CN103992962B - Streptococcusmutans rnc gene mutant strain and application thereof - Google Patents
Streptococcusmutans rnc gene mutant strain and application thereof Download PDFInfo
- Publication number
- CN103992962B CN103992962B CN201410082324.4A CN201410082324A CN103992962B CN 103992962 B CN103992962 B CN 103992962B CN 201410082324 A CN201410082324 A CN 201410082324A CN 103992962 B CN103992962 B CN 103992962B
- Authority
- CN
- China
- Prior art keywords
- streptococcus mutans
- strain
- rnc
- streptococcusmutans
- mutans
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a (i) rnc (/i) gene mutant strain of (i) Streptococcusmutans (/i) strain in long chain shape and with low cariogenic ability and application thereof to the prevention of dental caries. The mutant strain is obtained through construction, screening and identification of Streptococcusmutans UA159, and has a preservation number of CCTCCM2013211, classification nomenclature of (i) Streptococcusmutans (/i) HT120211. The (i) rnc (/i) gene mutant strain of (i) Streptococcusmutans (/i) strain provided by the invention can be prepared into a micro ecological preparation as an alternative strain of Streptococcusmutans, and can adjust the oral dysbacteriosis, reduce the number of Streptococcusmutans with high cariogenic ability, and prevent dental caries.
Description
Technical field
The present invention relates to one plant built by Streptococcus mutans ua159, screening and identification and the long chain, low cariogenic that obtains
Streptococcus mutans (streptococcusmutans) the rnc gene mutation strain of ability and its application in terms of anticaries.Should
Streptococcus mutans rnc gene mutation strain can be made into probiotics, as the replacement bacterial strain of Streptococcus mutans, adjusts oral cavity flora
Imbalance, reduces the Streptococcus mutans quantity of high cariogenic potential, the generation of anticaries, belongs to prevention of caries technical field.
Background technology
Incidence of caries is high, is one of modal human infectious disease, and who investigation finds that the whole world there are about 5,000,000,000 people and suffers from
There are dental caries.In China, national third time Oral epidemiological investigation shows, the caries prevalence rate of 5 years old children is about 66% within 2005, in
Year, crowd was 88.1%, and over-65s elderly population is then up to 98%, but the treatment rate of dental caries is then less than 10%.5 years old group deciduous teeth
Carious tooth number 3.5 (dmft), 35-44 year group permanent teeth carious tooth number 4.51 (dmft), 65-74 year group permanent teeth carious tooth number
14.65 (dmft).
Streptococcus mutans are, with dental caries, the close main cariogenic bacteria of development relationship occurs.It passes through metabolism intraoral carbon water
Chemical combination produce are sour, lead to the ph value of Dental plaque biofilm to decline to suppress the growth of other fungal components, thus establish oneself giving birth to
Superiority in thing film.Streptococcus mutans, by biomembranous formation, rely on the protection of extracellular matrix and other signals to pass
Guiding path carrys out the pressure that response environment change brings.The glucosyltransferase of its secretion and transfructosylase can be effectively synthesized
Extracellular polysaccharide, one side promotion bacterium is sticked with dental surface, on the one hand provides bound site for the field planting of other bacteriums
Point, promotes the formation of stabilate film.It is sour, acidproof, extracellular that the main Cariogenicity factor of Streptococcus mutans mainly includes its product
Polysaccharide synthesis, biofilm formation ability etc..
Rnc gene is the gene being widely studied in other bacteriums in recent years.It encodes double-strand rna in Escherichia coli
Specific endoribonuclease rnase iii, participates in the mrna processing procedure of encoding transcription regulator gadx-gadw, from
And control Escherichia coli to sour reaction.Rnase iii is also believed to affect the table of some bacteriophages, plasmid and cytogene
Reach, in terms of rna process, posttranscriptional gene expression control, defence poisoning intrusion, play very important effect.In sky blue chain
In mould, rnase iii is considered formation with spore and the generation of antibiotic is relevant.Although rnaseiii is in some bacteriums
Physiological function by numerous studies, but encode the function of the rnc gene of rnase iii enzyme present in Streptococcus mutans simultaneously
Not studied.Whether it participates in the regulation and control of some biological characteristicses of Streptococcus mutans, if having with Streptococcus mutans cariogenicity
Close unclear.
So far there is not yet about Streptococcus mutans rnc gene mutation bacterial strain build and its preventing and treating in dental caries
The report of application.
Content of the invention
Occurred frequently for above-mentioned dental caries, and there is no the present situation of specific medicament preventing and treating, it is an object of the invention to provide one plant of long-chain
Shape, Streptococcus mutans (streptococcusmutans) the rnc gene mutation strain of low cariogenic potential and its in terms of anticaries
Application.The rnc gene mutation strain of this Streptococcus mutans can be made into probiotics, as the replacement bacterial strain of Streptococcus mutans, adjusts
Whole oral cavity flora imbalance, reduces the Streptococcus mutans quantity of high cariogenic potential, the generation of anticaries.
The technical thought of the present invention is: first, there is no the medicine of special efficacy based on the preventing and treating of dental caries, and due to Streptococcus mutans
It is the modal cariogenic bacteria in oral cavity, therefore select the breach as endogenous ecology preventing decayed tooth for the Streptococcus mutans of cariogenic bacteria, real
Apply mutation technique genes of interest is knocked out, can stably produce one plant is in long chain, the variation chain of low cariogenic potential
Coccus gene mutation strain；Then, using the method for pcr technology and dna sequencing, this strain is accredited as Streptococcus mutans rnc gene
Knockout mutant strain；Finally, the nutrient solution containing this plant of bacterium is carried out with the cariogenic test of human caries animal model, result shows
This mutant strain has the effect of the incidence that can reduce spf level vistar rat dental caries.
Specifically, the technical solution adopted for the present invention to solve the technical problems is:
The present invention obtain have in long chain, the method for the Streptococcus mutans rnc gene mutation strain of low cariogenic potential be (see
Fig. 1): using the Streptococcus mutans obtaining at positioned at the mouth disease research National Key Laboratory in Sichuan Province China province Chengdu
Ua159 (hereinafter referred to as " s.mutans ua159 "), as male parent strain (note: be to carry out gene mutation using individual plant), uses bhi
After medium culture, induced-mutation technique is connected using pcr and carries out the structure of mutant strain, obtain one plant of anti-erythromycin, in long chain, low
Cariogenic potential, can improve the Bacterial community in rat oral cavity, and the rnc gene reducing the Streptococcus mutans of incidence of rat dental caries is dashed forward
Become bacterial strain, then carry out producing sour, acidproof, resistance to oxidation, Attachment, biofilm formation and exocellular polysaccharide Forming ability and bacterium
The comparative test of virulence correlation factor.Amplify the dna fragment of mutant strain by pcr, through sequencing, obtain genes of interest sequence
Row, it was demonstrated that rnc gene is successfully knocked out, determine that this detached bacterial strain is mutated successfully, and this bacterial strain is Streptococcus mutans rnc gene
Deletion mutation strain (streptococcus mutans ht120211), it has a longer chain structure, produces less cariogenic
Virulence factor, the China typical culture collection delivered in the Wuhan University of Wuhan City, Hubei Province on May 16th, 2013
Center (cctcc) preservation, preservation date is on May 16th, 2013, and deposit number is: cctcc no:m2013211.
Streptococcus mutans rnc gene mutation strain streptococcus mutans ht120211 of the present invention is (in following article
Referred to as " streptococcus mutans ht120211cctcc m2013211 ", abbreviation " ht100211 " in picture) according to
Conventional Freezing Glycerine method preservation.
It is big in human caries that the present invention also provides for " streptococcus mutans ht120211cctcc m2013211 "
Comparison in difference with the cariogenic potential of male parent strain Streptococcus mutans ua159 in mouse model.
Respectively using the s.mutans ua159 and streptococcus mutans ht120211cctcc of incubated overnight
M2013211 bacterium solution, after infection spf level wistar rat microbionation success, rat continues to feed 3 weeks, puts to death, takes off jawbone,
Embed, sections observation is carried out to lower molar, the keyes method according to improvement is classified to dental caries bad number and dental caries bad degree, and remembers
Record analysis.Result shows that streptococcus mutans ht120211cctcc m2013211 has and s.mutans
The diverse cariogenic potential of ua159, highlights streptococcus mutans ht120211cctcc of the present invention
M2013211 have reduce human caries rat model nest ditch enamel caries damage and dentine superficial caries damage the effect of incidence and
Effect.
The present invention has the effect that
(1) present invention adopts pcr to connect induced-mutation technique Streptococcus mutans ua159 under normal operation, by gene weight
Group, makes erythromycin resistance gene pinpoint and replaces genes of interest rnc, is then passed through resistance culture base and screens, pcr+ agarose electrophoresis,
Rt-pcr and dna nucleotide sequencing is verified, thus Streptococcus mutans rnc base repeatable, that stability obtains the present invention
Because of mutant strain " streptococcus mutans ht120211cctcc m2013211 ".
(2) present invention " streptococcus mutans ht120211cctcc m2013211 ", have anti-erythromycin,
Low in long chain, cariogenic potential, the Bacterial community in rat oral cavity can be improved, reduce the generation of rat dental caries.
(3) present invention " streptococcus mutans ht120211cctcc m2013211 " can be made into Tiny ecosystem system
Agent (the replacement bacterial strains using as Streptococcus mutans of the present invention), adjustment oral cavity flora imbalance, reduces the variation chain of high cariogenic potential
Coccus quantity, the generation of anticaries.
Brief description
The Streptococcus mutans rnc gene mutation strain (streptococcus mutans ht120211) of the present invention, in
On May 16th, 2013, deposit number was: cctcc by China typical culture collection center (cctcc) preservation positioned at Wuhan
no:m2013211.
Fig. 1 is the techniqueflow chart of the present invention
Fig. 24 is that the present invention " streptococcus mutans ht120211cctcc m2013211 " ne ar is reflected
Determine result figure
Fig. 5 is the present invention " streptococcus mutans ht120211cctcc m2013211 " biochemical identification result
Figure
Fig. 6,7 is the present invention " streptococcus mutans ht120211cctcc m2013211 " pcr fragment
1.5% agarose gel electrophoresis detection figure
Fig. 8 13 is that the present invention " streptococcus mutans ht120211cctcc m2013211 " p1p4pcr produces
The Sequencing chromatogram of thing
Figure 14 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
The comparison diagram of ua159 " growth curve
Figure 15 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
Ua159 " produces the comparison diagram of love song line
Figure 16 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
The comparison diagram of ua159 " environmental stress tolerance
Figure 17 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
Ua159 " early stage Sucrose-dependent cell adherence experiments experiment flow chart
Figure 18 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
Ua159 " early stage Sucrose-dependent cell adherence experimental result picture
Figure 19 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
Ua159 " in different culture media (bhi, bhi+0.5% sucrose, bhi+1% sucrose), biofilm formation experiments experiment flow chart
Figure 20 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
Ua159 " in different culture media (bhi, bhi+0.5% sucrose, bhi+1% sucrose), biofilm formation situation map
Figure 21 26 is the present invention " streptococcus mutans ht120211cctcc m2013211 and variation chain
Coccus ua159 " in different culture media (bhi, bhi+0.5% sucrose, bhi+1% sucrose), biomembrane electron microscopic observation picture
Wherein: Figure 21 23 is Streptococcus mutans ua1598h16h24h biomembrane ESEM result (10000x) figure；Figure
24 26 is that Streptococcus mutans streptococcus mutans ht120211cctcc m20132118h16h24h biomembrane is swept
Retouch Electronic Speculum result (10000x) figure
Figure 27 is the present invention " streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans
The research figure of ua159 " exocellular polysaccharide Forming ability
Figure 28-29 is the present invention " streptococcus mutans ht120211cctcc m2013211 and variation hammer
The results of in vitro studies figure of bacterium ua159 " Cariogenicity factor gene expression
Figure 30-31 is the present invention " streptococcus mutans ht120211cctcc m2013211 and variation hammer
Result of study figure in the human caries rat model of bacterium ua159 " Cariogenicity factor gene expression
Figure 32 34 is the present invention " streptococcus mutans ht120211cctcc m2013211, variation hammer
The bad figure of test vistar rat facing dental caries leading in bacterium ua159 and blank " human caries rat model
Specific embodiment
Embodiment 1: the acquisition of the present invention " streptococcus mutans ht120211cctcc m2013211 " and mirror
Fixed, flow process is shown in Fig. 1
1st, the structure of the present invention " streptococcus mutans ht120211cctcc m2013211 " and identification
The culture of 1.1 bacterial strains
The Streptococcus mutans obtaining at positioned at the mouth disease research National Key Laboratory in Sichuan Province China province Chengdu
Ua159 (that is: streptococcus mutans ua159, referred to as " s.mutans ua159 ") is inoculated in ox brain heart infusion
(bhi) culture medium (sigma-aldrich corp, saint louis, mo, usa), bacterium routine passage incubated overnight is in dy-2
Type anaerobic culture box (37 DEG C, 5%co2,10%h2,85%n2；Zhejiang, China) stand-by.
The structure of 1.2streptococcus mutans ht120211 mutant strain
Consult ncbi database, obtain rnc gene, and its dna sequence of upstream and downstream fragment, and in rnc upstream region of gene about
500bp and design primer (rnc-p1, rnc-p2) amplification rnc fragment upstream in the fragment of 5 ' end about 100bp in rnc gene, with
Design primer (rnc-p3, rnc-p4) in sample fragment of 3' end about 100bp in rnc downstream of gene about 500bp with rnc gene is expanded
Increase rnc segments downstream.The specificity of designed primer passes through ncbi blast (http://www.ncbi.nlm.nih.gov/
Blast) verify.Expanded from erythromycin resistance gene box (ermam cassette) using erm-pf/erm-pr primer pair simultaneously
Increase Erythromycinresistant fragment.QIAquick Gel Extraction Kit is purified using takara dna, according to the operational manual of kit, right respectively
Three dna products of rnc-p1/p2, rnc-p3/p4 and erm-pf/erm-pr amplification carry out purifying recovery.Then 37 DEG C of water-baths
Under, respectively using the rnc- of restriction endonuclease fsei (new england biolabs, usa) overnight digestion purifying
P1p2, restriction endonuclease asci (new england biolabs, usa) overnight digestion rnc-p3p4 fragment；Asci and
Fsei carries out double digestion to erythromycin resistance gene erm-pfpr fragment after purification；65 DEG C are placed reaction liquid into after the completion of digestion
15min inactivation restriction endonuclease in water-bath, then t4dna ligase (new england biolabs, usa) connection
Three dna fragments after digestion, obtain and connect, by three above dna fragment, the rnc-p1p4 fragment producing.
20 μ l rnc-p1p4 junction fragments are taken to add the s.mutans ua159 bacterium solution of 50 μ l incubated overnight new with 0.5ml
In fresh bhi fluid nutrient medium (experiencing peptide csp containing final concentration of 1 μ g/ml Streptococcus mutans), 37 DEG C of Anaerobic culturel enter for 3 hours
The conversion of row junction fragment.It is inoculated in after conversion with 37 DEG C of anaerobism of erythromycin bhi flat board (containing final concentration 10 μ g/ml erythromycin)
Culture 48 hours, screening obtains the bacterium colony with Erythromycinresistant.By resistant clones Secondary Culture 48 hours respectively, carry out bacterium colony
Form and bacteria microscopic morphological examination (Fig. 2-4).
The identification of 1.3streptococcus mutans ht120211 mutant strain
1.3.1streptococcus the morphology of mutans ht120211 mutant strain and biochemical identification
Tolerant bacteria is inoculated in bhi solid medium (containing final concentration 10 μ g/ml erythromycin).37 DEG C of (5%co2,
10%h2, 85%n2) Anaerobic culturel 18h, smear microscopy observes ne ar, after being defined as pure culture, quick using reaction plate
Biochemical test carries out biochemical character identification (Fig. 5) to Streptococcus mutans streptococcus mutans ht120211.
Result shows: after connection product rnc-p1p4 is transformed into Streptococcus mutans ua159, resistant panel is screened, successfully
Obtain the single bacterium colony (as Fig. 2) with Erythromycinresistant；Grain stain is accredited as the long streptococcal of Grain-positive.Erythromycinresistant
The quick biochemical test of the reacted plate of bacterial strain is accredited as Streptococcus mutans, can metabolism aesculin, arginine, mannitol, sorbierite,
Gossypose and melibiose.Simultaneously in liquid medium within, mutant strain shows different growth patterns from wild strain
Streptococcus mutans ht120211, mutant strain is in lumps, is suspended in more limpid culture medium, and wild
Raw bacterial strain s.mutans ua159 is then evenly distributed in culture medium, shows the turbid suspension of homogeneous.
1.3.2streptococcus the pcr amplification of mutans ht120211 mutant strain and dna sequencing identification
Using specific primer, rncp1/p2, rncp3/p4, rncp1/p4 are expanded to mutant gene group dna,
Product purifies and reclaims laggard row agarose gel electrophoresis and nucleotide sequencing, just to verify Erythromycinresistant fragment
Really insertion (Fig. 6, Fig. 7).
Product purifies after reclaiming and carries out nucleotide sequencing (Fig. 8-13), and result shows Erythromycinresistant fragment
Substitute rnc gene, be correctly inserted into rnc coding region it was confirmed we have obtained one plant of new mutant strain is exactly Streptococcus mutans
Rnc gene mutation bacterial strain, according to international nomenclature principle, is named as streptococcus mutans ht120211.This bacterium
In on May 16th, 2013 by China typical culture collection center (cctcc) preservation, its preserving number is cctcc no for strain:
M2013211, referred to as " streptococcus mutans ht120211cctcc m2013211 ".
Streptococcus mutans growth and the research of acid producing ability
Take Streptococcus mutans ua159 and the life of streptococcus mutans ht120211cctcc m2013211 logarithm
Long mid-term bacteria suspension, be inoculated in 12 orifice plates of 2ml fresh bhi fluid nutrient medium (final bacterial concentration be 5x105Cfu/ml), in
37 DEG C, incubated in 5%co2 incubator.When starting culture and at interval of 1h, take out an orifice plate, carry out ph value and
600nm wavelength absorbance value measures, and monitors bacterial growth 24h.With time point as abscissa value, od600 value, ph value are ordinate
Value draws growth curve and the product love song line of bacterium respectively.
From the point of view of 24 hours growth curve of bacteria (Figure 14), streptococcus mutans ht120211cctcc
M2013211 and s.mutans ua159 reaches the time consistency of exponential phase, and the exponential phase bacterium doubling time is identical,
S.mutans ua159 to be more than in the bacterium bacterium cell of stationary phase mutant strain.Produce love song line (Figure 15) by bacterial growth 24h to come
See, mutant strain is slow compared with ua159 in the ph value decline of exponential phase, finally both reaches ph value 5.0, illustrates and wild mushroom
Strain s.mutans ua159 compares, streptococcus mutans ht120211cctcc m2013211 bacterium acid production speed
Slack-off.
.streptococcus the research of mutans ht120211cctcc m2013211 environmental stress tolerance
By contrasting ua159 and streptococcus mutans ht120211cctcc m2013211 in acid ph value
Expose 2h in 5.0 environment, cultivate 1h in the culture medium containing 10 μm of hydrogen peroxide, contain in the culture medium of 0.5m sodium chloride and cultivate
The change of bacterial action after 0.5h, research rnc gene pairs Streptococcus mutans acid-fast ability, resistance to oxidation pressure, resistance to osmotic pressure
Impact.
Mid log phase ua159 and streptococcus mutans ht120211cctcc is collected by centrifugation
M2013211 bacterium, is resuspended in 2ml growth medium (ph value 5.0), 2ml contains the culture medium of 10 μm of hydrogen peroxide, 2ml contains 0.5m
The culture medium of sodium chloride, 37 DEG C of cultures 2h, 1h and 0.5h of anaerobism respectively.100 μ l bacterium are drawn from reaction system respectively before and after culture
Liquid, gradient dilution, spiral inoculation instrument is inoculated in bhi culture medium, 37 DEG C of culture 48h of anaerobism, carries out viable bacteria colony counting.
Viable bacteria colony counting (as Figure 16) result after processing respectively through three factors shows: ph value 5.0 expose 2h, 10 μm
After hydrogen peroxide treatment 1h, ua159 viable bacteria is many compared with streptococcus mutans ht120211cctcc m2013211, both
Between difference there is statistical significance.After 0.5m sodium chloride solution processes 0.5h, streptococcus mutans
Ht120211cctcc m2013211 viable count is many compared with ua159, and difference has statistical significance, explanation between the two
Streptococcus mutans ht120211cctcc m2013211 has lower environment resistance.
.streptococcus mutans ht120211cctcc m2013211 Sucrose-dependent cell adherence experiment
Using 6 orifice plates to Streptococcus mutans ua159 and streptococcus mutans ht120211cctcc
M2013211 carries out the research of early stage surface adhesion.6 orifice plates adopt sterile saliva room temperature to pre-process 1h, and specific experiment flow process is as schemed
Shown in 17.
The percentage of calculating adherent bacteria according to the following formula:
The bacterium Sucrose-dependent cell adherence experimental result of 1h, 2h, 4h shows: streptococcus mutans
The Sucrose-dependent cell adherence ability of ht120211cctcc m2013211 is low compared with ua159.Three time points, the difference between two bacterial strains
Different it is respectively provided with statistical significance, as shown in figure 18.During particularly 4h, streptococcus mutans ht120211cctcc
The adherent bacteria percentage of m2013211 significantly reduces compared with ua159.
.streptococcus the research of mutans ht120211cctcc m2013211 biofilm formation ability
Using 96 orifice plate biofilm formation models, contrast Streptococcus mutans ua159 and streptococcus mutans
Ht120211cctcc m2013211 external biological film Forming ability, whether analysis rnc gene is biomembranous to Streptococcus mutans
Formation has certain impact.Experiment flow is as shown in figure 19.
In addition, Streptococcus mutans ua159 and streptococcus mutans ht120211cctcc m2013211 is connect
Plant and cultivate biomembrane in 12 orifice plates.Place aseptic slide (1cmx1cm) in orifice plate, add 2ml bhi culture medium (containing 1% sugarcane
Sugar), final bacterial concentration is 5x105cfu/ml.12 orifice plates are placed in after 37 DEG C of Anaerobic culturel 8h, 16h, 24h, carefully draw micropore
In liquid phase planktonic bacteria cell, then using pbs buffer solution biomembrane 3 times.Biomembrane slide is fixed, gradient takes off
Water, replace, metal spraying is dried after observed under a scanning electron microscope and carried out IMAQ
It is found that: 96 orifice plate biofilm formation experimental results show, s.mutans ua159 can be in orifice plate bottom shape
Uniformly fine and close biomembrane, and the biology that streptococcus mutans ht120211cctcc m2013211 is formed
Membrane structure, sparse inequality, form biomembranous amount and significantly reduce compared with ua159.In the culture medium containing 0.5% sucrose and 1% sucrose
Interior, ua159 forms biomembranous amount and is more than streptococcus mutans ht120211cctcc m2013211, both it
Between difference there is statistical significance (Figure 20).
ESEM result display ua159 and streptococcus mutans ht120211cctcc m2013211 exists
There is relatively big difference on biofilm structure and ne ar.Ua159 biomembranous structure more dense uniform, ties between long short chain
Close closely, and in streptococcus mutans ht120211cctcc m2013211 biomembrane, the bacterium of long chain arranges
Confusion, biomembrane space is larger, and biofilm thickness is not as good as ua159 (Figure 21-26).
The research of streptococcus mutans exocellular polysaccharide Forming ability
Using 12 orifice plate in-vitro culture models, in bhi fluid nutrient medium add 30mm [14C] sucrose (0.02 μ that marks
ci/ml).37 DEG C, after Anaerobic culturel 24h, gently take out biomembrane sample, be placed in 2ml deionized water, aseptic spatula shaves glass
Piece surface biological film, concussion is resuspended, and 10000g4 DEG C of centrifugation collects supernatant in 10 minutes, uses the concussion of 2ml deionized water resuspended heavy again
Multiple aforesaid operations twice, merge supernatant and are the water-soluble polysaccharide collected.Precipitation washed with 0.4m sodium hydroxide solution 2ml,
Centrifugation, in triplicate, merges supernatant, the as water-insoluble polysaccharide of collection.Add absolute ethyl alcohol precipitation 18h, using aperture
0.22 μm of glass fiber filter is collected by filtration polysaccharide, and scintillation counting technique surveys exocellular polysaccharide amount.
It is found that it is water-insoluble in streptococcus mutans ht120211cctcc m2013211 biomembrane
Exocellular polysaccharide is few compared with ua159, and difference has statistical significance (p < 0.05) (Figure 27) between the two.
" streptococcus mutans ht120211cctcc m2013211 and Streptococcus mutans ua159 " cariogenic poison
The in vitro study of power factor gene expression
Take above-mentioned bacteria suspension 1.5ml culture, add 3mlrna stabilizer (qiagen), mix 5sec, room temperature is placed
5min.4 DEG C of 12000rpm are centrifuged 2 minutes collects thallines, carefully remove all culture medium supernatants.With containing 30mg/ml lysozyme
200 μ lte buffer solution thoroughly resuspended thalline, 37 DEG C incubation 10min.Extracted using trizol method.Sample uses nano vue
The purity of the extracted rna of plus spectrophotometer measurement and concentration.According to primescript rt reagent kit with
Gdna eraser (takara) specification provides method to carry out reverse transcription reaction.
Reaction system sample-adding and two are carried out according to the method that sybr premix ex taq ii (takara) specification provides
Footwork pcr amplification program carries out the real-time pcr amplification of genes of interest, obtains each genes of interest ct (cycle after amplification
Threshold) value.The method that this experiment adopts relative quantification, by 2-δδctMethod is carried out to the relative expression levels of genes of interest
Calculate analysis, obtain Streptococcus mutans ua159 poor with the expression of streptococcus mutans ht120211 genes of interest
Different, statistical analysis (p < 0.05 is carried out by independent samples t test (independent-sample t test) method to difference
For difference, there is statistical significance).
Rt-pcr result display s.mutans ua159 and streptococcus mutans in experiment in vitro
Ht120211cctcc m2013211 compares, the gtfb of streptococcus mutans ht120211cctcc m2013211,
The expression of vicrkx gene substantially raises, and the expression of gtfc, gtfd, ftf and gbpb gene also slightly raises (Figure 28
29).
Embodiment 2: the present invention " streptococcus mutans ht120211cctcc m2013211 " is in human caries
Comparison in difference with the cariogenic potential of male parent strain Streptococcus mutans ua159 in rat model
1. in human caries rat model, Streptococcus mutans ua159 and streptococcus mutans
After ht120211cctcc m2013211 is inoculated in 10ml bhi (supplement 1% sucrose) incubated overnight, centrifugation, abandon resuspended after supernatant
In the fresh bhi culture medium of 10ml.Draw bacteria suspension 100 μ l and continue culture in 2ml bhi culture medium to OD value 0.4
(od600).
After bacterial strain field planting success in experiment in vivo, animal is continuous raises 3 weeks, co2Smother play puts to death rat, takes off jawbone mark
Originally, the physiological saline of sterilizing flushing gently 3 times.Put into equipped with the protection of 5mlrna tissue sample under the mandibular room temperature condition of right side
1h in the sterilizing 15ml test tube of liquid.Bacterial plaque on facing is shaken off (impulse amplitude 10s, power 7w) by ultrasonic cell disruption instrument,
By 4 DEG C of centrifugations 20min (5500g) of the bacterial plaque suspension containing jawbone, abandon supernatant, carefully take out jawbone, precipitation is transferred to and goes out
The 1.5ml centrifuge tube of bacterium, for the extraction of rna.
Key instrument and analysis software
nanovue plus spectrophotometer(ge healthcare,england)
abi prismtm3730xl dna analyzer(applied biosystems,usa)
1.1 bacteriums total rna extraction and purification
Take above-mentioned bacteria suspension 1.5ml culture, add 3mlrna stabilizer (qiagen), mix 5sec, room temperature is placed
5min.4 DEG C of 12000rpm are centrifuged 2 minutes collects thallines, carefully remove all culture medium supernatants.With containing 30mg/ml lysozyme
200 μ lte buffer solution thoroughly resuspended thalline, 37 DEG C incubation 10min.Rna is extracted using trizol method.According to primescript
Rt reagent kit with gdna eraser (takara) specification provides method to carry out reverse transcription reaction.
1.2 real-time quantitative pcr
Sybr green i chimeric fluorescent method carries out real-time pcr amplification.6 genes of interest (primer sequences of coamplification
Row such as table 1-1), using abi prism7300, method carries out pcr amplification program in two steps.
Table 1-1real-time pcr primer sequence
Experiment in vivo finds, compared with wild strain ua159, mutant strain streptococcus mutans
The expression of gtfb, gtfc, gtfd, ftf and gbpb gene of ht120211cctcc m2013211 substantially raises, with early stage
Vitro Experimental Results trend identical, but raise degree be higher than previous experiments (Figure 30 31).
2. the evaluation of mutant strain streptococcus mutans ht120211cctcc m2013211 cariogenic potential
The left and right sides mandibular removing bacterial plaque in 7th step is fixed after 24h with 2.5% glutaraldehyde, alcohol serial dehydration,
Embedding, repairs organization embedding block, is fixed on hard tissue slicing machine.Ground one's teeth in sleep with ultra-thin carborundum disc state of cooling lower edge mandibular
Tooth closes face middle-distant direction sagittal hemisection, observes and suffer from dental caries situation under stereomicroscope, according to keyes classics methods of marking, rat is ground
Tooth shiny surface and pit and fissure caries damage and are classified and score, and this process is completed by another two experimenter's blind that (1 people record keyes comments
Point, another 1 people's verification).Using the one-way anova analysis each group difference in statistical software spss13.0, in the meaningful feelings of f value
Under condition, then carry out each group compare (s-n-k inspection) two-by-two.α=0.05.
It was found that damaging for nest ditch enamel caries and dentine superficial caries damage (Figure 32-34), positive controls (variation chain
Coccus wild strain ua159) score and be significantly higher than mutant strain streptococcus mutans ht120211cctcc
M2013211 group and negative control group (p < 0.05), and mutant strain streptococcus mutans ht120211cctcc
The bad no difference of science of statistics (p > 0.05) of scoring of the dental caries of m2013211 group and negative control group.Shiny surface enamel caries are damaged, negative
Control group, wild strain ua159 group and mutant strain streptococcus mutans ht120211cctcc m2013211 group are scored
No difference of science of statistics (p > 0.05), is shown in Table 1-2.Result of the test shows: adds the present invention " streptococcus mutans
Ht120211cctcc m2013211 " has the obvious nest ditch enamel caries reducing human caries rat model to be damaged and dentine shallow-layer
The effect of the incidence that dental caries damage.
Table 1-2 each group rat keyes dental caries are scored
*p<0.05vs negative control
Streptococcus mutans rnc gene mutation strain nucleotide sequence is shown in sequence table.
cgatccaaattatcctgagtctgtgttagcttagactgcgtctcttttttacgtgttttgtattttaag
acaccggctgcttcttcaaaaattgaacgacgctcttctggtttactattaaaaatctcttccacacgtccttgaga
aataatggaaaaggaatcacgccccaaaccagtatccataaacaaatcgtgaatatcgcgcaggcgtacttttttac
catcaataagataatcactgtccccattacgataaatatggcgttcaatgcgaatctcctcttgagcgtctttgata
aaggcatcgctattatctaaaataaccgttacttgagcgtaattgagtggctttcgattttcagttcctgcaaaaat
cacgtctggcatcttaccgccacgcaggctcttggcacttgactcacccaaagcccagcgtaaactctccgtaatat
tactctttcctgaaccatttggtccaacaacggctgtcactcctctgtcgaactcaaccttggtcttatcagcaaaa
gatttaaatccctgcatttcaatttcttttaaaaacattaagaacctcgttgaagtttttcaagcgcatttttagca
gcctcttgctctgggcgcgccccgggcccaaaatttgtttgatttgtatcttaaaattttgtataataggaattgaa
gttaaattagatgctaaaaatttgtaattaagaaggagtgattacatgaacaaaaatataaaatattctcaaaactt
tttaacgagtgaaaaagtactcaaccaaataataaaacaattgaatttaaaagaaaccgataccgtttacgaaattg
gaacaggtaaagggcatttaacgacgaaactggctaaaataagtaaacaggtaacgtctattgaattagacagtcat
ctattcaacttatcgtcagaaaaattaaaactgaatactcgtgtcactttaattcaccaagatattctacagtttca
attccctaacaaacagaggtataaaattgttgggagtattccttaccatttaagcacacaaattactaaaaaagtgg
tttttgaaagccatgcgtctgacttctatctgattgttgaagaaggattctacaagcgtaccttggatattcaccga
acactagggttgctcttgcacactcaagtctcgattcagcaattgcttaagctgccagcggaatgctttcatcctaa
accaaaagtaaacagtgtcttaataaaacttacccgccataccacagatgttccagataaatattggaagctatata
cgtactttgtttcaaaatgggtcaatcgagagtatcgtcaactgtttactaaaaatcagtttcatcaagcaatgaaa
cacgccaaagtaaacaatttaagtaccgttacttatgagcaagtattgtctatttttaatagttatctattattcaa
cgggaggaaataattctatgagtcgctgccgactggccggccgtttaggaggcgatgctcattagcataactagtat
gagtaaaggcagtttccaataattccttgtcagaaaagacgatcttaaagtcttctgccagttttttttctaatgtt
ttcatataaatcctttcttttatccttagacctttctattatagcaaaaatcacccagaacaaccatttccgagtaa
tctttgtttttcattcttccttttaagctgtccactagatttttgctaatggtaaagcagtatctggcgaggtatca
taaatcttaaaatcatgatctacagccaaatctgcctgcatgagagcattcttcatcgtcatatgggctaattcttt
gacattgttttctttgctgagatgtcccaaataaatcttttttgttttattccccaaagttcgaaccattgtttctg
caccatcatcatttgataggtgtcctttatcggataaaatacgctgttttaaactccaagggtagatacctgagcgt
aaaatttcaatatcatgattggactcaatcagataaccatcagcattttcaatcagatctgccatacgatcactgac
ataacctgtatccgtcaatataacaaagctcttgccgtctttcatcaggcggtaaaactgtggttgagcagcatcat
ggctgacaccaaaactttcaatatcaatatccccaaaagtgatggt
Claims (1)
1. one plant of Streptococcus mutans (streptococcus mutans) rnc gene mutation strain, this bacterial strain is in long chain, low cause
Dental caries ability, can improve the Bacterial community in rat oral cavity, reduce the generation of rat dental caries；This bacterial strain on May 16th, 2013 by
China typical culture collection center (cctcc) preservation, its preserving number is cctcc no:m 2013211.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410082324.4A CN103992962B (en) | 2014-03-07 | 2014-03-07 | Streptococcusmutans rnc gene mutant strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410082324.4A CN103992962B (en) | 2014-03-07 | 2014-03-07 | Streptococcusmutans rnc gene mutant strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103992962A CN103992962A (en) | 2014-08-20 |
| CN103992962B true CN103992962B (en) | 2017-01-18 |
Family
ID=51307299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410082324.4A Active CN103992962B (en) | 2014-03-07 | 2014-03-07 | Streptococcusmutans rnc gene mutant strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992962B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107012159B (en) * | 2017-05-12 | 2019-06-21 | 四川大学 | A kind of streptococcus mutans biomembrane pH indicating gage and its application based on gene recombination plasmid |
| CN108130300B (en) * | 2018-01-29 | 2021-02-26 | 四川大学 | Streptococcus mutans, application thereof and microbial preparation |
| CN114891708A (en) * | 2022-05-26 | 2022-08-12 | 四川大学 | Luciferase reporter gene strain for monitoring up-regulation of gtfD and ftf gene level expression, preparation method and application thereof |
| CN118127022B (en) * | 2024-04-30 | 2024-07-12 | 四川大学 | Streptococcus mutans circular RNA circcsbD and application thereof, over-expression strain, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103007262A (en) * | 2012-12-31 | 2013-04-03 | 中国人民解放军第二军医大学 | Anti-caries DNA (Deoxyribose Nucleic Acid) vaccine and preparation method and application thereof |
| CN103099820A (en) * | 2012-11-21 | 2013-05-15 | 重庆原伦生物科技有限公司 | Streptococcus mutans infection and cariogenic animal model establishing method |
-
2014
- 2014-03-07 CN CN201410082324.4A patent/CN103992962B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103099820A (en) * | 2012-11-21 | 2013-05-15 | 重庆原伦生物科技有限公司 | Streptococcus mutans infection and cariogenic animal model establishing method |
| CN103007262A (en) * | 2012-12-31 | 2013-04-03 | 中国人民解放军第二军医大学 | Anti-caries DNA (Deoxyribose Nucleic Acid) vaccine and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems;Ines Fonfara et al;《Nucleic Acids Research》;20131122;第42卷(第4期);2577-2590 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103992962A (en) | 2014-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103992962B (en) | Streptococcusmutans rnc gene mutant strain and application thereof | |
| Grine et al. | Methanobrevibacter smithii, a methanogen consistently colonising the newborn stomach | |
| CN108486022B (en) | Anti-caries lactobacillus plantarum and application thereof | |
| Mao et al. | The rnc gene promotes exopolysaccharide synthesis and represses the vicRKX gene expressions via microRNA-size small RNAs in Streptococcus mutans | |
| CN108379570B (en) | Toxoplasma gondii attenuated live vaccine with OPRT and LDH1 gene deletion and preparation method thereof | |
| JP5881599B2 (en) | Rapid sterile microassay | |
| CN109355349B (en) | Ackermansoni specificity screening culture medium and preparation method and application thereof | |
| Wei et al. | Solirubrobacter phytolaccae sp. nov., an endophytic bacterium isolated from roots of Phytolacca acinosa Roxb. | |
| CN110484465B (en) | Resuscitation medium of VBNC bacteria and preparation method and application thereof | |
| EP2554677B1 (en) | Viable bacteria count measurement method and culture medium | |
| CN110699471B (en) | Primer pair and kit for rapidly detecting mycoplasma and application of primer pair and kit | |
| Tayco et al. | Characterization of a κ-carrageenase-producing marine bacterium, Isolate ALAB-001 | |
| Yongchang et al. | Oceanobacillus bengalensis sp. nov., a bacterium isolated from seawater of the Bay of Bengal | |
| CN111826304A (en) | Streptococcus thermophilus and application thereof | |
| CN108424866A (en) | A kind of sturgeon source Aeromonas media AMth-1 and PCR detection primer and application | |
| CN118127022B (en) | Streptococcus mutans circular RNA circcsbD and application thereof, over-expression strain, construction method and application thereof | |
| Al-Abdul et al. | Isolation and Identification of Bacteria from Diabetic and Non-Diabetic Patients With Periodontitis | |
| Jin et al. | Terrabacter ginsengisoli sp. nov., isolated from ginseng cultivating soil | |
| Liu et al. | Phylogeny and morphology of genus Nephrocytium (Sphaeropleales, Chlorophyceae, Chlorophyta) from China | |
| TWI639697B (en) | Lactobacillus strain, composition comprising the same and uses thereof | |
| CN107630072A (en) | The detection method that a kind of buccal tobacco product influences on porphyromonas gingivalis | |
| Naginyte | Environmental effects on oral biofilm communities | |
| CN116024361B (en) | Primer and kit for detecting pathogenic vibrio of prawn glass seedlings | |
| CN108085317A (en) | A kind of CRISPR-B gene editings method in selectively targeted Streptococcus mutans gtfB sites and application | |
| RU2817419C1 (en) | Method of lactobacillus fermentum biofilm formation, recovered from periodontal pockets, on inert surfaces |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |