CN103993072A - Multiple PCR detection kit for rapidly identifying pathogenic Pseudomonas plecoglossicida, and method thereof - Google Patents
Multiple PCR detection kit for rapidly identifying pathogenic Pseudomonas plecoglossicida, and method thereof Download PDFInfo
- Publication number
- CN103993072A CN103993072A CN201410150633.0A CN201410150633A CN103993072A CN 103993072 A CN103993072 A CN 103993072A CN 201410150633 A CN201410150633 A CN 201410150633A CN 103993072 A CN103993072 A CN 103993072A
- Authority
- CN
- China
- Prior art keywords
- pseudomonas
- pathogenic
- sweetfish
- pcr
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a multiple PCR detection kit for rapidly identifying pathogenic Pseudomonas plecoglossicida, and a method thereof. The kit comprises TaqDNA polymerase, a PCR buffer, a deoxyribonucleoside triphosphate mixture, double distilled water, and primer pairs of Pseudomonadaceae, Pseudomonas plecoglossicida and pathogenic Pseudomonas plecoglossicida. The multiple PCR detection method for rapidly identifying pathogenic Pseudomonas plecoglossicida by using the kit comprises: primary separation of Pseudomonadaceae, and multiple PCR amplifications. Compared with the kit and the method in the prior art, the kit and the method of the present invention have the following advantages that: with application of the kit of the present invention to detect, Pseudomonadaceae, Pseudomonas plecoglossicida and pathogenic Pseudomonas plecoglossicida corresponding to the DNA primer pairs of the three Pseudomonadaceae can be rapidly detected, and with the detection method of the present invention, the presence of the Pseudomonadaceae can be rapidly, sensitively and specifically determined by using the kit, and the pathogenic stain and the non-virulent environment isolation strain can be distinguished.
Description
Technical field
The present invention relates to the detection technique of sweetfish pseudomonas, especially a kind of multiple PCR detection kit and method thereof that relates to the pathogenic sweetfish pseudomonas of Rapid identification.
Background technology
Report and had pathogenic pseudomonas species to kill eel pseudomonas (Pseudomonas anguillacida) to fish, Pseudomonas fluorescens (P.fluorescens), pseudomonas putida (P.putida) and sweetfish pseudomonas (P.plecoglossicida) etc., wherein latter 3 kinds belong to fluorescent type pseudomonas DNA I type, in form with similar on part physicochemical property, especially pseudomonas putida and sweetfish pseudomonas, these two kinds of bacterium belong to pseudomonas putida group in classification, very approaching on physicochemical property, 16S rRNA gene order homology reaches more than 99%, these two kinds of bacterium all can not be effectively distinguished in conventional physicochemical property qualification and the comparison of 16S rRNA gene sequencing.Sweetfish pseudomonas NB2011 is the virulent strain pathogenic to large yellow croaker, causes large yellow croaker internal organ ichthyophthiriasis, the solution of NB2011 pnca gene group is known to result to be shown, there is III type excretory system (Type III secretion system in this bacterial strain, TTSS), its sequence in the gene is similar to the TTSS that mankind pathogenic bacteria Pseudomonas aeruginosa (P.aeruginosa) exists, but in part-structure and functional gene sequence, there is higher specificity, if exoU may be the most important cytotoxin of NB2011TTSS to host cell secretion, the homology of its aminoacid sequence and Pseudomonas aeruginosa corresponding protein (WP_023097922) is the highest, also be only 45%, nucleotides sequence lists does not have obvious similarity, the secretion of exoU is subject to regulating the strict regulation and control of albumen exsA, the homology of NB2011exsA and Pseudomonas aeruginosa corresponding protein (NP_250404) is 65%, nucleotide sequence similarity is lower than 70%, and this species specificity is for differentiating that pathogenic strains provides good basis.Sweetfish pseudomonas be simultaneously physical environment as the normal member of microbial population in water body, environment separation strain does not generally have virulence to fish; Pilot study result in advance shows, does not have TTSS and corresponding virulence factor and modulin in the sweetfish pseudomonas strains of environment separation.Therefore analyze in advance, detect and determine the kind of infectious bacteria and pathogenicly just seem particularly important.
