641sd_R amplification products therefrom sample presentation, result shows that this product is comprised of 1585 Nucleotide, wherein from 5 ' end, 1-1285 position is the 1934-3218 position of sequence 1, the 5127606-5127905 position that 1286-1585 position is GenBank:NC_003997.This result reconfirms that in the A16R △ BA5641::spc mutant strain preparing at embodiment 1, BA5641 gene successfully knocks out from karyomit(e).
Two, protein science is identified
According to the qualification result of step 1 molecular level, be enough to confirm successfully constructing of A16R △ BA5641::spc mutant strain, the present invention has also further carried out further confirmation to A16R △ BA5641::spc mutant strain aspect protein science.
The gemma albumen of the A16R △ BA5641::spc mutant strain that embodiment 1 is built carries out two-dimensional electrophoresis and mass spectroscopy, thereby completes the evaluation to its proteomics.Anthrax bacillus A16R strain is set simultaneously in contrast.Specific as follows:
1, the preparation of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain gemma albumen
L-Ala participates in the sprouting damping fluid of induction: the Tris-Cl of 50mM, 50mM NH
4cl, pH8.9.
Less salt 10 * PBS: sodium-chlor 40g, Repone K 2g, Sodium phosphate dibasic 14.4g, potassium primary phosphate 2.4g, be dissolved in 1L water.
Lysate I: 7mmol/L urea (electrophoresis level), 2mol/L sulphur urine, 4%(quality percentage composition) CHAPS(3-[(3-courage amido propyl)-diethylamine]-propanesulfonic acid), 1%(quality percentage composition) and DTT, solvent is distilled water.
The gemma of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain is placed in to 70 ℃ of thermal shock 30min, then getting respectively 500 μ L gemma liquid adds L-Ala to participate in the sprouting damping fluid of induction, adding final concentration is that the L-Ala of 100mM is as germinant, on shaking table 37 ℃, 225r/min sprouts 2h.Then 4 ℃, the centrifugal 10min of 6000g, collects gemma, with the less salt PBS of precooling, cleans gemma 3 times.Gemma precipitation is resuspended in 750 μ L lysate I, adds half sheet proteinase inhibitor (purchased from Roche company, the U.S. 04693159001, a slice is water-soluble, gets the solution of half), and ice-bath ultrasonic 20min(pulse 2s, stops 4s, peak power 25%).After ultrasonic, add the RQ1DNase of 0.2mg RNaseA, 50 units.In room temperature, place after 1h, the centrifugal 30min of 26000g removes infusible precipitate.Get supernatant and measure protein concn with protein quantification test kit (purchased from GE Healthcare company, U.S. 80-6483-56), by every pipe 800 μ g packing ,-70 ℃ save backup.
2, two-dimensional electrophoresis and mass spectroscopy
By protein purification test kit (purchased from GE Healthcare company, U.S. 80-6484-51) purifying for the packing sample of step 1, with pH4-7 immobilized ph gradient strip, carry out one to isoelectrofocusing (IEF), then carry out two to SDSPAGE.The mode deposition condition following (2 glue of take are example) of permanent power: 8 ℃ of circulator baths are cooling, first under 10mA condition after electrophoresis 1h, electric current is enlarged to 16mA electrophoresis 1h, electrophoresis under last 17W condition is until tetrabromophenol sulfonphthalein stops electrophoresis while just moving out of gel bottom again.After electrophoresis finishes, after coomassie brilliant blue staining, glacial acetic acid decolouring, image scanning, with ImageMaster2D Platinum v5.0, analyze and express discrepancy, with the suction nozzle of cutting (the about 1.5mm in aperture) stamp, get discrepancy, decolour, in-gel digestion and then obtain peptide section extracting solution, then carry out MALDI-TOF-MS analysis.MALDI-TOF-MS analyzes specific as follows: detecting instrument is ULTRAFLEX
tMthe substance assistant laser desorpted ionized flight time mass spectrum of III type (MALDI-TOF/TOF-MS) (German Bruker company).Point target: a-cyano group-4-hydroxycinnamic acid (a-CCA) is dissolved in to the volume fraction containing 0.1%() trifluoroacetic acid and 50%(volume fraction) in the aqueous solution of acetonitrile, make supersaturated solution; After centrifugal, get supernatant 1 μ L and mix with the above-mentioned peptide section of 1 μ L extracting solution etc., get 1 μ L mixed solution point on Scorce384 target, send in ion source and detect.Detection mode is reflection detection; Flight pipe range 3m; Nitrogen laser: wavelength 337nm; Acceleration voltage 20kV; Reflected voltage is 23kV.Log in http://www.matrixscience.Com, by Mascot program, MALDI-TOF-MS is detected to the PMF obtaining and retrieve.
Result shows, anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain have 4 obvious differential expression point (Fig. 7 at Jiao Tushang, arrow indication), these 4 protein sites of anthrax bacillus A16R strain disappear in the albumen two-dimensional electrophoresis figure of A16R △ BA5641::spc mutant strain, these 4 points are carried out to mass spectroscopy, utilize the local database operation Mascot retrieval (relevant information that comprises Bacillus anthracis Ames and Sterne strain and two large plasmids) building, the retrieval of entering dactylogram.They are all target protein for retrieval knot result proofs.This has further confirmed the success of A16R △ BA5641::spc mutation construction on protein level.
The evaluation of embodiment 3, A16R △ BA5641::spc mutant strain and starting strain A16R growth curve and physiological and biochemical property
One, the mensuration of growth curve
Respectively from the fresh culture flat board of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain picking list colony inoculation in the nonresistant LB nutrient solution of 5mL (test tube) after activation culture 12h, in the 500mL triangular flask of transferring containing 100mL LB nutrient solution (containing microbiotic) according to 1% volume, 37 ° of C, 225r/min shaking table shaking culture.Light absorption value every 1h sampling and measuring 600nm place, plots growth curve by these numerical value afterwards.The activation culture of noting two bacterial strains will be synchronizeed with shaking table cultivation.
As shown in Figure 8, the growth of A16R △ BA5641::spc mutant strain is faster than starting strain A16R as seen from the figure for result, and final concentration is also higher.Visible, the A16R △ BA5641::spc mutant strain that embodiment 1 builds does not affect its growth and breeding speed because of the disappearance of BA5641 gene.
Two, the mensuration of physiological and biochemical property
Adopt the CHB/E Physiology and biochemistry reagent strip of Mei Liai company to carry out, specific as follows:
1) the appropriate thalline of scraping from the fresh culture flat board of anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain respectively, respectively adds 1mL0.85%(0.85g/100mL) NaCl solution, mix.
2) the bacterium liquid mixing is dropwise added to 5mL0.85%(0.85g/100mL) in NaCl solution, make 5mL0.85%(0.85g/100mL) turbidity of NaCl solution reaches 2MCF(with reference to opacity tube), the bacterium number of drops " n " that record adds.
3) in API50CHB/E substratum (Mei Liai company product) pipe, add 2n to drip the 1st) the bacterium liquid that mixes in step, then vaccinating agents bar.
4) inoculated after reagent strip, built lid, put 37 ° of C and cultivate, each Taking Pictures recording of 24h, 48h once, is found out the difference of the two.
As shown in Figure 9, as can be seen from the figure, A16R compares result with starting strain, and A16R △ BA5641::spc mutant strain does not have significant difference to sugared utilization.Visible, the A16R △ BA5641::spc mutant strain that embodiment 1 builds does not affect its physiological and biochemical property because of the disappearance of BA5641 gene.
The comparison that embodiment 4, A16R △ BA5641::spc mutant strain and starting strain A16R gemma are sprouted
One, the preparation of gemma
Prepare according to the following steps gemma:
(1) from BHI flat board, distinguish the mono-clonal of picking anthrax bacillus A16R strain and A16R △ BA5641::spc mutant strain, be connected in the test tube that contains 5mL liquid nutrient medium, 37 ℃, 225r/min cultivates 10-12h, and go down to posterity 2 times by 1% volume ratio, obtain activating bacterium liquid;
(2) with rifle, draw the bacterium liquid 1mL having activated in step (1), be incorporated in the Roche bottle that contains 200mL LB solid medium, rock Roche bottle and make bacterium liquid evenly be laid in media surface;
(3) above-mentioned Roche bottle substratum forward is positioned in 37 ℃ of incubators and cultivates 24h, then Roche bottle is forwarded in 30 ℃ of incubators and is inverted and cultivates 10-15d;
(4) then use the 30%(volume content of ice bath) glycerine collect, method is as follows: with 30% glycerine of ice bath after 200mL sterilizing, media surface lawn is washed down in the centrifuge tube that is loaded on 250mL, be placed in self-dissolving chain rupture 16-18h in 48 ℃ of water-baths; Then with aseptic cotton, filter, filtrate is placed in 30-60min in 65 ℃ of water-baths, kills propagulum; Last 4 ℃, the centrifugal 10min of 10000r/min, abandons supernatant, adds 30% glycerine (30mL) washing precipitation, washs 4-5 time;
(5) by the resuspended gemma precipitation of 30% glycerine (about 10mL, specifically depending on gemma amount), and dye with azaleine methylene blue, the purity of microscopy gemma, when gemma purity reaches 98%, puts 4 ℃ of preservations;
(6) dilution spread counting.
Two, gemma is sprouted the comparison of ability
The stimulus that gemma is sprouted has a lot, such as the stimulation of high pressure, nutritive substance, thermal shock etc.The at present known Bacillus anthracis being caused by amino acids material incentive is sprouted path and is mainly contained following four kinds: the 1. dense ALANINE effect of simple height, L-Ala is at present onlyly can trigger separately the material (during concentration >10mmol/L) sprouting, and D-alanine can suppress the trigger action of ALANINE, lower concentration L-Ala is only equipped with other amino acid just to be understood rapid triggering and sprouts; 2. combining of ALANINE and proline(Pro) promotes the effect of sprouting; 3. ALANINE and aromatic amino acid effect; 4. inosine and amino acid effect, can not trigger gemma and sprout during inosine Individual existence, can cause the strong effect of sprouting when adding some aromatic amino acid of people or non-aromatic amino acid as L-Ala, L-Cys, L-Ser etc.
The inductor that this research is sprouted with following five kinds of gemma respectively (also claiming: " germinant "), test A16R △ BA5641::spc mutant strain and the starting strain A16R difference on gemma is sprouted:
1. the ALANINE of high density: the ALANINE that final concentration is 100mM, solvent is the sprouting damping fluid that L-Ala participates in induction.
2. ALANINE and L-PROLINE: the L-PROLINE that the ALANINE that final concentration is 1mM and final concentration are 10mM, solvent is the sprouting damping fluid that L-Ala participates in induction.
3. ALANINE and L-Trp: the L-Trp that the ALANINE that final concentration is 1mM and final concentration are 100mM, solvent is the sprouting damping fluid that L-Ala participates in induction.
4. inosine and L-Trp: the L-Trp that the inosine that final concentration is 1mM and final concentration are 100mM, solvent is the sprouting damping fluid that inosine participates in induction.
5. inosine: the inosine that final concentration is 1mM, solvent is the sprouting damping fluid that inosine participates in induction.
L-Ala participates in the sprouting damping fluid of induction: the Tris-Cl of 50mM, 50mM NH
4cl, pH8.9.
Inosine participates in the sprouting damping fluid of induction: 10mM Tris-Cl, 10mM NaCl, pH8.0.
Concrete grammar is as follows:
(1) get respectively A16R △ BA5641::spc mutant strain prepared by 1mL step 1 and the gemma liquid of starting strain A16R, be placed in 70 ℃ of water-bath water-bath 30min, kill propagulum; Be placed on ice and preserve, in 8-10h, use;
(2) preparation gemma is sprouted damping fluid, as follows:
There is L-Ala to participate in the sprouting damping fluid of sprouting: 50mM Tris-Cl, 50mM NH
4cl, pH8.9;
There is inosine to participate in the sprouting damping fluid of sprouting: 10mM Tris-Cl, 10mM NaCl, pH8.0.
Filtration sterilization, is sub-packed in the triangular flask of 500mL, is divided into and fills 4 bottles, refilters degerming after wherein adding germinant in two bottles;
(3) draw respectively two kinds of gemma liquid processing in 200 μ L steps (1), add containing 100mL gemma and sprout in the triangular flask of damping fluid, every group all will arrange contrast, to one bottle, contains gemma germinant and one bottle respectively and containing in the damping fluid of gemma germinant, does not add gemma liquid;
(4) sample is placed in to 37 ℃ it is sprouted, from zero light absorption value constantly starting every its 580nm of 2min sampling survey;
(5) Treatment Analysis data, with zero OD constantly recording
580value as benchmark, later each value is constantly worth divided by this, obtain ratio, mapping.Gemma germination rate is higher, OD
580be worth lower.
Experimental result:
1) ALANINE of high density is induced separately:
Result as shown in figure 10, does not add germinant in control group, added the ALANINE of 100mM in experimental group.As seen from the figure, A16R compares with starting strain, A16R △ BA5641::spc mutant strain under the induction of the ALANINE of 100mM, the sprouting rate reduction of gemma.Visible, the disappearance of BA5641 gene makes the ALANINE gemma sprouting rate reduction of induction separately.
2) ALANINE and L-PROLINE are induced jointly
Result as shown in figure 11, does not add germinant in control group, added the ALANINE of 1mM and the L-PROLINE of 10mM in experimental group.As seen from the figure, A16R compares with starting strain, A16R △ BA5641::spc mutant strain under the common induction of the ALANINE of 1mM and the L-PROLINE of 10mM, the sprouting rate reduction of gemma.Visible, BA5641 genetically deficient makes the gemma of ALANINE and the common induction of L-PROLINE sprout rate reduction.
3) ALANINE and L-Trp are induced jointly
Result as shown in figure 12, does not add germinant in control group, added the ALANINE of 1mM and the L-Trp of 100mM in experimental group.As seen from the figure, A16R compares with starting strain, A16R △ BA5641::spc mutant strain under the common induction of the ALANINE of 1mM and the L-Trp of 100mM, the sprouting rate reduction of gemma.Visible, the disappearance of BA5641 gene makes the gemma of ALANINE and the common induction of L-Trp sprout rate reduction.
4) inosine and L-Trp are induced jointly
Result as shown in figure 13, does not add germinant in control group, added the inosine of 1mM and the L-Trp of 100mM in experimental group.As seen from the figure, A16R compares with starting strain, A16R △ BA5641::spc mutant strain under the common induction of the inosine of 1mM and the L-Trp of 100mM, the sprouting rate reduction of gemma.Visible, the disappearance of BA5641 gene makes the gemma of inosine and the common induction of L-Trp sprout rate reduction.
5) inosine is induced separately
Result as shown in figure 14, does not add germinant in control group, added the inosine of 1mM in experimental group.As seen from the figure, A16R compares with starting strain, A16R △ BA5641::spc mutant strain under the induction of the inosine of 1mM, the sprouting rate reduction of gemma.Visible, the disappearance of BA5641 gene is sprouted not impact of speed to the gemma of inosine induction.
By above 1)-5) result can find out, the ALANINE of high density (100mM) can induce separately the gemma sprouting of anthrax bacillus, the ALANINE (1mM) of lower concentration, although can not effectively induce the gemma of anthrax bacillus to sprout, can effectively induce the gemma of anthrax bacillus to sprout when jointly using with L-PROLINE (10mM) and L-Trp (100mM) respectively; Inosine can not be induced separately sprouting, but can induce the gemma of Bacillus anthracis to sprout with L-Trp acting in conjunction.And when the gemma of A16R △ BA5641::spc mutant strain is induced agent induction sprouting, it is more a lot of slowly than starting strain A16R that it sprouts speed, and the disappearance of hence one can see that BA5641 gene can play restraining effect to the ALANINE of high density, ALANINE and L-PROLINE, ALANINE and L-Trp, inosine with the sprouting that L-Trp is induced.
Claims (10)
1. recombinant bacterium, is to be the DNA fragmentation that contains resistance screening marker gene by the BA5641 Gene Replacement in anthrax bacillus genome, the recombinant bacterium obtaining.
2. recombinant bacterium according to claim 1, is characterized in that: the coding region sequence of described BA5641 gene is sequence 2 in sequence table.
3. recombinant bacterium according to claim 1 and 2, is characterized in that: described resistance screening marker gene is spectinomycin resistance gene;
The nucleotide sequence of described spectinomycin resistance gene is specially the 1032-2161 position of sequence 1 in sequence table; Or
The nucleotides sequence of the described DNA fragmentation that contains resistance screening marker gene is classified the 934-2257 position of sequence 1 in sequence table as.
4. according to arbitrary described recombinant bacterium in claim 1-3, it is characterized in that: described anthrax bacillus is anthrax bacillus A16R strain.
5. recombinant bacterium according to claim 4, it is characterized in that: described recombinant bacterium is following recombinant bacterial strain: in the genome sequence of described anthrax bacillus A16R strain, by at nucleotides sequence, classify as the DNA fragmentation shown in the 1-933 position of sequence 1 in sequence table and nucleotides sequence classify sequence table as in sequence between the DNA fragmentation shown in the 2258-3218 position of sequence 1, replace with the 934-2257 position of sequence 1 in sequence table, the recombinant bacterial strain obtaining.
6. the method for preparing arbitrary described recombinant bacterium in claim 1-5, comprises the steps:
(a) following nucleotide fragments is cloned in responsive to temperature type shuttle plasmid, obtains recombinant vectors;
Described nucleotide fragments is followed successively by from 5 ' end to 3 ' end: the DNA fragmentation 1 that is positioned at described BA5641 upstream region of gene in the genome sequence of anthrax bacillus described in claim 1-5 is arbitrary, resistance screening marker gene described in claim 1-5 is arbitrary, and the DNA fragmentation 2 that is positioned at described BA5641 gene downstream in the genome sequence of anthrax bacillus described in claim 1-5 is arbitrary;
(b) the described recombinant vectors obtaining in step (a) is imported to the anthrax bacillus of claim 1-5 described in arbitrary, and cultivate at the non-sensitive temperature of described shuttle plasmid, obtain recombinant bacterium intermediate;
(c) the recombinant bacterium intermediate obtaining in step (b) is cultivated under the sensitive temperature of described shuttle plasmid, to remove described recombinant vectors, obtained described recombinant bacterium.
7. method according to claim 6, is characterized in that: described DNA fragmentation 1 is the DNA fragmentation shown in the 1-933 position Nucleotide of sequence 1 in sequence table, and described DNA fragmentation 2 is the DNA fragmentation shown in the 2258-3218 position Nucleotide of sequence 1 in sequence table; Or
The sequence of described nucleotide fragments is sequence 1 in sequence table; And/or
Described responsive to temperature type shuttle plasmid is pKSV7 plasmid; And/or
Described non-sensitive temperature is 30 ℃, and described sensitive temperature is 37 ℃-40 ℃.
8. according to the method described in claim 6 or 7, it is characterized in that: in described method, in step (a), also comprise before the step of described recombinant vectors demethylation;
Described by the method for described recombinant vectors demethylation, specifically comprise the steps: described recombinant vectors to import in the intestinal bacteria of methylase defect, obtain recombination bacillus coli; From described recombination bacillus coli, extract plasmid, obtain the recombinant vectors of demethylation;
Described intestinal bacteria are specially intestinal bacteria SCS110.
9. the biomaterial of following (1) or (2):
(1) DNA molecular, its nucleotide sequence is as shown in sequence in sequence table 1;
(2) contain the recombinant vectors of DNA molecular, expression cassette, recombinant cell lines or recombinant bacterium described in (1) in steps;
Described recombinant vectors is specially described DNA molecular is inserted into the recombinant plasmid obtaining in responsive to temperature type shuttle plasmid;
Described responsive to temperature type shuttle plasmid is specially pKSV7 plasmid.
10. the application of arbitrary described recombinant bacterium in preparing Anthrax vaccine in claim 1-5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310062204.3A CN104004696A (en) | 2013-02-27 | 2013-02-27 | Bacillus anthracis with BA5641 gene deleted and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310062204.3A CN104004696A (en) | 2013-02-27 | 2013-02-27 | Bacillus anthracis with BA5641 gene deleted and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104004696A true CN104004696A (en) | 2014-08-27 |
Family
ID=51365606
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310062204.3A Pending CN104004696A (en) | 2013-02-27 | 2013-02-27 | Bacillus anthracis with BA5641 gene deleted and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004696A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003057834A2 (en) * | 2001-12-26 | 2003-07-17 | University Of Central Florida | Expression of protective antigens in transgenic chloroplasts and the production of improved vaccines |
| CN101812424A (en) * | 2010-02-26 | 2010-08-25 | 中国人民解放军军事医学科学院生物工程研究所 | Thymine auxotrophic bacillus anthracis and application thereof |
| CN102628019A (en) * | 2012-04-06 | 2012-08-08 | 中国人民解放军军事医学科学院生物工程研究所 | Bacillus anthracis strain with lysine synthesizing defect and constructing method thereof |
-
2013
- 2013-02-27 CN CN201310062204.3A patent/CN104004696A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003057834A2 (en) * | 2001-12-26 | 2003-07-17 | University Of Central Florida | Expression of protective antigens in transgenic chloroplasts and the production of improved vaccines |
| CN101812424A (en) * | 2010-02-26 | 2010-08-25 | 中国人民解放军军事医学科学院生物工程研究所 | Thymine auxotrophic bacillus anthracis and application thereof |
| CN102628019A (en) * | 2012-04-06 | 2012-08-08 | 中国人民解放军军事医学科学院生物工程研究所 | Bacillus anthracis strain with lysine synthesizing defect and constructing method thereof |
Non-Patent Citations (3)
| Title |
|---|
| HONGBIN LIU ET AL: "FORMATION AND COMPOSITION OF THE BACILLUS ANTHRACIS ENDOSPORE", 《JOURNAL OF BACTERIOLOGY》 * |
| 高美琴 等: "炭疽芽孢杆菌A16R株eag基因缺失突变株构建", 《微生物学报》 * |
| 高飞 等: "炭疽芽孢杆菌A16R株lysA基因缺失突变株的构建", 《军事医学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Atabay et al. | Identification of unusual Campylobacter‐like isolates from poultry products as Helicobacter pullorum | |
| Jeffery et al. | Isolation of a cyprinid herpesvirus 2 from goldfish, Carassius auratus (L.), in the UK | |
| Bi et al. | Contribution of AhyR to virulence of Aeromonas hydrophila J-1 | |
| US8956628B2 (en) | Bacteriophage preparations and method of use thereof | |
| de Freitas Raso et al. | Chlamydophila psittaci in free-living Blue-fronted Amazon parrots (Amazona aestiva) and Hyacinth macaws (Anodorhynchus hyacinthinus) in the Pantanal of Mato Grosso do Sul, Brazil | |
| Stevens et al. | Characterization of a Haemophilus ducreyi mutant deficient in expression of cytolethal distending toxin | |
| Huang et al. | Dual RNA-Seq unveils Pseudomonas plecoglossicida htpG gene functions during host-pathogen interactions with Epinephelus coioides | |
| CN104962558A (en) | Specific primers for detection of riemerella anatipestifer and PCR (Polymerase Chain Reaction) detection kit | |
| Foysal et al. | Molecular characterization and interactome analysis of aerolysin (aer) gene from fish pathogen Aeromonas veronii: The pathogenicity inferred from sequence divergence and linked to histidine kinase (cheA) | |
| CN106048065A (en) | PCR amplimer for environmental DNA detection of Chinese sturgeon, detection method using PCR amplimer and application of PCR amplimer | |
| Shivaprasad et al. | A novel herpesvirus associated with respiratory disease in Bourke's parrots (Neopsephotus bourkii) | |
| Nigam et al. | Evaluation of antibacterial activity and innate immune components in skin mucus of Indian major carp, Cirrhinus mrigala | |
| CN104073450A (en) | Goat source arcanobacterium pyogenes and application thereof | |
| CN102994534A (en) | Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP | |
| Fang et al. | Co-Infection of Escherichia coli, Enterococcus faecalis and chlamydia psittaci contributes to salpingitis of laying layers and breeder ducks | |
| Vogt et al. | Oral application of recombinant Bacillus subtilis spores to dogs results in a humoral response against specific Echinococcus granulosus paramyosin and tropomyosin antigens | |
| Sun et al. | Transcriptome analysis of Fusarium–Tomato interaction based on an updated genome annotation of Fusarium oxysporum f. sp. lycopersici identifies novel effector candidates that suppress or induce cell death in Nicotiana benthamiana | |
| Ma et al. | Avian influenza virus, Streptococcus suis serotype 2, severe acute respiratory syndrome-coronavirus and beyond: molecular epidemiology, ecology and the situation in China | |
| CN103436619A (en) | Method for identifying atypical Escherichia coli in calf diarrhea | |
| CN104004696A (en) | Bacillus anthracis with BA5641 gene deleted and construction method thereof | |
| Wu et al. | Study on the mechanism of Mycoplasma gallisepticum infection on chicken tracheal mucosa injury | |
| Li et al. | Deletion of the oligopeptide transporter Lmo2193 decreases the virulence of Listeria monocytogenes | |
| JP2012509075A (en) | Salmonella marker vaccine | |
| Wang et al. | Identification of Subunits for Novel Universal Vaccines against Three Predominant Serogroups and the Emerging O145 among Avian Pathogenic Escherichia coli by Pan-RV Pipeline | |
| CN108251546A (en) | A kind of Forecasting Methodology of lactobacillus plantarum endogenous signal peptides and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140827 |