CN103981264A - Technology for carrying out early diagnosis of millet rust by using real-time fluorescence quantitative polymerase chain reaction (PCR) - Google Patents

Technology for carrying out early diagnosis of millet rust by using real-time fluorescence quantitative polymerase chain reaction (PCR) Download PDF

Info

Publication number
CN103981264A
CN103981264A CN201410204435.8A CN201410204435A CN103981264A CN 103981264 A CN103981264 A CN 103981264A CN 201410204435 A CN201410204435 A CN 201410204435A CN 103981264 A CN103981264 A CN 103981264A
Authority
CN
China
Prior art keywords
millet
real
pcr
italicae
uromycessetariae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410204435.8A
Other languages
Chinese (zh)
Other versions
CN103981264B (en
Inventor
李志勇
王楠
董志平
白辉
董立
马继芳
全建章
刘磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Grain Research Institute of Hebei Academy of Agriculture and Forestry Sciences
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201410204435.8A priority Critical patent/CN103981264B/en
Publication of CN103981264A publication Critical patent/CN103981264A/en
Application granted granted Critical
Publication of CN103981264B publication Critical patent/CN103981264B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for detecting content of uromycessetariae-italicae in millet leaves by real-time fluorescence quantitative polymerase chain reaction (PCR). The method comprises the following steps: inoculating the uromycessetariae-italicae into millets, collecting millet leaf samples after 0 hour, 6 hours, 18 hours, 30 hours, 36 hours, 42 hours and 72 hours; extracting total deoxyribonucleic acid (DNA) from the leaf sample collected at each temporal point; designing a specific primer according to a rust ribosomes ITS sequence; carrying out quantitative analysis on the uromycessetariae-italicae by using the specific primer by the real-time fluorescence quantitative PCR, and determining the change rule of the DNA in the tissue after the millet leaves are inoculated with the uromycessetariae-italicae. A fluorescence quantitative PCR detection method for uromycessetariae-italicae with high accuracy, strong specificity and high sensitivity is built, so as to establish basis for research of pathogenic mechanism and molecular biology of the uromycessetariae-italicae.

Description

A kind of technology of utilizing real-time fluorescence quantitative PCR to carry out the early diagnosis of millet rust
Technical field
The present invention relates to, by real-time fluorescence quantitative PCR (Real-time fluorescence quantitative PCR) technology, millet rest fungus is carried out to detection by quantitative, belong to plant epiphyte molecular Biological Detection technical field.
Background technology
Millet ( setaria italica) genus Gramineae ( cramineae) broomcorn millet subfamily ( panicoideae), broomcorn millet system ( panicatae), broomcorn millet family ( paniceae), Herba Setariae Viridis subtribe ( setaviineae) setaria ( setaria), be China's origin a kind of crop early, extensively plant in Northern Part of China.Millet drought resisting is resistance to lean, nutritious, is the important food of China and fodder grain.But due to the generation of millet disease, cause millet output and Quality Down.Millet rust is the recurrent a kind of disease in millet producing region, the world, has a strong impact on millet and produces.In the popular time of rust, no matter Shi Xiagu district, Chun Gu district or the susceptible variety production loss in Xia Guyu Chun Gu miscegenation district are serious, and the general underproduction is more than 30%, and does not receive in serious plot even particle.
Millet rust pathogenic bacteria uromyces setariae-italicae, genus Basidiomycotina ( basidiomycotina), uromyces ( uromyces).Millet rust all can occur on the blade of millet and leaf sheath, but on blade, occurs more serious.Their early stage, at blade surface and leaf back, particularly the back side produces sorrel spot, slightly protuberance, the i.e. uredinium of rest fungus.On blade, generally can produce many urediniums, break through Cuticle after ripe and expose, strengthen the transpiration of plant, make plant lose large quantity of moisture, reduce photosynthesis area, when serious, uredinium is covered with blade, causes blade withered.The morbidity later stage, on the blade back and leaf sheath of diseased plant, especially scattered a large amount of grey black points on leaf sheath, the i.e. telium of rest fungus.Telium is mostly grown on the outside of belly or leaf sheath of blade, buries for a long time raw under host's epidermis, therefore symptom is not obvious.Millet rest fungus is obligate parasite, has the Differentiation of Pathogenicity of height, and various places exist different physiological strains.Millet rust, except causing harm millet, can also infect the high wild broomcorn millet of Green foxtail, Herba setariae geniculatae, hangnail Herba Setariae Viridis, paddy green bristlegrass, medium-sized Herba Setariae Viridis, bur bristlegrass and India etc.
Due to the commitment occurring in disease, symptom is also not obvious, is difficult to find by traditional method, has incured loss through delay the best moment of controlling disease.In recent years, quick, the Accurate Diagnosis of pathogenic bacteria in plant materials that develop into of Protocols in Molecular Biology provides effective instrument.Real-time fluorescence quantitative PCR is the technology that round pcr is combined with fluoroscopic examination growing up in recent years, realize the leap of PCR from qualitative analysis to detection by quantitative, by the collection to fluorescent signal, reach the object of Real-Time Monitoring PCR process, thereby realize the quantitative analysis to template DNA in system.Pan Juanjuan etc. utilize real-time fluorescence quantitative PCR to detect that wheat stripe rust invades wheat leaf blade strip rust bacteria content in wheat leaf blade after 12 hours.M.S. Hamada etc. utilize real-time fluorescence quantitative PCR to detect and quantitatively the Rhizoctonia cerealis on wheat stalk ( rhizoctonia cerealis).Ronald J. Sayler etc. utilize real-time PCR detected dry thread Pyrenomycetes in paddy rice ( rhizoctonia solani) AG-1 IA, sensitivity reaches 1pg.Bohm etc., Gachon etc., Mercado-Blanco etc. also utilize real-time fluorescence quantitative PCR to detect the Changing Pattern of pathogenic bacteria in plant materials.Therefore, Real-Time Fluorescent Quantitative PCR Technique provides technical support for detecting fast and accurately millet rest fungus, and the bacterium that can find the cause of disease more early, is more timely significant to the early detection of millet rust and control.
Summary of the invention
The invention provides a kind of by Real-Time Fluorescent Quantitative PCR Technique detect and accurate quantitative analysis millet in the method for rest fungus, can quick diagnosis go out the concrete content that whether carries rest fungus in millet plant and obtain rest fungus by the method.The method can shorten sense cycle greatly, for the prevention of rust and the control of the state of an illness provide safeguard.
Concrete steps of the present invention are:
1, extract millet rest fungus genomic dna, with ITS universal primer amplification rest fungus genomic dna, its upstream primer and downstream primer base sequence are as shown in SEQ ID No.1 in sequence table and SEQ ID No.2.Pcr amplification obtains the specific fragment of 727bp, fragment is connected and spends the night with PMD19-T carrier after reclaiming purifying, proceed in escherichia coli jm109 competent cell by heat shock method, picking transformed bacteria is dropped into performing PCR and is detected, the clone who inserts object fragment is served to Hai Shenggong and check order, after sequencing analysis, obtain this specific fragment nucleotide base sequence as shown in SEQ ID No.3 in sequence table.The positive colony of the sequence of measuring is extracted to plasmid, utilize NanoDrop 1000 to measure plasmid concentration, facilitate subsequent serial dilution;
2, real-time fluorescence quantitative PCR design of primers
According to rest fungus rrna ITS sequence sequencing result, application Primer Premier 5.0 software designs specific primer sequence SEQ ID No.4 and SEQ ID No.5:
SEQ ID No.4 rustf GGTGCACTTAATTGTGGCTCAA
SEQ ID No.5 rustr CTCCTTTTCTTTTTCCCTCTCAAA
3, the extraction of other common fungal DNA on millet;
4, primer specificity detects
Application primer rustf and rustr to other common fungi millet white hair on millet rest fungus and millet ( sclerospora graminicola), paddy pest ( pyricularia setariae), millet line withered ( rhizoctonia solani), grain grain dust-brand ( ustilago crameri), grain flax spot ( bipolaris setariae), the curved spore of grain mould ( curvularia lunata), grain graywall ( cercospora setariae) DNA that extracts carries out regular-PCR and Real-Time Q pcr amplification, measures the specificity of primer;
5, at millet inoculation rest fungus 0h, 6h, 18h, 30h, 36h, 42h, gathers respectively millet blade sample after 72h;
6, the total DNA of blade sample extraction each time point being gathered;
7, real-time fluorescence quantitative PCR Specification Curve of Increasing
Taking said extracted positive plasmid as fluorescent quantitation standard substance, for fluorescent quantitation Specification Curve of Increasing, amplification reaction system is 10 times of serial dilutions (10ng/ μ L ~ 10fg/μ L): 20.0 μ L, wherein Mix 10.0 μ L, the each 0.8 μ L of upstream and downstream primer, ROX 0.4 μ L, template 2.0 μ L, dH 2o(sterile purified water) 6.0 μ L; Response procedures is: hatch 50 DEG C of 2min, 95 DEG C of 10min of denaturation; 95 DEG C of sex change 15s, 60 DEG C of annealing 1min, carry out 40 circulations altogether; Then 95 DEG C of 15s, 60 DEG C of 1min, then from 0.3 DEG C to 95 DEG C 15s of 60 DEG C of risings per second, collect fluorescence, for drawing melting curve;
8, described typical curve is Y in the present invention 1=-3.381X 1+ 28.248, R 2=0.995, wherein Y 1for the Ct value of real-time fluorescence quantitative PCR reaction, X 1for the standard plasmid content logarithmic value of rest fungus DNA;
9, analyze the rest fungus in millet blade to be measured according to typical curve.
The invention has the advantages that: pathogenic bacteria in applied molecular biology means research plant materials, set up quick, easy authentication method, infect rest fungus 6h in millet and rest fungus just can be detected.This method has not only been identified rest fungus, and can carry out it quantitative accurately, obtain the rest fungus content of millet each time point after by Rust, thereby in the time that also not showing manifest symptom, disease early period of origination just disease is monitored accurately, occur to make in early days corresponding prophylactico-therapeutic measures in disease, the hazard rating of disease is dropped to minimum.
Beneficial effect of the present invention is mainly reflected in:
(1) highly sensitive: to carry out sensitivity detection by doubling dilution DNA standard substance, can detect that minimum concentration is 10fg/μ L;
(2) high specificity: result demonstration, 7 kinds of germs common on millet are showed no amplification, only have rest fungus to produce amplification;
(3) reproducible: the typical curve that the present invention sets up is Y 1=-3.381X 1+ 28.248, R 2=0.995, close to 1.Between this explanation pcr template and Ct value, have good linear functional relation, quantitative result has higher accuracy and repeatability.
Brief description of the drawings
Fig. 1: use the ITS sequence amplification result of universal primer to rest fungus DNA;
Fig. 2: rest fungus serial dilution standard substance Real-time Q pcr amplification curve;
Fig. 3: rest fungus serial dilution standard substance Real-time Q PCR typical curve;
Fig. 4: rest fungus serial dilution standard substance quantitative fluorescent PCR melting curve;
Fig. 5: electrophoresis detection primer specificity, wherein 1 is rest fungus DNA, 2-8 be followed successively by millet white hair ( sclerospora graminicola), paddy pest ( pyricularia setariae), millet line withered ( rhizoctonia solani), grain grain dust-brand ( ustilago crameri), grain flax spot ( bipolaris setariae), the curved spore of grain mould ( curvularia lunata), grain graywall ( cercospora setariae) DNA, 9 negative contrasts;
Fig. 6: Real-time Q PCR detects primer specificity melting curve;
Fig. 7: in millet plant, rest fungus content is with inoculation time variation diagram.
Embodiment
Below by embodiment, also the invention will be further described by reference to the accompanying drawings, but following description do not form the restriction of going up in all senses to protection scope of the present invention, only does example explanation.
Embodiment 1: the amplification of rest fungus ITS sequence.
(1) extraction of rest fungus DNA
A) 25mg rest fungus spore is joined in 1.5 mL centrifuge tubes, add 500 μ L Extraction buffers (50 mM Tris – HCl,, pH 8.0,150 mM NaCl, 100 mM EDTA), fully mix;
B) in mixed solution, add 5 μ L Proteinase Ks (1 mg/mL), then add Extraction buffer to 1 mL, 65 ° of C water-bath 30 min;
C) mixed solution is divided and install in two 1.5 mL centrifuge tubes, add isopyknic phenol/chloroform/primary isoamyl alcohol (25:24:1, vol/vol/vol, pH=8.0), centrifugal;
D) get supernatant, move on in 1.5 clean mL centrifuge tubes, add isopyknic chloroform, centrifugal;
E) get supernatant, move on in 1.5 clean mL centrifuge tubes, add isopyknic freezing Virahol, freezing 1 hour of 20 ° of C;
F) 12,000 rpm, 4 ° of centrifugal 20 min of C, make DNA precipitation;
G) abandon supernatant, with 70% freezing ethanol rinsing twice, after natural air drying, add 0.1 mL TE damping fluid (10 mM Tris – HCl, 1 mM EDTA,, pH 8.0) make its dissolving;
H) add 1 μ L 10 mg/ mL RNA enzymes (final concentration is 20 μ g/ mL), 4 ° of C spend the night, thoroughly enzymolysis RNA;
I) DNA is precipitated again, with 70% freezing ethanol rinsing, natural air drying, be dissolved in 50 μ L TE.
(2) with ITS universal primer to SEQ ID No.1 and SEQ ID No.2 amplification rest fungus DNA
The system of PCR reaction is: 25.0 μ L, wherein 2 × Taq MasterMix, 12.5 μ L, the each 1.0 μ L of upstream and downstream primer 10 μ M, DNA profiling 1.0 μ L, dH 2o(sterile purified water) 9.5 μ L; PCR response procedures is: 95 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C are extended 1min and carry out altogether 35 circulations; 72 DEG C are extended 10min.PCR product after amplification carries out electrophoretic analysis on 1.2% sepharose, uses the imaging of BioRad gel imaging system after EB dyeing.Result shows, can amplify single band, and clip size is in 750bp left and right (seeing accompanying drawing 1).
(3) specific fragment is cut and reclaimed test kit with glue after glue and reclaim DNA, then be connected on pMD-19T carrier and transform in JM109 competent cell, 37 DEG C of incubated overnight in the LB substratum that has added ammonia benzyl resistance, select the positive colony growing and carry out sequencing analysis, recording sequence is SEQ ID No.3, sequence is analyzed through Blast at NCBI, is up to 97% with rest fungus sequence homology, determines thus the exactness of amplified fragments.Utilize the little extraction reagent kit of plasmid to extract positive colony plasmid, and using it as fluorescent quantitation positive plasmid standard substance, utilize NanoDrop 1000 to measure plasmid concentration.
Embodiment 2: the specific detection of primer.
Select fungi millet white hair common on other 7 kinds of millets ( sclerospora graminicola), paddy pest ( pyricularia setariae), millet line withered ( rhizoctonia solani), grain grain dust-brand ( ustilago crameri), grain flax spot ( bipolaris setariae), the curved spore of grain mould ( curvularia lunata), grain graywall ( cercospora setariae) carry out the checking of primer specificity, concrete steps are:
(1) the total DNA that extracts these several bacterium is template, and extracting method is identical with the extracting method of rest fungus DNA;
(2) according to rest fungus rrna ITS sequence sequencing result, application Primer Premier 5.0 software designs fluorescent quantitation Auele Specific Primer SEQ ID No.4 and SEQ ID No.5:
SEQ ID No.4 rustf GGTGCACTTAATTGTGGCTCAA
SEQ ID No.5 rustr CTCCTTTTCTTTTTCCCTCTCAAA
(3) application primer rustf/rustr carries out regular-PCR and Real-Time Q pcr amplification to rest fungus DNA and other 7 kinds of fungal DNAs, and result demonstration, only has rest fungus DNA to have amplified production, and other 7 kinds of fungies do not have corresponding amplified production.The specificity of presentation of results primer is fine, can be for the specificity analyses of rest fungus.
Increased primer specificity is detected and shown by regular-PCR, primer only can stably amplify the target stripe of 145bp to rest fungus DNA, and other 7 kinds of fungal DNAs and negative control all do not amplify target stripe (seeing accompanying drawing 5).By Real-Time Q PCR, the specific detection of primer is shown equally, there is single product absorption peak to primer pair rest fungus in this, other 7 kinds of fungies, without this product absorption peak (seeing accompanying drawing 6), have shown that this Real-Time Q PCR detects as specific amplification.
Embodiment 3: the foundation of real-time fluorescence quantitative PCR system and detection are analyzed
Auele Specific Primer is pair identical with embodiment 2.
(1) production standard Curves needs the preparation of template
Be 10ng/ μ L, 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100 fg/μ L, 7 concentration gradients of 10 fg/μ L by positive plasmid DNA standard substance gradient dilution.
(2) real-time fluorescence quantitative PCR
Carry out quantitative fluorescent PCR analysis taking the DNA having diluted as template, negative control is set simultaneously.20 μ L reaction system: Mix 10.0 μ L, the each 0.8 μ L of upstream and downstream primer, ROX 0.4 μ L, template 2.0 μ L, dH 2o(sterile purified water) 6.0 μ L; Response procedures is: UDG is hatched 50 DEG C of 2min, 95 DEG C of 10min of denaturation; 95 DEG C of sex change 15s, 60 DEG C of annealing 1min, carry out 40 circulations altogether; Then 95 DEG C of 15s, 60 DEG C of 1min, then from 0.3 DEG C to 95 DEG C 15s of 60 DEG C of risings per second, collect fluorescence, for drawing melting curve.Reaction is at Applied Biosystems StepOne tMon fluorescent PCR instrument, carry out, amplification curve, typical curve and melting curve are generated automatically by instrument.
Applied Biosystems StepOne tMreal-Time PCR Software draws out the amplification curve (seeing accompanying drawing 2) of reaction.Amplification curve shows, 7 curves represent the amplification curve of the gradient dilution of 10ng/ μ L, 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100 fg/μ L, 10 fg/μ L of standard substance successively from left to right, 7 DNA standard substance amplification curves are more smooth, present typical S type curve, and each cycle threshold (Ct value) interval is more even.
Cycle threshold (Ct value) the Applied Biosystems StepOne of the each gradient concentration of standard substance providing according to amplification curve and reaction tMreal-Time PCR Software draws out the typical curve (seeing accompanying drawing 3) of reaction voluntarily.This typical curve cycle threshold and template concentrations present good linear relationship, coefficient R 2=0.995, slope is-3.381, and amplification efficiency E=97.58% meets the requirement of quantitative fluorescence analysis to typical curve.
Measure melting temperature (Tm) in PCR process of the standard substance of each concentration gradient dilution and sample and draw melting curve (seeing accompanying drawing 4).The melting curve peak type of standard substance and sample is single, and standard substance and sample melting temperature (Tm) identical (75.47), shows that amplified reaction product melting temperature (Tm) is compared with homogeneous, and specificity is good and affect without primer dimer.
Embodiment 4: millet is by rest fungus content analysis in Rust rear blade
The Applied Biosystems StepOne that quantitative real time PCR Instrument adopts ABI company to produce tMfluorescent PCR instrument carries out.
(1) collection of leaf sample
Aseptic culture 15 basin millet susceptible variety Yungu No.1s, every basin 5 young plants, when being cultured to millet seedling growing to for 6 ~ 7 leaf phase in incubator for experiment.The fresh uredospore of strong millet rest fungus toxicity microspecies 93-5 monospore fungus strain is made into 5 × 10 6the spore suspension of individual spore/mL, is sprayed on millet blade uniformly, and under dark condition, moisturizing 48h is placed in incubator and continues to cultivate.At millet inoculation rest fungus 0h, 6h, 18h, 30h, 36h, 42h, gathers respectively millet blade sample after 72h, and every basin gathers 1 leaf, totally 15, as 1 repetition, 3 repetitions is set altogether.The blade collecting is put into rapidly in liquid nitrogen, is then saved in-80 DEG C, for subsequent use.
(2) the total DNA of blade sample extraction each time point being gathered
A) get millet blade 1-1.5g, add liquid nitrogen grind into powder;
B) by powder transfer in 1.5mL centrifuge tube, add 650 μ L CTAB Extraction buffers, 65 DEG C of water-bath 40min;
C) be cooled to after room temperature, add isopyknic chloroform/primary isoamyl alcohol mixed solution (v:v=24:1), put upside down and mix, 4 DEG C, centrifugal 15 min of 12000rpm;
D) get supernatant in new 1.5mL centrifuge tube, add isopyknic chloroform/primary isoamyl alcohol mixed solution (v:v=24:1), put upside down and mix, 4 DEG C, centrifugal 15 min of 12000rpm;
E) get supernatant in new 1.5mL centrifuge tube, add isopyknic freezing Virahol, put upside down and mix, be placed in-20 DEG C of freezing 30min;
F) 4 DEG C, centrifugal 15 min of 12000rpm;
G) abandon supernatant, the ethanol rinsing precipitation of functional quality concentration 75% 1-2 time;
H) after precipitating natural air drying, be dissolved in 200 μ L TE, utilize NanoDrop 1000 to measure the rear total DNA concentration of each time point blade of inoculation, 4 DEG C save backup.
(3) Auele Specific Primer pair that utilizes embodiment 2 to provide, adopts the amplification system of embodiment 3 to increase, and calculates and can obtain rest fungus content in each inoculation time point millet blade according to typical curve.Result shows, after inoculation 6h, just can detect that the content of rest fungus in blade is 0.03ng/g blade, and along with rest fungus content in the increase millet blade of inoculation time increases (seeing accompanying drawing 7).
The upstream primer of millet rest fungus (Uromyces setariae-italicae) ITS sequence fragment amplification universal primer:
TCCGTAGGTGAACCTGCGG
The downstream primer of millet rest fungus (Uromyces setariae-italicae) ITS sequence fragment amplification universal primer:
TCCTCCGCTTATTGATATGC
The target fragment of millet rest fungus (Uromyces setariae-italicae) ITS sequence universal primer amplification:
TCCGTAGGTGAACCTGCGGAAGGATCATTATTGATAAAAAAAAATGGGTGCACTTAATTGTGGCTCAATTTATATTATCATTTCACATCTCATATACAAAACTTATTAACGTGAAGAAATTCATTGTTAATAGGTATAAGTAAATTTCTTTACTCTTCCCCTTTTTTTTTGAGAGGGAAAAAGAAAAGGAGTTTGCATTATCCCCCCCAACCTTTTTTTTTAACACTATATCAATGAACTTGAATGTAAAAATATGTTATAAATCATATATAACTTTTAACAATGGATCTCTAGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAGAGGTACACCTGTTTGAGTGTCATGAAAACCTTCTCATTATATAAAATTTTAATTAATTTTGTATATGGATTTTGAATGTTGCAAAAAAATAATCATAAATTTATTTGCTCATTTTAAATAAATAAAAGTTATATTCAAATGTATGAGTGGATTAACTTGATGCGTAATAATTTTCCAATCTCACATTAAGGAAGGAGTTTTGATAAACTTGCCACTTTTTATATATTTTGAAAAGGACTACTAAAGTAAAATCATTTTTTTTTTTTTAGACCTCAAATCAGGTGGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
The specificity upstream primer rustf of millet rest fungus (Uromyces setariae-italicae) ITS sequence fragment amplification:
GGTGCACTTAATTGTGGCTCAA
The specificity downstream primer rustr of millet rest fungus (Uromyces setariae-italicae) ITS sequence fragment amplification:
CTCCTTTTCTTTTTCCCTCTCAAA
The target fragment of millet rest fungus (Uromyces setariae-italicae) ITS sequence specific primers amplification:
GGTGCACTTAATTGTGGCTCAATTTATATTATCATTTCACATCTCATATACAAAACTTATTAACGTGAAGAAATTCATTGTTAATAGGTATAAGTAAATTTCTTTACTCTTCCCCTTTTTTTTTGAGAGGGAAAAAGAAAAGGAG

Claims (1)

1. one kind is carried out the method for early diagnosis to the rest fungus in millet blade by real-time fluorescence quantitative PCR, it is characterized in that: utilize the Auele Specific Primer of real-time fluorescence quantitative PCR reaction, respectively called after rustf and rustr---
Rustf:GGTGCACTTAATTGTGGCTCAA, rustr:CTCCTTTTCTTTTTCCCTCTCAAA; By DNA combination dye (SYBR Green I) method, carry out amplified reaction taking the total DNA of millet blade extracting as template, if can amplify the nucleotide fragments of 145bp, this millet has infected millet rust.
CN201410204435.8A 2014-05-15 2014-05-15 A kind of technology utilizing real-time fluorescence quantitative PCR to carry out millet rust early diagnosis Active CN103981264B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410204435.8A CN103981264B (en) 2014-05-15 2014-05-15 A kind of technology utilizing real-time fluorescence quantitative PCR to carry out millet rust early diagnosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410204435.8A CN103981264B (en) 2014-05-15 2014-05-15 A kind of technology utilizing real-time fluorescence quantitative PCR to carry out millet rust early diagnosis

Publications (2)

Publication Number Publication Date
CN103981264A true CN103981264A (en) 2014-08-13
CN103981264B CN103981264B (en) 2016-06-29

Family

ID=51273435

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410204435.8A Active CN103981264B (en) 2014-05-15 2014-05-15 A kind of technology utilizing real-time fluorescence quantitative PCR to carry out millet rust early diagnosis

Country Status (1)

Country Link
CN (1) CN103981264B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111334601A (en) * 2020-03-12 2020-06-26 河北省农林科学院谷子研究所 Early diagnosis method for northern millet leaf blight

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586427A (en) * 2012-01-13 2012-07-18 河南科技大学 Method for identifying wheat leaf rust single sorus by utilizing nested PCR (polymerase chain reaction)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586427A (en) * 2012-01-13 2012-07-18 河南科技大学 Method for identifying wheat leaf rust single sorus by utilizing nested PCR (polymerase chain reaction)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
冯凌云 等: "粟锈菌生理分化研究", 《沈阳农业大学学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111334601A (en) * 2020-03-12 2020-06-26 河北省农林科学院谷子研究所 Early diagnosis method for northern millet leaf blight
CN111334601B (en) * 2020-03-12 2022-06-03 河北省农林科学院谷子研究所 Early diagnosis method for northern millet leaf blight

Also Published As

Publication number Publication date
CN103981264B (en) 2016-06-29

Similar Documents

Publication Publication Date Title
CN103333969B (en) Method and kit for quickly detecting verticillium dahliae through PCR (polymerase chain reaction)
CN101974650B (en) Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit
CN103498000B (en) Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method
CN101643788B (en) Detection primer of potato late blight bacterium molecules and use method thereof
CN102329879B (en) Rapid identification method of Brucellosis aerosol by using fluorescent quantitative PCR (polymerase chain reaction)
CN101974651B (en) Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian
CN108588249B (en) Primer pair for detecting sweet potato stem rot bacteria and detection method thereof
CN104232782B (en) A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method
CN108893557A (en) A kind of method of three kinds of wheat rhizome portion diseases of quick detection
CN103045747B (en) Molecular detection primer for sweet potato black rot germs and application of molecular detection primer
CN105316427A (en) Fluorescent quantitative PCR detection kit for quickly detecting pythium aphanidermatum
CN102311994A (en) Fluorescence quantitative PCR (polymerase chain reaction) detection method of aspergillus fumigatus
CN102329858B (en) Sugarcane smut bacteria nest type polymerase chain reaction (PCR) quick detection method
CN106435007A (en) Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)
CN101451162B (en) Primer, detecting probe and actual time fluorescent PCR kit for detecting Thielaviopsls basicola
CN103981264A (en) Technology for carrying out early diagnosis of millet rust by using real-time fluorescence quantitative polymerase chain reaction (PCR)
CN104293957B (en) A kind of early stage rapid molecular detection method of Botrytis cinerea
CN104099408A (en) Method for qualitatively detecting potato scab pathogen
CN103981265B (en) Millet rest fungus nest-type PRC efficient detection method
CN104212896B (en) The Molecular Identification primer of a kind of Tobacco Angular Leaf Spot Disease bacterium and authentication method
CN104195254A (en) Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology
CN105506072B (en) Detect primer and its application of mulberry pseudomonas syringae
CN112280890A (en) Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof
CN105039331A (en) Peronophythora litchi LAMP primer as well as rapid detection method and application thereof
CN106957915A (en) Detection primer, kit and the quantitative detecting method of apple tree/Fungus of Pear Canker Disease bacterium

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C41 Transfer of patent application or patent right or utility model
TR01 Transfer of patent right

Effective date of registration: 20170203

Address after: 050035 Shijiazhuang City, Hebei Province East Development Zone, Mt. Hengshan street, No. 162, millet, by the end of 113

Patentee after: Grain Institute, Provincial Academy of Agriculture and Forestry, Hebei Provinee

Address before: 050035 Mt. Hengshan, Shijiazhuang, East Development Zone, No. 162, millet

Patentee before: Dong Zhiping