The method that detects at present sweetfish pseudomonas infection mainly comprises: the biotechnology diagnostic methods such as Physiology and biochemistry detection, pathological study, microscope inspection and PCR.The detection of fish bacterial pathogens sweetfish pseudomonas is disclosed to following test kit as the Chinese invention patent application of an application number 201210466878.5 (publication No. is CN102952884A) " LAMP detection kit and the detection method of a kind of fish bacterial pathogens sweetfish pseudomonas ": comprise reaction buffer, MgSO4 solution, dNTP liquid, Bst archaeal dna polymerase liquid, alkali solution of beet, FIP/BIP primer solution, F3/B3 primer solution and distilled water, this LAMP detection kit has highly sensitive to sweetfish pseudomonas, high specific, it is target-gene sequence that but this method adopts ubiquitous house-keeping gene rpoD in bacterial strain, can not distinguish simultaneously and have the pathogenic strain of virulence and avirulent environment separation strain, lack enough specificitys.
Therefore, this has researched and developed a kind of Multiplex PCR, can differentiate fast conventional pseudomonas and sweetfish pseudomonas, detects pathogenic bacterial strains wherein simultaneously, distinguishes avirulent environment separation strain.
Summary of the invention
A technical problem to be solved by this invention is to provide the multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification, this detection kit can be measured the existence of sweetfish pseudomonas rapidly, sensitively, specifically, distinguishes pathogenic strain and avirulent environment separation strain simultaneously.
Another technical problem to be solved by this invention is to provide a kind of multi-PCR detection method of applying the pathogenic sweetfish pseudomonas of test kit Rapid identification, detect the method for pathogenic sweetfish pseudomonas by this detection kit, can monitor technique means is provided for Related Bacteria detection and environmental bacteria in aquaculture.
The present invention solves the problems of the technologies described above adopted technical scheme: the multiple PCR detection kit of the pathogenic sweetfish pseudomonas of this Rapid identification, is characterized in that: described test kit comprises the primer pair of TaqDNA polysaccharase, PCR damping fluid, deoxyribonucleoside triphosphate mixture, redistilled water and pseudomonas, sweetfish pseudomonas, pathogenic sweetfish pseudomonas;
Wherein, the upstream and downstream primer of the pseudomonads R NA polysaccharase gyrB of subunit is:
P1:5’CAACTCSGGCGTTGGCATYCTGCT3’；
P2:5’CARG?ATCGCCTGGGTRCGACGGTT3’；
The upstream and downstream primer of sweetfish pseudomonas gyrB is:
P3:5’CTGCTGAAGGACGAGCGTTC3’；
P4:5’GGTCATCTCACGAGCTTTCG3’；
The upstream and downstream primer of pathogenic sweetfish pseudomonas III type excretory system regulatory factor exsA is:
P5:5’TTGCTCAGCGAGATCAAAC3’；
P6:5’GCTCATCTATCCAAACCCTC3’。
Further, described test kit is specifically made up of following reagent: TaqDNA polysaccharase 0.05mL, 10 × PCR damping fluid 0.5mL, deoxyribonucleoside triphosphate mixture 0.25mL, redistilled water 5mL and concentration are respectively pseudomonas, the sweetfish pseudomonas of 10 μ M, the primer pair 200 μ L of pathogenic sweetfish pseudomonas.
The present invention also provides the multi-PCR detection method of the pathogenic sweetfish pseudomonas of application mentioned reagent box Rapid identification, it is characterized in that comprising the steps:
1) initial gross separation of pseudomonas: extract genomic dna from the substratum of pseudomonas, the standby pcr template of doing;
Wherein, pseudomonas CFC selective medium separates suspicious bacterium colony from sick fish viscera and cultivation are aseptic in water sample, to logarithmic phase, extract genomic dna through cetyl trimethylammonium bromide method (CTAB method) with LB culture medium culturing, the standby pcr template of doing.
2) multiplex PCR amplification comprises: a, multiplex PCR amplification reaction system: reaction system is 20-30.0 μ L, each reaction product is respectively TaqDNA polysaccharase 0.02U/ μ L, PCR damping fluid 2.5 μ L, deoxyribonucleoside triphosphate mixture 1.0mmol/L, the each 0.2-0.24 μ of primer P1, P2 mol/L, the each 0.4-0.6 μ of P3, P4 mol/L, the each 0.32-0.48 μ of P5, P6 mol/L, surplus is supplied with redistilled water; B, amplification reaction condition: 94 DEG C of denaturation 4min, 94 DEG C of sex change 30s, 60.4 DEG C of annealing 45s, 72 DEG C are extended 40s, circulate 30 times, and 10min is extended at 72 DEG C of whole ends; C, the amplified production of step b is carried out to electrophoresis detection and interpretation of result.
Further, the reaction system of the multiplex PCR amplification of described step a is specially 25.0 μ L, each reaction product is respectively TaqDNA polysaccharase 0.25 μ L, 10 × PCR damping fluid, 2.5 μ L, deoxyribonucleoside triphosphate mixture 1.0 μ L, the each 0.5 μ L of primer P1, P2, the each 1.0 μ L of P3, P4, the each 1.0 μ L of P5, P6, redistilled water complements to cumulative volume 25.0 μ L.
By electrophoresis detection and interpretation of result, (1) PCR product only has a band of 745bp if find, having indicated detection bacterial strain is the close kind of Rhodopseudomonas pseudomonas putida; (2) if find there are two bands of 745bp and 570bp in PCR product, and having indicated detection bacterial strain is the strain of sweetfish pseudomonas environment separation; (3) if find, PCR product has three bands of 745bp, 570bp and 446bp, and it is pathogenic sweetfish pseudomonas that instruction detects bacterial strain; (4) if find without PCR product, or without above-mentioned signature band, indicate other bacteriums of non-Rhodopseudomonas.
Compared with prior art, the invention has the advantages that: use test kit of the present invention to detect and just can detect rapidly the pseudomonas corresponding with the DNA primer of above-mentioned three kinds of pseudomonass, sweetfish pseudomonas, pathogenic sweetfish pseudomonas, detection method of the present invention is utilized above-mentioned test kit energy fast in addition, sensitive, measure specifically the existence of pseudomonas, can also distinguish pathogenic strain and avirulent environment separation strain simultaneously, detect consuming time short, simple to operation, can save a large amount of labours and financial resources, be applicable to the requirement of rapid detection, and instrument is required simple, for the early prevention and treatment of sweetfish pseudomonas disease provides technical support.
preservation explanation
1, large yellow croaker pathogenic strain NB2011, be sweetfish pseudomonas Pseudomonas plecoglossicida, on April 1st, 2014, be preserved in common micro-organisms DSMZ of China Committee for Culture Collection of Microorganisms (CGMCC), deposit number is CGMCCNo.8985.
Brief description of the drawings
Fig. 1 is the electrophoresis detection result that multiplex PCR is differentiated the close bacterial strain of sweetfish pseudomonas and pathogenic strain and avirulent environment separation strain;
Fig. 2 is the sensitivity test result that multiplex PCR detects pathogenic strain;
Fig. 3 is the specificity that multiplex PCR is differentiated the close bacterial strain of Rhodopseudomonas sweetfish pseudomonas;
Fig. 4 is that multiplex PCR is to infecting the electrophorogram of fish tissue DNA detected result;
Fig. 5 is the electrophoresis detection result of multiplex PCR to seawater sample.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the invention will be further described.
Embodiment 1
A kind of pathogenic sweetfish pseudomonas multiple PCR detection kit, this test kit is specifically made up of following reagent:
TaqDNA polysaccharase 0.05mL, 10 × PCR damping fluid 0.5mL, deoxyribonucleoside triphosphate mixture 0.25mL, redistilled water 5mL, concentration be respectively 10 μ M 3 pairs of Auele Specific Primers, 200 μ L, be respectively the pseudomonads R NA polysaccharase gyrB of subunit upstream and downstream primer P1, P2, sweetfish pseudomonas gyrB upstream and downstream primer P3, P4 and pathogenic sweetfish pseudomonas III type excretory system regulatory factor exsA upstream and downstream primer P5 and P6.
Wherein, the inner conserved sequence of gyrB gene that by gene accession number is the bacterial strain such as Pseudomonas fluorescens, pseudomonas putida and sweetfish pseudomonas of CP000094.2, KC189956.1, AB178859.1 designs relative degenerated primers, and target sequence length is 745bp; Wherein, the upstream and downstream primer of the pseudomonads R NA polysaccharase gyrB of subunit is:
P1:5’CAACTCSGGCGTTGGCATYCTGCT3’；
P2:5’CARG?ATCGCCTGGGTRCGACGGTT3’；
The inner conserved sequence of gyrB gene that is AB178862, JN688866.1, ASJX00000000 by gene accession number is template, design sweetfish pseudomonas gyrB upstream and downstream primer P3, P4, and target sequence length is 570bp; The upstream and downstream primer of sweetfish pseudomonas gyrB is:
P3:5’CTGCTGAAGGACGAGCGTTC3’；
P4:5’GGTCATCTCACGAGCTTTCG3’；
Be that in ASJX00000000NB2011 genome, III type excretory system modulin exsA gene is template by gene accession number, design exsA upstream and downstream primer P5 and P6, target sequence length is 446bp;
And the upstream and downstream primer of pathogenic sweetfish pseudomonas III type excretory system regulatory factor exsA is:
P5:5’TTGCTCAGCGAGATCAAAC3’；
P6:5’GCTCATCTATCCAAACCCTC3’；
Primer sequence is by Primer premier6.0 design, synthetic through Shanghai Sheng Gong biotechnology company limited.
Embodiment 2
The multi-PCR detection method of the pathogenic sweetfish pseudomonas of test kit Rapid identification of Application Example 1:
1, the initial gross separation of pseudomonas: with pseudomonas CFC selective medium suspicious bacterium colony of aseptic separation in sick fish viscera and cultivation water sample.
2, DNA profiling preparation: to logarithmic phase, extract genomic dna through CTAB method with Luria Broth (LB) culture medium culturing, the standby pcr template of doing.
3, the program that multiplex PCR detects: amplification system 25.0 μ L, comprise TaqDNA polysaccharase (Taq enzyme) 0.02U/ μ L, 10 × PCR damping fluid 0.5mL, deoxyribonucleoside triphosphate (dNTPmix) 1.0mmol/L, getting 0.5 μ L concentration is Auele Specific Primer P1, the P2 of 0.2 μ mol/L, 1.0 μ L concentration are Auele Specific Primer P3, the P4 of 0.5 μ mol/L, 1.0 μ L concentration are Auele Specific Primer P5, the P6 of 0.4 μ mol/L, DNA profiling solution 40ng/ μ L, redistilled water complements to 25.0 μ L.In the enterprising performing PCR amplification of Eppendorf Mastercycler, PCR program is 94 DEG C of denaturations, 4min, 94 DEG C of sex change, 30s, anneal 60.4 DEG C, 45s, extend 72 DEG C, 40s, circulate 30 times, end is extended 72 DEG C eventually, 10min, after reaction finishes, extract reaction solution each 3 μ L and carry out 1.0% agarose gel electrophoresis, deposition condition: electric current 50mA, voltage 100mv, electrophoresis time 45min, after with Bio-Rad gel imaging system take imaging, result as shown in Figure 1, wherein, M is DNA molecular amount standard DL2000, 1 is sweetfish pseudomonas NB2011 strain, 2 is the strain of sweetfish pseudomonas environment separation, 3 is the strain of pseudomonas putida environment separation, 4 negative contrasts.
Embodiment 3
Carry out multiple proportions gradient dilution according to the DNA profiling solution extracting in embodiment 2 methods, concentration is from 1050ng/ μ L to 1ng/ μ L, implementing the multiplex PCR identical with embodiment 2 detects, 3 specificity object bands all can clearly increase in >=4ng/ μ L concentration range, the sensitivity that shows the DNA that multiplex PCR that the present invention sets up can detect is 4ng/ μ L, result as shown in Figure 2, wherein M is DNA molecular amount standard DL2000, it is 1050ng/ μ L that 1-10 is respectively template DNA concentration, 525ng/ μ L, 258ng/ μ L, 129ng/ μ L, 65ng/ μ L, 32ng/ μ L, 16ng/ μ L, 8ng/ μ L, 4ng/ μ L, 2ng/ μ L, the detected result of multiplex PCR when 1ng/ μ L, the negative contrast of swimming lane 11.
Embodiment 4
Respectively to Pseudomonas aeruginosa, Pseudomonas fluorescens, pseudomonas putida, sweetfish pseudomonas (pathogenic strain and environment separation strain, wherein environment separation strain is provided by National Bureau of Oceanography's marine microorganism preservation center), Vibrio harveyi, Vibrio parahaemolyticus, vibrio alginolyticus and Aeromonas hydrophila etc. extract template DNA according to the method for embodiment 2, carrying out identical multiplex PCR detects, electrophoresis result is as Fig. 3, show that the multiplex PCR that the present invention sets up can detect sweetfish pseudomonas specifically, distinguishes pathogenic strain and environment separation strain simultaneously.Wherein, M is DNA molecular amount standard DL2000, swimming lane 1-9 represents respectively sweetfish pseudomonas NB2011, sweetfish pseudomonas environment separation strain (MCCC1A00022), pseudomonas putida (CGMCC1.8092), Pseudomonas fluorescens (CGMCC1.6279), Pseudomonas aeruginosa (CGMCC1.10712), Aeromonas hydrophila, vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio harveyi, the negative contrast of swimming lane 10.
Embodiment 5
Get the large yellow croaker liver of non-evident sympton in region of disease net cage, kidney, the viscera tissues such as spleen are worn into tissue juice with sterile grinder, get 1.5mL tissue juice in sterilizing centrifuge tube, 5000rpm, centrifugal 5min, abandon supernatant, add aqua sterilisa, 6000rpm, centrifugal 5min centrifuge washing 3 times repeatedly, in precipitation, add TE damping fluid 1mL, suspend, 6000rpm, centrifugal 5min, collecting precipitation, be bacterial extract, then carry out extraction and the multiplex PCR detection of DNA profiling according to the method for embodiment 2, electrophoresis result as shown in Figure 4, wherein, M is DNA molecular amount standard DL2000, swimming lane 1-3, 4-6 represents respectively morbidity fish and healthy fish liver, kidney and spleen tissue extraction DNA profiling, the negative contrast of swimming lane 7, result shows, infect the band that 3 entries appear in fish viscera tissue sample, and nothing in normal healthy controls fish illustrates that present method can detect early infection exactly.
Embodiment 6
Gather away from culture zone seawater, healthy aquaculture district and large yellow croaker morbidity net cage seawater, by concentrated 100 times of centrifugal enrichment method, get 1.5mL enriching seawater, sterilizing seawater is set simultaneously, sterilizing seawater interpolation pathogenic strain contrasts with environment separation strain, implement the method identical with embodiment 2 and carry out DNA profiling extraction and multiplex PCR detection, electrophoresis result as shown in Figure 5, wherein, M is DNA molecular amount standard DL2000, swimming lane 1-6 represents that respectively sterilizing seawater adds environment separation strain, sterilizing seawater adds pathogenic strain NB2011, sterilizing seawater, away from culture zone seawater, healthy aquaculture district seawater and morbidity net cage seawater, swimming lane 7 is not for adding the negative control of template.
Claims (4)
1. a multiple PCR detection kit for the pathogenic sweetfish pseudomonas of Rapid identification, is characterized in that: described test kit comprises the primer pair of TaqDNA polysaccharase, PCR damping fluid, deoxyribonucleoside triphosphate mixture, redistilled water and pseudomonas, sweetfish pseudomonas, pathogenic sweetfish pseudomonas;
Wherein, the upstream and downstream primer of the pseudomonads R NA polysaccharase gyrB of subunit is:
P1:5’CAACTCSGGCGTTGGCATYCTGCT3’；
P2:5’CARG?ATCGCCTGGGTRCGACGGTT3’；
The upstream and downstream primer of sweetfish pseudomonas gyrB is:
P3:5’CTGCTGAAGGACGAGCGTTC3’；
P4:5’GGTCATCTCACGAGCTTTCG3’；
The upstream and downstream primer of pathogenic sweetfish pseudomonas III type excretory system regulatory factor exsA is:
P5:5’TTGCTCAGCGAGATCAAAC3’；
P6:5’GCTCATCTATCCAAACCCTC3’。
2. the multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification as claimed in claim 1, is characterized in that: described test kit is specifically made up of following reagent:
TaqDNA polysaccharase 0.05mL, 10 × PCR damping fluid 0.5mL, deoxyribonucleoside triphosphate mixture 0.25mL, redistilled water 5mL and concentration are respectively pseudomonas, the sweetfish pseudomonas of 10 μ M, the primer pair 200 μ L of pathogenic sweetfish pseudomonas.
3. a multi-PCR detection method for the pathogenic sweetfish pseudomonas of application test kit Rapid identification as claimed in claim 2, is characterized in that comprising the steps:
1) initial gross separation of pseudomonas: extract genomic dna from the substratum of pseudomonas, the standby pcr template of doing;
2) multiplex PCR amplification comprises: a, multiplex PCR amplification reaction system: get above-mentioned DNA profiling solution 38-60ng/ μ L, detect with above-mentioned test kit, reaction system is 20-30.0 μ L, each reaction product is respectively TaqDNA polysaccharase 0.02U/ μ L, PCR damping fluid 2.5 μ L, deoxyribonucleoside triphosphate mixture 1.0mmol/L, the each 0.2-0.24 μ of primer P1, P2 mol/L, the each 0.4-0.6 μ of P3, P4 mol/L, the each 0.32-0.48 μ of P5, P6 mol/L, surplus is supplied with redistilled water; B, amplification reaction condition: 94 DEG C of denaturation 4min, 94 DEG C of sex change 30s, 60.4 DEG C of annealing 45s, 72 DEG C are extended 40s, circulate 30 times, and 10min is extended at 72 DEG C of whole ends; C, the amplified production of step b is carried out to electrophoresis detection and interpretation of result.
4. the multi-PCR detection method of the pathogenic sweetfish pseudomonas of Rapid identification as claimed in claim 3, it is characterized in that: the reaction system of the multiplex PCR amplification of described step a is specially 25.0 μ L, each reaction product is respectively TaqDNA polysaccharase 0.25 μ L, 10 × PCR damping fluid, 2.5 μ L, deoxyribonucleoside triphosphate mixture 1.0 μ L, the each 0.5 μ L of primer P1, P2, the each 1.0 μ L of P3, P4, the each 1.0 μ L of P5, P6, redistilled water complements to cumulative volume 25.0 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410150633.0A CN103993072B (en) | 2014-04-15 | 2014-04-15 | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410150633.0A CN103993072B (en) | 2014-04-15 | 2014-04-15 | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103993072A true CN103993072A (en) | 2014-08-20 |
| CN103993072B CN103993072B (en) | 2015-09-02 |
Family
ID=51307401
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410150633.0A Expired - Fee Related CN103993072B (en) | 2014-04-15 | 2014-04-15 | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103993072B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047783A (en) * | 2016-05-25 | 2016-10-26 | 浙江万里学院 | Pseudomonas plecoglossicida ExoU gene knockout mutant strain and application thereof |
| CN113512600A (en) * | 2021-06-18 | 2021-10-19 | 广西壮族自治区水牛研究所 | Primer and method for detecting pseudomonas putida and application thereof |
| CN114002342A (en) * | 2021-09-29 | 2022-02-01 | 集美大学 | Combined metabolic marker and detection kit for judging gene modification effect of epinephelus coioides visceral white spot disease pathogenic bacteria |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952884B (en) * | 2012-11-16 | 2014-04-23 | 宁波大学 | LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and detection method |
| CN103276093B (en) * | 2013-06-06 | 2015-02-04 | 宁波大学 | Fluorescent quantitative PCR detection kit of Pseudomonas plecoglossicida, and detection method thereof |
-
2014
- 2014-04-15 CN CN201410150633.0A patent/CN103993072B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047783A (en) * | 2016-05-25 | 2016-10-26 | 浙江万里学院 | Pseudomonas plecoglossicida ExoU gene knockout mutant strain and application thereof |
| CN106047783B (en) * | 2016-05-25 | 2019-10-25 | 浙江万里学院 | Kill sweetfish pseudomonad ExoU gene knockout mutant strain and its application |
| CN113512600A (en) * | 2021-06-18 | 2021-10-19 | 广西壮族自治区水牛研究所 | Primer and method for detecting pseudomonas putida and application thereof |
| CN114002342A (en) * | 2021-09-29 | 2022-02-01 | 集美大学 | Combined metabolic marker and detection kit for judging gene modification effect of epinephelus coioides visceral white spot disease pathogenic bacteria |
| CN114002342B (en) * | 2021-09-29 | 2023-11-07 | 集美大学 | Combined metabolic marker and detection kit for judging gene modification effect of pathogenic bacteria of visceral ichthyophthiriasis of Epinephelus coioides |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103993072B (en) | 2015-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wagner et al. | Removal of free extracellular DNA from environmental samples by ethidium monoazide and propidium monoazide | |
| Safni et al. | Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. | |
| Czajkowski et al. | Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review | |
| Fera et al. | Detection of Arcobacter spp. in the coastal environment of the Mediterranean Sea | |
| Cocolin et al. | Direct identification in food samples of Listeria spp. and Listeria monocytogenes by molecular methods | |
| Moreno et al. | Specific detection of Arcobacter and Campylobacter strains in water and sewage by PCR and fluorescent in situ hybridization | |
| Lambertz et al. | Real-time PCR method for detection of pathogenic Yersinia enterocolitica in food | |
| Carli et al. | Detection of Salmonellae in chicken feces by a combination of tetrathionate broth enrichment, capillary PCR, and capillary gel electrophoresis | |
| Pal et al. | Rapid detection and differentiation of Erysipelothrix spp. by a novel multiplex real‐time PCR assay | |
| Strayer et al. | A multiplex real-time PCR assay differentiates four Xanthomonas species associated with bacterial spot of tomato | |
| Golomidova et al. | The diversity of coliphages and coliforms in horse feces reveals a complex pattern of ecological interactions | |
| Cui et al. | Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| Shen et al. | Identification of surface protective antigen (spa) types in Erysipelothrix reference strains and diagnostic samples by spa multiplex real‐time and conventional PCR assays | |
| Zhai et al. | Development of a real-time nucleic acid sequence–based amplification assay for the rapid detection of Salmonella spp. from food | |
| Malania et al. | Prevalence and diversity of Bartonella species in rodents from Georgia (Caucasus) | |
| Ballesté et al. | Bifidobacterial diversity and the development of new microbial source tracking indicators | |
| Yu et al. | Development of a triplex loop-mediated isothermal amplification method for rapid on-site detection of three Vibrio species associated with fish diseases | |
| Mandakovic et al. | Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP | |
| CN103820554B (en) | Cross primer isothermal amplification kit for detecting Clavibacter michiganensis subsp. michiganensis and special primer | |
| Heo et al. | Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products | |
| Halm et al. | Novel real-time PCR assay for simultaneous detection and differentiation of Clostridium chauvoei and Clostridium septicum in clostridial myonecrosis | |
| Onuk et al. | Molecular identification and determination of some virulence genes of Aeromonas spp. in fish and water from Turkish coastal regions | |
| CN102304573B (en) | Nucleotide sequence for bacterium diagnosis and application | |
| CN102181549B (en) | Multi-PCR detection kit and detection method for duck-origin common bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150902 Termination date: 20180415 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |