CN103993016A - HIF2A gene mutant, and detection and application thereof - Google Patents
HIF2A gene mutant, and detection and application thereof Download PDFInfo
- Publication number
- CN103993016A CN103993016A CN201410172171.2A CN201410172171A CN103993016A CN 103993016 A CN103993016 A CN 103993016A CN 201410172171 A CN201410172171 A CN 201410172171A CN 103993016 A CN103993016 A CN 103993016A
- Authority
- CN
- China
- Prior art keywords
- hif2a
- nucleic acid
- seq
- gene
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to the field of medical molecular biology and aims to provide an HIF2A gene mutant and detection and application thereof. A separated gene sequence coding HIF2A mutant nucleic acid is shown in SEQ ID No. 1. Separated HIF2A mutant polypeptide is coded by the mutant nucleic acid and has an amino acid sequence as shown in SEQ ID No. 2. Research results in the invention show that in the sequence of the human HIF2A gene shown in SEQ ID No. 1, G-to-A mutation of nucleotide at site 2155 leads to transformation of glutamic acid (E) at site 549 in the sequence shown in SEQ ID No. 2 into lysine (K), so the half life of protein is prolonged and expression of a downstream gene is increased. Thus, the invention provides a detection method for HIF2A gene mutation. With the method, whether a biological sample has HIF2A gene mutation can be rapidly found out.
Description
Technical field
The present invention relates to Medical Molecular Biology field, particularly, relate to the nucleic acid of the HIF2A mutant of separation, isolated polypeptide, and the method for the biological sample of screening susceptible liver cancer and other liver related diseases and for screening the test kit of biological sample of susceptible liver cancer and other liver related diseases.
Background technology
Liver cancer be the coefficient result of environment and gene, it is one of modal malignant tumour, worldwide in cancer-related death factors, is number three, and has data to show, the whole world has every year and exceedes 500,000 new patients.The more than 50% new and dead liver cancer patient in the whole world occurs in China, and only China 110,000 people that just have an appointment every year die from liver cancer.And the concealment of liver cancer onset, exceed 60% liver cancer patient at the first middle and advanced stage that just entered when medical, lose the chance of radical cure treatment, within 5 years, overall survival rate only has 7% left and right [Lin H, Yan J, Wang Z, et al.Loss of Immunity-supported senescence enhances susceptibility to hepatocellular carcinogenesis and progression in TLR2-deficient mouse.Hepatology, 2013,57 (1): 171-82.].Excision is still the first-selection for the treatment of primary hepatocarcinoma, but well-known, high, the high [Yu Xiushi of the rate of transform of patient's 5 years recurrence rates after radical excision, Guan Yuanyuan, Tian Juxia. the associated molecule Mechanism Study that liver cancer occurs. health research (fundamental research), 2010,30 (5): 391-393.].Therefore the index of liver cancer susceptibility examination, early diagnosis, treatment, prognosis judgement of finding practicability and effectiveness is very urgent already.
Along with the develop rapidly of oncomolecularbiology theory and technology, understanding to various liver cancer related genes deepens continuously, and proto-oncogene, cancer suppressor gene, toxin metabolic enzyme gene, the research of the transgenation of DNA-repair gene etc. and the liver cancer susceptibility relation [Zheng Xiaoyan that also deepens continuously, Shi Xishun, Hu Zhijian. the research of liver cancer related gene sudden change and liver cancer susceptibility. Chinese tumour, 2008, 17 (5): 390-395.], but the limited amount of the liver cancer related gene of finding at present, and up to the present, do not have very good Hepatocarcinoma screening, diagnosis, treatment, the gene of prognosis judgement etc.Therefore, find possible liver cancer modificator gene, thereby find out the index of reliable liver cancer susceptibility examination, early diagnosis and the new foundation of prognosis in hcc judgement, remain the focus of current liver cancer research.
Summary of the invention
The technical problem to be solved in the present invention is, overcomes deficiency of the prior art, a kind of HIF2A gene mutation body is provided and detects and applies.
For technical solution problem, solution of the present invention is:
The coding HIF2A mutant nucleic acid that a kind of separation is provided, the gene order of this mutant nucleic acid is as shown in SEQ ID NO:1.
The present invention further provides a kind of HIF2A mutant polypeptide of separation, this mutant polypeptide is by mutant nucleic acid encoding described in claim 1, and its aminoacid sequence is as shown in SEQ ID NO:2.
The present invention further provides a kind of method whether detection of biological sample exists HIF2A transgenation, comprised the following steps:
(1) determine the 549th amino acids shown in the SEQ ID NO:2 that whether possesses HIF2A genes encoding in biological sample, or the 2155th Nucleotide shown in SEQ ID NO:1;
This step specifically comprises: utilize the specific primer of the 12nd exon of HIF2A gene, sample of nucleic acid is carried out to pcr amplification, build nucleic acid sequencing library and check order for the amplified production of gained;
Described biological sample refers to the tissue, skin, hair or the oral mucosa that separate from the blood of human body, various organs, can be used in and separate mutant nucleic acid described in acquisition claim 1, or obtain cDNA sample to form described sample of nucleic acid by reverse transcription reaction;
The specific primer of the 12nd exon of described HIF2A gene has the nucleotide sequence as shown in SEQ ID NO:3 and SEQ ID NO:4;
(2) detect at described nucleotide position whether have G → A sudden change, and whether described aminoacid sequence there is E → K sudden change;
This step specifically comprises: by the comparison nucleotide map that checks order, the 2155th Nucleotide becomes A from G, on CDS encoding sequence, see it is that the 1645th Nucleotide is undergone mutation, there is c.G1645A sudden change, codon GAG becomes AAG, after translation, the 549th L-glutamic acid of aminoacid sequence (E) becomes Methionin (K), and p.E549K sudden change occurs.
The present invention further provides the application of described coding HIF2A mutant nucleic acid in the test kit that whether has HIF2A transgenation for the preparation of detection of biological sample.
The present invention further provides the application of described coding HIF2A mutant polypeptide in the test kit that whether has HIF2A transgenation for the preparation of detection of biological sample.
Compared with prior art, beneficial effect of the present invention is:
The present invention studies the 2155th Nucleotide G → A sudden change in sequence shown in the SEQ ID NO:1 of finder HIF2A gene, cause the 549th L-glutamic acid (E) in sequence shown in SEQ ID NO:2 to become Methionin (K), make the Increased Plasma Half-life of protein, the expression of downstream gene is increased.Based on this, the invention provides the detection method of HIF2A transgenation.By the application to the method, can understand fast biological sample and whether have HIF2A transgenation.As of the present invention spreading out stretched to application, can be used as the potential susceptibility patient's who finds liver cancer and liver related disease new basis for estimation.
Brief description of the drawings
Fig. 1 is the forward primer sequencer map containing the patient in mutational site, saltant type (G/A);
Fig. 2 is the forward primer sequencer map that control group does not contain the normal healthy people in mutational site, wild-type (G/G);
Fig. 3 is the reverse primer sequencer map containing the patient in mutational site, saltant type (C/T);
Fig. 4 is the reverse primer sequencer map that control group does not contain the normal healthy people in mutational site, wild-type (C/C);
Fig. 5 is the result of the sequence of multiple species HIF2A protein being compared according to the embodiment of the present invention, and wherein 531 is proline(Pro) hydroxylation site.
Fig. 6 is patient's red corpuscle, hematocrit and oxyphorase variation tendency, in its routine blood test before being admitted to hospital, red corpuscle, hematocrit and oxyphorase are all higher than normally, and after operation, its red corpuscle, hematocrit and oxyphorase start again to present the trend increasing gradually.
Embodiment
The technical scheme that following general description the present invention is claimed:
1. the invention provides and from different types of liver disease, separate HIF2A new mutant Disease-causing gene, have the sequence (as shown in SEQ ID NO:1) of sudden change, there is the sudden change of G → A in the 2155th bit base.
The method that the present invention checks order by Sanger has been determined the new Disease-causing gene sudden change (HIF2Ac.G1645A, p.E549K) of liver cancer and other liver related diseases.
HIF2A gene mutation body
According to embodiments of the invention, this nucleic acid has the sequence (as shown in SEQ ID NO:1) of sudden change.The phraseology " nucleic acid of coding HIF2A mutant " that used in this article, refer to the nucleic acid substances corresponding with the gene of the HIF2A mutant of encoding, the type that is nucleic acid is not particularly limited, can be any deoxyribonucleotide corresponding with the encoding gene of HIF2A mutant and/or polymkeric substance of ribonucleotide of comprising, include but not limited to DNA, RNA or cDNA.According to a concrete example of the present invention, the nucleic acid of foregoing coding HIF2A mutant is DNA.
According to embodiments of the invention, contriver has determined the new mutant body of HIF2A gene, the morbidity of these new mutant bodies and liver cancer and other liver related diseases is closely related, thereby whether exist in biological sample by detecting this new mutant body, can reach and effectively predict the whether object of susceptible liver cancer and other liver related diseases of organism.
The nucleic acid of this coding HIF2A mutant is that present inventor passes through the new mutant on the Disease-causing gene of the definite liver cancer of Sanger method sequence measurement and other liver related diseases.The mutational site of this discovery is new, not referred in the prior art.
The nucleotide sequence of saltant type HIF2A gene as shown in SEQ ID No.1, the HIF2A albumen (coding region) of its coding, this protein contains 870 amino acid, has the aminoacid sequence shown in SEQ ID No.2.
The new mutant body that contriver finds is as shown in SEQ ID NO:2, there is p.E549K sudden change, be that in the cDNA of HIF2A gene mutation body of the present invention, the G of the 2155th sports A, thus, its coded product HIF2A albumen (as shown in SEQ ID NO:2), have p.E549K sudden change, the E of 549 (L-glutamic acid) sports K (Methionin).
The present invention also provides the liver cancer that separates from different types of liver disease and the HIF2A new mutant body of other liver related diseases, and its aminoacid sequence, as shown in SEQ ID NO:2, has p.E549K sudden change.Whether the morbidity of this new mutant body and liver cancer and other liver related diseases is closely related, thereby exist in biological sample by detecting this new mutant body, can reach and effectively predict the whether object of susceptible liver cancer and other liver related diseases of organism.
The present invention has obtained according to the mutator gene obtaining the mutant polypeptide separating, and this polypeptide has p.E549K sudden change, and its sequence is as shown in SEQ IDNO:2.According to concrete examples more of the present invention, this polypeptide is by the nucleic acid encoding of the coding HIF2A mutant of aforementioned separation.Effectively predict the whether object of susceptible liver cancer and other liver related diseases of organism by whether expressing this polypeptide in detection of biological sample, can reaching.
3. embodiments of the invention also provide the method for the biological sample of screening susceptible liver cancer and other liver related diseases, comprise the following steps: from described extraction from biological material sample of nucleic acid; Determine the nucleotide sequence of described sample of nucleic acid; The nucleotide sequence of described sample of nucleic acid is as shown in SEQ ID NO:1, and having c.G1645A sudden change is the instruction of described biological sample susceptible liver cancer and other liver related diseases.
By according to the method for the biological sample of the screening susceptible liver cancer of the embodiment of the present invention and other liver related diseases, can reach the object of the biological sample that effectively screens susceptible liver cancer and other liver related diseases.
The method of the biological sample of screening susceptible liver cancer and other liver related diseases
The present invention proposes a kind of method of the biological sample that screens susceptible liver cancer and other liver related diseases.According to embodiments of the invention, the method for the biological sample of this screening susceptible liver cancer and other liver related diseases can comprise the following steps:
First, from extraction from biological material sample of nucleic acid.According to embodiments of the invention, the type of biological sample is also not particularly limited, and reflects whether biological sample HIF2A exists the sample of nucleic acid of sudden change as long as can extract from this biological sample.According to embodiments of the invention, biological sample can be for being selected from least one in tissue, skin, hair or the oral mucosa of the blood of human body, various organs.Thus, can sample easily and detect, thereby can further improve the efficiency of the biological sample of screening susceptible liver cancer and other liver related diseases.According to embodiments of the invention, here the term " sample of nucleic acid " that used should be interpreted broadly, it can be anyly can reflect whether HIF2A in biological sample exists the sample of sudden change, it can be for example the complete genome DNA directly extracting from biological sample, also can be a part that comprises HIF2A encoding sequence in this full genome, can be the total RNA extracting from biological sample, can be also the mRNA extracting from biological sample.According to one embodiment of present invention, described sample of nucleic acid is complete genome DNA.Thus, can expand the source range that comes of biological sample, and can determine the much information of biological sample simultaneously, thereby can improve the efficiency of the biological sample of screening susceptible liver cancer and other liver related diseases.
In addition, according to embodiments of the invention, for adopting RNA as sample of nucleic acid, may further include from extraction from biological material sample of nucleic acid: from extraction from biological material RNA sample, preferably RNA sample is mRNA; And RNA sample based on obtained, by reverse transcription reaction, obtain cDNA sample, the cDNA composition of sample sample of nucleic acid obtaining.Thus, can further improve and utilize the efficiency of RNA as the biological sample of sample of nucleic acid screening susceptible liver cancer and other liver related diseases.
Next, after obtaining sample of nucleic acid, can analyze sample of nucleic acid, thereby can determine the nucleotide sequence of obtained sample of nucleic acid.According to embodiments of the invention, the method and apparatus of the nucleotide sequence of definite sample of nucleic acid that obtains is also not particularly limited.According to a particular embodiment of the invention, can pass through sequence measurement, the nucleotide sequence of definite kernel acid sample.According to embodiments of the invention, can and be not particularly limited for the method and apparatus that checks order.According to embodiments of the invention, can adopt s-generation sequencing technologies, also can adopt the third generation and the 4th generation or more advanced sequencing technologies.According to concrete example of the present invention, can utilize be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device nucleotide sequence is checked order.Thus, in conjunction with up-to-date sequencing technologies, can reach the higher order-checking degree of depth for Single locus, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, can improve follow-up accuracy and accuracy when sequencing data is analyzed.Thus, according to embodiments of the invention, the nucleotide sequence of definite kernel acid sample may further include: first, for obtained sample of nucleic acid, build nucleic acid sequencing library; And checked order in obtained nucleic acid sequencing library, to obtain the sequencing result being formed by multiple sequencing datas.According to some embodiments of the present invention, can adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in obtained nucleic acid sequencing library.In addition, according to embodiments of the invention, can screen sample of nucleic acid, enrichment HIF2A exon, this screening enrichment can, before building sequencing library, build in sequencing library process, or carries out after building sequencing library.According to one embodiment of present invention, for sample of nucleic acid, build nucleic acid sequencing library and further comprise: utilize HIF2A exon Auele Specific Primer, sample of nucleic acid is carried out to pcr amplification; And for obtained amplified production, build nucleic acid sequencing library.Thus, can pass through pcr amplification, enrichment HIF2A exon (especially the 12nd exon), thus can further improve the efficiency of the biological sample of screening susceptible liver cancer and other liver related diseases.
According to embodiments of the invention, the sequence of HIF2A exon Auele Specific Primer is not particularly limited, and according to a preferred embodiment of the invention, these HIF2A exon Auele Specific Primers have the nucleotide sequence shown in SEQ ID NO:3 and 4:
AGGAGCTGAGTTGGAATAGTG(SEQ?ID?NO：3)
CCAGCTATCTTACTAGTGGGTG(SEQ?ID?NO：4)
About for sample of nucleic acid, build method and the flow process of sequencing library, those skilled in the art can suitably select according to different sequencing technologies, about the details of flow process, can be referring to manufacturer's code that for example Illumina company provides of order-checking instrument, for example, referring to the Multiplexing Sample Preparation Guide (Part#1005361 of Illumina company; Or Paired-End SamplePrep Guide (Part#1005063 Feb2010); Feb2010), be incorporated to herein by reference.According to embodiments of the invention, from the method and apparatus of extraction from biological material sample of nucleic acid, be also not particularly limited, can adopt commercial nucleic acid extraction kit to carry out.
It should be noted that, broad understanding should be made in the term " nucleotide sequence " that here used, it can be after the sequencing data that obtains that sample of nucleic acid is checked order is assembled, the complete nucleic acid sequence information obtaining, also can be directly to adopt by obtained sequencing data (reads) that sample of nucleic acid is checked order as nucleotide sequence, as long as the encoding sequence that contains corresponding HIF2A in these nucleotide sequences.
Finally, after the nucleotide sequence of definite kernel acid sample, by the nucleotide sequence of obtained sample of nucleic acid as shown in the sequence of SEQ ID NO:1.If there is c.G1645A sudden change in obtained nucleotide sequence, indicator organism sample susceptible liver cancer and other liver related diseases.Thus, by according to the method for the biological sample of the screening susceptible liver cancer of the embodiment of the present invention and other liver related diseases, can effectively screen the biological sample of susceptible liver cancer and other liver related diseases.According to embodiments of the invention, the method and apparatus that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate.
It should be noted that, be not particularly limited according to the purposes of " method of the biological sample of screening susceptible liver cancer and other liver related diseases " of the embodiment of the present invention, for example can be as the screening method of non-diagnostic purpose.
4. as of the present invention spreading out stretched to application, embodiments of the invention also can be prepared the test kit of the biological sample of screening susceptible liver cancer and other liver related diseases.Comprise: be suitable for detecting the reagent of HIF2A gene mutation body, described HIF2A gene mutation body, as shown in SEQ ID NO:1, has c.G1645A sudden change.
According to embodiments of the invention, this test kit that is used for the biological sample that screens susceptible liver cancer and other liver related diseases comprises: the reagent that is suitable for detecting HIF2A gene mutation body is as shown in SEQ ID NO:1, and this HIF2A gene mutation body has c.G1645A sudden change.Utilize test kit according to an embodiment of the invention, can reach the object of the biological sample that effectively screens susceptible liver cancer and other liver related diseases.In this article, the term using " is suitable for detecting the reagent of HIF2A gene mutation body " and should be interpreted broadly, can be the reagent that detects HIF2A encoding gene, can be also the reagent that detects HIF2A mutant polypeptide, for example, can adopt the antibody in identification specificity site.According to one embodiment of present invention, described reagent is nucleic acid probe, thus, can reach the object of the biological sample that screens efficiently susceptible liver cancer and other liver related diseases.
It should be noted that, in the feature and advantage of screening herein above described in the method part of biological sample of susceptible liver cancer and other liver related diseases, the test kit that is equally applicable to the biological sample that screens susceptible liver cancer and other liver related diseases, does not repeat them here.
Below with reference to specific embodiment, the present invention will be described, it should be noted that, these embodiment are only illustrative, and can not be interpreted as limitation of the present invention.
If do not specialize, the conventional means that the technique means adopting in embodiment is well known to those skilled in the art, can carry out with reference to " molecular cloning experiment guide " third edition or related products, and the reagent adopting and product are also and can business obtain.Various processes and the method do not described in detail are ordinary methods as known in the art, source, the trade(brand)name of agents useful for same and be necessary to list its moiety person, all in the time occurring first, indicate, identical reagent used is if no special instructions, all identical with the content of indicating first thereafter.
The inventor has found the heterozygous mutant (c.G1645A) on people HIF2A gene 12 exons by research extensively and profoundly.
Certain male patient suffers from the hepatitis B several years, blood routine examination before being admitted to hospital is found, its red corpuscle, hematocrit and oxyphorase are all higher than normally, in a health check-up its 43 years old time, be found to suffer from hepatic hemangioma, ultrasound diagnosis subsequently, CT and MRI (nucleus magnetic resonance) check the right hepatic space occupying lesion of finding him, and after excision, pathological diagnosis is liver cancer, and after operation, its red corpuscle, hematocrit and oxyphorase start again to present the trend increasing gradually.Existing research shows, the sudden change of HIF2A can cause the generation of polycyth(a)emia, and HIF2A can be incorporated on DNA, affect the expression of some genes, except short red thin generation element (EPO), also comprise VEGF, EDN1, GLUT etc., a series of these genes all with the growth of cell, propagation, apoptosis, even moisten relevant to invading of tumour, research has simultaneously found that HIF2A sudden change can bring out chromaffinoma, pheochromocytoma, the generation of somatostatinoma, and find in the mouse model with liver specificity HIF2A sudden change, sudden change has caused polycyth(a)emia and the hepatic hemangioma of mouse.But up to the present, never there are the sudden change of clinical report finder HIF2A and the dependency of liver cancer.
Contriver find HIF2A gene 12 exons on heterozygous mutant (c.G1645A), make the 549 amino acids E of HIF2A become K, the Increased Plasma Half-life of protein, and the expression of downstream gene raises, finally cause patient's polycythemia, bring out patient's hepatic hemangioma, the generation of final induced hepatocellular carcinoma, and patient raises because patient's angiogenesis factor (VEGF) expression ratio does not suddenly change, therefore the easy transfer whether situation that can suddenly change to predict its prognosis and liver cancer by detecting it, certainly, also can be to often there is red corpuscle in blood routine examination, the hepatitis B patient that hematocrit or oxyphorase raise carry out on HIF2A12 exon the examination of heterozygous mutant (c.G1645A), thereby determine the hepatic hemangioma of detected object, the susceptibility of liver cancer and other liver related diseases and patient's prognosis is judged.Thereby also may disturb mutator gene to express by certain specific technology treats patient.
The open reading frame of people HIF2A gene is positions, (511)-(3123), and the genome sequence of people HIF2A obtains from GenBank.
With the test kit of method of the present invention or detection primer used and probe, design according to cDNA sequence or the genome sequence of HIF2A gene, and synthesize by conventional synthetic technology.
1 embodiment 1 patient's examination
The hepatitis B patient increasing with red corpuscle, hematocrit or oxyphorase is clinically carried out to examination, biological sample to its tissue, blood, throat swab or hair follicle etc. gathers, and gathers the same biological specimen of normal healthy people control group simultaneously.All samples all derive from Zhejiang University Medical College The First Affiliated Hospital, and all members all pass through informed consent.
2 embodiment 2 determine people HIF2A transgenation
The extracting of 1 genomic dna and order-checking
Utilize DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) genomic dna in blood or the other biological sample of extraction patient and normal healthy people control group, utilize the primer for HIF2A sequence 12 exons, and test kit TaKaRa Ex Taq
tM(Mg2+free Buffer) (TaKaRa, Japan) does regular-PCR amplification.The DNA of gained carries out purity and concentration detects, and the OD260/OD280 of each sample genomic dna is all between 1.8-2.3, and concentration is no less than 20ng/ μ L.
Primer sequence is:
Sense primer: (AGGAGCTGAGTTGGAATAGTG) SEQ ID NO:3
Antisense primer: (CCAGCTATCTTACTAGTGGGTG) SEQ ID NO:4
Amplification system: (cumulative volume 50 μ L)
Response procedures:
Amplify the product of 634bp, use 3730xl DNA Analyzer (Applied Biosystems, America) to carry out forward and reverse order-checking.
3 embodiment 3 sequencing result analyses
Utilize the Nucleotide Blast function of ncbi database and BioEdit software to align backward sequencing result and analyze, sequencing result is shown in respectively Fig. 1,2,3,4.Find HIF2Ac.G1645A heterozygous mutant site, and in ncbi database, snp database, all do not find this mutational site.
4 embodiment 4 people HIF2A p.E549K species conservative Analysis
Contriver uses ncbi database to compare the species homology of HIF2A gene, the results are shown in Figure 5.Fig. 5 has shown the sequence alignment result of multiple species HIF2A protein.As seen from the figure, 549 of HIF2A albumen L-glutamic acid (E) are guarded between species.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc., means being contained at least one embodiment of the present invention or example of specific features, structure, material or the feature described in conjunction with this embodiment or example.In addition, in this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And specific features, structure, material or the feature of description can be with suitable mode combination in any one or more embodiment or example.
Although illustrated and described embodiments of the invention, those of ordinary skill in the art can carry out multiple variation, amendment, replacement, modification or polishing to these embodiment in the situation that not departing from principle of the present invention and aim, but be all relevant to detection mutational site of the present invention, or the various forms of application in this site, these amendments or polishing all belong to scope of the present invention.
Claims (5)
1. a coding HIF2A mutant nucleic acid for separation, is characterized in that, the gene order of this mutant nucleic acid is as shown in SEQ ID NO:1.
2. a HIF2A mutant polypeptide for separation, is characterized in that, this mutant polypeptide is by mutant nucleic acid encoding described in claim 1, and its aminoacid sequence is as shown in SEQ ID NO:2.
3. whether detection of biological sample there is a method for HIF2A transgenation, it is characterized in that, comprises the following steps:
(1) determine the 549th amino acids shown in the SEQ ID NO:2 that whether possesses HIF2A genes encoding in biological sample, or the 2155th Nucleotide shown in SEQ ID NO:1;
This step specifically comprises: utilize the specific primer of the 12nd exon of HIF2A gene, sample of nucleic acid is carried out to pcr amplification, build nucleic acid sequencing library and check order for the amplified production of gained;
Described biological sample refers to the tissue, skin, hair or the oral mucosa that separate from the blood of human body, various organs, can be used in and separate mutant nucleic acid described in acquisition claim 1, or obtain cDNA sample to form described sample of nucleic acid by reverse transcription reaction;
The specific primer of the 12nd exon of described HIF2A gene has the nucleotide sequence as shown in SEQ ID NO:3 and SEQ ID NO:4;
(2) detect at described nucleotide position whether have G → A sudden change, and whether described aminoacid sequence there is E → K sudden change;
This step specifically comprises: by the comparison nucleotide map that checks order, the 2155th Nucleotide becomes A from G, on CDS encoding sequence, see it is that the 1645th Nucleotide is undergone mutation, there is c.G1645A sudden change, codon GAG becomes AAG, after translation, the 549th L-glutamic acid of aminoacid sequence (E) becomes Methionin (K), and p.E549K sudden change occurs.
4. the application of HIF2A mutant nucleic acid in the test kit that whether has HIF2A transgenation for the preparation of detection of biological sample of encoding described in claim 1.
5. the application of HIF2A mutant polypeptide in the test kit that whether has HIF2A transgenation for the preparation of detection of biological sample of encoding described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410172171.2A CN103993016B (en) | 2014-04-25 | 2014-04-25 | HIF2A gene mutation body and detect with apply |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410172171.2A CN103993016B (en) | 2014-04-25 | 2014-04-25 | HIF2A gene mutation body and detect with apply |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103993016A true CN103993016A (en) | 2014-08-20 |
| CN103993016B CN103993016B (en) | 2015-12-30 |
Family
ID=51307348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410172171.2A Active CN103993016B (en) | 2014-04-25 | 2014-04-25 | HIF2A gene mutation body and detect with apply |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103993016B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107118274A (en) * | 2017-05-27 | 2017-09-01 | 南京川博生物技术有限公司 | The preparation method of people's hypoxia inducible factor HIF2a specific antibodies and its application in diagnosis antibody reagent is prepared |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101868251A (en) * | 2007-08-06 | 2010-10-20 | 千寿制药株式会社 | Pharmaceutical containing HIF-1alpha alpha and HIF-2alpha alpha expression inhibitor |
| CN102037123A (en) * | 2008-04-04 | 2011-04-27 | 卡兰多制药股份有限公司 | Compositions and use of epas1 inhibitors |
| WO2011066537A1 (en) * | 2009-11-30 | 2011-06-03 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Nitroxide therapy for the treatment of von hippel - lindau disease (vhl) and renal clear cell carcinoma (rcc) |
-
2014
- 2014-04-25 CN CN201410172171.2A patent/CN103993016B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101868251A (en) * | 2007-08-06 | 2010-10-20 | 千寿制药株式会社 | Pharmaceutical containing HIF-1alpha alpha and HIF-2alpha alpha expression inhibitor |
| CN102037123A (en) * | 2008-04-04 | 2011-04-27 | 卡兰多制药股份有限公司 | Compositions and use of epas1 inhibitors |
| WO2011066537A1 (en) * | 2009-11-30 | 2011-06-03 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Nitroxide therapy for the treatment of von hippel - lindau disease (vhl) and renal clear cell carcinoma (rcc) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107118274A (en) * | 2017-05-27 | 2017-09-01 | 南京川博生物技术有限公司 | The preparation method of people's hypoxia inducible factor HIF2a specific antibodies and its application in diagnosis antibody reagent is prepared |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103993016B (en) | 2015-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9416422B2 (en) | Methods for detecting minimum residual disease | |
| CN105316341B (en) | A kind of LncRNA and its application in marker or prostate cancer prognosis recurrence marker is detected as prostate cancer | |
| CN106978480A (en) | Molecular diagnostic assay for cancer | |
| CN110387421A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| BRPI0709397A2 (en) | primary cell propagation | |
| CN109825586A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| CN104781415A (en) | Targeted RNA-Seq methods and materials for the diagnosis of prostate cancer | |
| ES2651522T3 (en) | High levels of TEM FT for the diagnosis of cancer, particularly colorectal cancer (CRC) and pancreas (CP) | |
| CN104745719A (en) | Primer, probe and detection reagent kit for detecting RET fusion gene | |
| CN103374575B (en) | CYP4V2 gene mutant and application thereof | |
| US20220228223A1 (en) | Squamous cell carcinoma diagnostic or prognosis prediction marker and use thereof | |
| CN104830989A (en) | Detection kit for fusion mutation of ROS1 and various genes | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| Qiu et al. | Analysis on expression level and diagnostic value of miR-19 and miR-21 in peripheral blood of patients with undifferentiated lung cancer | |
| CN103290120B (en) | Probe, primer and kit for detecting ALK (anaplastic lymphoma kinase) gene expression | |
| El-Din et al. | Relationship between codon 249 mutation in exon 7 of p53 gene and diagnosis of hepatocellular carcinoma | |
| Lee et al. | Identification of differentially‑expressed genes by DNA methylation in cervical cancer | |
| Murakami et al. | Detection of p53 gene mutations in cytopathology and biopsy specimens from patients with lung cancer. | |
| CN103993016B (en) | HIF2A gene mutation body and detect with apply | |
| CN110331207A (en) | Adenocarcinoma of lung biomarker and related application | |
| CN109825585A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| CN104928297A (en) | LPL (lipoprotein lipase) novel mutant pathogenic gene of separated familial chylomicronemia syndrome and kit for detecting same | |
| Chu et al. | Detection of ALK gene rearrangement in cell-free RNA from lung cancer malignant pleural effusion | |
| CN105567797A (en) | PCR primer, method and kit for detecting CpG island methylation of DACT2 gene promoter area | |
| CN112226440B (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cao Hongcui Inventor after: Li Lanjuan Inventor after: Yu Jiong Inventor after: Su Xiaoru Inventor before: Li Lanjuan Inventor before: Cao Hongcui Inventor before: Su Xiaoru Inventor before: Yu Jiong |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |