CN103966355A - Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit - Google Patents
Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit Download PDFInfo
- Publication number
- CN103966355A CN103966355A CN201310028194.1A CN201310028194A CN103966355A CN 103966355 A CN103966355 A CN 103966355A CN 201310028194 A CN201310028194 A CN 201310028194A CN 103966355 A CN103966355 A CN 103966355A
- Authority
- CN
- China
- Prior art keywords
- hiv
- sequence
- probe
- seq
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit, which comprises a RT-PCR reaction solution, a RT-PCR enzyme mixture, a primer probe, a negative control, a HIV-1B subtype positive control and a HIV-1AE subtype positive control. According to the present invention, one-step genotyping detection can be performed on the extracted HIV-1, and the UNG enzyme is adopted to prevent product pollution so as to avoid false positive, wherein the HIV-1B subtype is detected with the FAM channel, and the HIV-1AE subtype is detected with the HEX channel; and the kit has characteristics of simple one-step amplification method, short procedure, easy operation, pollution prevention, strong detection result specificity, high sensitivity, clear result and high result reliability, and is used for gene detection of human immunodeficiency virus type 1 (HIV-1) B subtype and AE subtype.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of Measurement for Biotechnique, relate in particular to a kind of gene parting detecting reagent for human immunodeficiency virus type 1 (HIV-1) RNA.
Background technology
Human immunodeficiency virus (Human Immunodeficiency Virus, HIV) is a kind of slow virus (Lentivirus) that infects human immunity system cells, belongs to the one of retrovirus (Retrovirus).This virus is destroyed the immunologic function of human body, cause the immune resistibility that loses, thereby cause various diseases pathogenic agent to be able to survive in human body, develop into last, causing acquired immune deficiency syndrome (AIDS) (is acquired immune deficiency syndrome (AIDS), Acquired Immunodeficiency Syndrome, AIDS), for a kind of so far without the effective mortality transmissible disease of therapy.From 1981 since the U.S. finds first and confirms, acquired immune deficiency syndrome (AIDS) has been captured the life that exceedes 3,000 ten thousand people, make it become one of global prevailing disease of tool destructive force in history, approximately have in the world in by the end of May, 2,011 6,400 ten thousand people's aids infection poison by, on average have 7000 new cases every day.At present, South Asia and South East Asia become the second severely afflicated area after Sub-Saharan Africa.China CDC estimates, ends to the end of the year 2011 China survival HIV carriers and AIDS patient approximately 780,000 people, annual new the infected 4.8 ten thousand people, dead 2.8 ten thousand people.Epidemic situation has covered national all provinces, autonomous regions and municipalities, and at present China faces acquired immune deficiency syndrome (AIDS) morbidity and dead peak period, and has been started to population to spread by high risk population such as drug abuse, unlicensed prostitutes, and anti-Chinese mugwort, the situation is tense for anti-Chinese mugwort.
According to gene difference, HIV can be divided into HIV-1 type and HIV-2 type.Generally, HIV-1 virus is the pathogenic agent that most HIV infect, and HIV-2 virus mainly appears at Africa, especially in area, West Africa.The circulation way of HIV-2 is identical with HIV-1, all can generator opportunistic infections and AIDS, but immune deficiency due to HIV-2 develops comparatively slowly and gentle.The hypotype difference that different areas are popular, also there is some difference for the epidemic status of same hypotype in different areas.At present, the popular HIV-1 type that is mainly in world wide.In the U.S., because HIV-2 is comparatively rare, HIV-2 is not listed in conventional sense.
On clinical medicine, this process is divided into four periods: acute infection period, latent period, pre-AIDS and typical AIDS stadium.Conventionally adopt cd4 cell counting and virus load as the index of weighing AIDS progress.Also there is objection for different subtype whether there are differences aspect virus progress.Some research thinks that different subtype HIV infects the speed difference of progress for AIDS.As research of Senegal shows, it is high 8 times that the ratio that infects C, D, G hypotype in women infects the possibility that A hypotype progress is AIDS.The dry research discovery of crow, in the infected that grows up, D hypotype is lower than the cd4 cell quantity of A hypotype, and more easily progress is for dead.Also there is research to think different subtype no significant difference aspect progression of disease.According to the dependency of HIV-1 gene hypotype and progression of disease, measurable AIDS progress, this is significant for pharmacological agent.At drug treatment, the antiretroviral drugs using at present comprises nucleotide reverse transcriptase inhibitors (RNTIs), non-nucleotide reverse transcriptase inhibitors (NRNTIs) and proteinase inhibitor (PIs) three classes, mainly for the HIV-1 B hypotype of European and American developed countries
polthe reversed transcriptive enzyme of genes encoding and proteolytic enzyme Development and design, and other subtype virus strains may affect the treatment to there are differences in the susceptibility of this medicine.
At present, popular HIV is mainly M group HIV-1 type and (there is not yet the report of HIV-1 N group and O group at present within the border within Chinese territory, the report of HIV-2 type cases of infection is few), its genotype is mainly B/B ', BC recombinant type (comprising CRF 07_BC recombinant type and CRF 08_BC recombinant type) and AE recombinant type (CRF 01_AE recombinant type).Therefore, in conjunction with HIV-1 different subtype, in Chinese epidemic status, the factors such as the impact of each hypotype HIV-1 on acquired immune deficiency syndrome (AIDS) Development process, have important practical significance to the genotype tests of HIV-1 B hypotype and AE hypotype.
The detection method of HIV-1 totally can be divided into antibody test and virus detects two large classes.Virus detects and comprises that cell cultures (virus separates), p24 Detection of antigen and viral nucleic acid detect.Early stage is mainly the antibody that detects anti-HIV-1 by serological test to the diagnosis of HIV-1, indirectly diagnoses HIV-1 to infect.At present, use more HIV-1 subtype typing method to have direct sequencing, heteroduplex mobility assay, serological typing method and nucleic acid detection method etc.In recent years, molecular biology method was constantly applied in the detection of HIV-1, and the laboratory diagnostic method of HIV makes great progress, and detection of nucleic acids has become the developing direction of HIV-1 laboratory diagnosis.
Traditional nucleic acid detection method is to adopt nucleic acid hybridization technique to detect object nucleic acid, although adopt radiolabeled probe can improve the susceptibility of detection, but still on the low side, can not meet clinical needs.Nucleic acid detection technique development recent years rapidly, is mainly to adopt various amplification amplifying techniques to improve the sensitivity detecting.Along with the maturation of amplification technique, the target sequence of low copy can be become logarithm level to amplify amplification, adopt the on-radiation detection system that specific activity probe is sensitiveer (as electrochemical luminescence system etc.) simultaneously, the sensitivity that obviously improves detection of nucleic acids, and reduce the pollution of radioactive substance.The method that detects HIV-1 RNA viruses carrying capacity mainly contains branched DNA and detects (bDNA), reverse transcription polymerase chain reaction (RT-PCR) and amplification of nucleic acid sequences detection (NASBA) etc., wherein, the fluorescent quantitative RT-PCR method based on TaqMan probe technique has developed into maturation, has commonly used and effective detection means.
TaqMan probe technique is the fluorescent quantitative PCR technique of high special.TaqMan probe is a kind of oligonucleotide probe, and fluorophor is connected to 5 ' of probe-end, and quenching group is at probe 3 '-end.In the time that probe is complete or match with target sequence, the fluorescence of fluorophor transmitting, because approaching and be quenched with the quenching group of 3 '-end, produces without fluorescent signal.In the time carrying out PCR reaction extension process,
taq5' → 3' exonuclease activity of archaeal dna polymerase is degraded probe, and fluorophor is separated with quenching group, produces fluorescent signal.PCR reaction cycle of every experience, just has the amplified production of a part to generate, and is accompanied by the generation of the fluorescent signal of a part.Along with the increase of amplification cycles number, the fluorophor signal discharging constantly accumulates, and is the process that an Exponential Synchronization increases, and the intensity of fluorescent signal has just represented the copy number of amplified production.This technology has high specificity, level of automation high, efficiently solves the problems such as PCR pollution.HIV-1 fluorescent quantitation detects just based on this principle design, for the diagnosis of HIV-1 early infection, extensive examination, curative effect performance analysis, new drug development etc. provide good technical support.At present, the HIV-1 typing detection reagent of external listing is all based on TaqMan probe technique, product has ViroSeq HIV-1 Genotyping System with the 3700 Genetic Analyzer(Celera companies, 2003) and Trugene HIV-1 Genotyping Kit and Open Gene DNA Sequencing System(Siemen company, 2002) etc., the domestic HIV-1 somatotype testing product that there is no goes on the market.
For avoiding the false positive of reaction result, utilize the antipollution characteristic of UNG enzyme simultaneously, in pcr amplification reaction, replace dTTP with dUTP, so only in amplified fragments, contain dUTP; And dUTP makes the amplicon polluting be easy to the enzyme liberating by UNG before amplification target DNA: the PCR product of this dUTP of containing is hatched together with UNG enzyme, because of the N-glycosyl bond between UDG enzyme cleavable uridylic base and sugared phosphoric acid skeleton, can from strand or double-stranded DNA, eliminate dUTP and stop
taqthe extension of archaeal dna polymerase, thus the ability being increased again lost.UNG enzyme loses activity above at 50 DEG C, can not destroy patient HIV-1 RNA like this through thermal cycling.UNG enzyme has no effect to the template that does not contain dUTP, and therefore, the HIV-1 RNA only extracting from HIV-1 positive patients sample serum in reaction system is not because directly being carried out RT-PCR reaction by UNG enzyme liberating.
This technology is by analyzing the each genotype sequence alignment of HIV-1, obtain for the universal primer of HIV-1 B hypotype and AE hypotype and specific fluorescent probe separately, by detecting various HIV-1 standard serums and clinical serum, determine the various detection indexs of this test kit, determine specificity, sensitivity that this test kit detects, for the making a definite diagnosis of HIV-1, Large-scale Screening, severity extent judgement, therapeutic evaluation, new drug development etc. provide a convenience, cheap detection means.Its gordian technique is to obtain for the universal primer of various HIV-1 B hypotypes and AE hypotype and specific fluorescent probe separately, prepares high specific, does susceptibility, reproducible HIV-1 gene type RT-PCR detection kit.
Summary of the invention
The object of the invention is to: a kind of accurate easy method detecting for human immunodeficiency virus type 1 (HIV-1) rna gene somatotype is provided; Another object is to provide a kind of test kit for the method.
Technical scheme of the present invention is: a kind of human immunodeficiency virus type 1 genotype tests method and test kit are provided, adopt single stage method gene type RT-PCR technology to carry out genotype tests to human immunodeficiency virus type 1 (HIV-1) B hypotype and AE hypotype.Starfish credit medical science and technology Development Co., Ltd post method purified reagent (pellosil absorption method) is carried out after nucleic acid extraction HIV-1 positive serum sample in the use, directly preparation reaction system increases, reaction system preparation is convenient, amplification program step is easy, proliferation time is short, without recirculation repeatedly, prevent product pollution.The inventive method is easy and simple to handle, susceptibility is high, result is distinct, reliability is high.
Test kit provided by the invention comprises: RT-PCR reaction solution, RT-PCR enzyme mixture, primer probe, negative control, HIV-1 B hypotype positive control and HIV-1 AE hypotype positive control.The nucleic acid that test kit provided by the invention detects need be by using Shanghai Xingyao Medical Technology Development Co., Ltd.'s post method purified reagent (pellosil absorption method) to carry out nucleic acid extraction to HIV-1 positive serum sample, the HIV-1 RNA extracting is directly carried out to gene type RT-PCR detection, and wherein said RT-PCR reaction solution is Tris-HCl (pH8.3) 20 mM, KCl 100 mM, gelatin 0.2 mg/ml, dATP, dGTP, each 0.4 mM of dCTP, dUTP, MgCl
2the mixed solution of 6 mM; Described enzyme mixture be reversed transcriptive enzyme,
taqthe mixture of archaeal dna polymerase and UNG enzyme (reversed transcriptive enzyme 3 U/ul,
taqarchaeal dna polymerase 2 U/ul, UNG enzyme 1 U/ul); Described primer probe is mixed solution (each 6.25 uM of primer of a pair of HIV-1 Auele Specific Primer, a HIV-1 B hypospecificity probe and a HIV-1 AE hypospecificity probe, HIV-1 B hypospecificity probe 2.5 uM, HIV-1 AE hypospecificity probe 2.5 uM); Described negative control is the normal human serum without HIV-1 RNA; Described HIV-1 B hypotype positive control is the human serum of the slow virus that contains HIV-1 B subtype gene fragment; Described HIV-1 AE hypotype positive control is the human serum of the slow virus that contains HIV-1 AE subtype gene fragment.The HIV-1 specificity universal amplification primer that detects use divides upstream primer and downstream primer,
Upstream primer sequence < SEQ ID No.3 > is: 5 '-AGACAGGATCAGAAGAACTTA-3 ',
Downstream primer sequence < SEQ ID No.4 > is: 5 '-TCTAAAGCTTCCTTGGTGTCTTTTA-3 ',
HIV-1 B hypospecificity probe sequence < SEQ ID No.5 > is: 5 '-FAM-ATAATATCAGTAGCAACCCTCTATTG-TAMRA-3 ',
HIV-1 AE hypospecificity probe sequence < SEQ ID No.6 > is: 5 '-JOE-TTAATATCARTAGCAACCCTCTGGTG-TAMRA-3 '.
Reagent provided by the invention is stored in-20 DEG C, reduces multigelation as far as possible.
Test kit using method of the present invention:
Each detection all should be set up negative control, HIV-1 B hypotype positive control and HIV-1 AE hypotype positive control, and amplification detection method is as follows:
A, prepare reaction solution by reaction sample number (reaction sample number=sample number+reference substance 3+1 to be checked) n: get RT-PCR reaction solution n × 12.5 μ l, primer probe n × 2 μ l, RT-PCR enzyme mixture n × 0.5 μ l mixes in a centrifuge tube; The low-speed centrifugal several seconds, install in reaction tubes by 15 μ l/ pipes point;
B, sample this extract, the each 10 μ l of reference substance extract add respectively in reaction tubes, the low-speed centrifugal several seconds, take out put on full-automatic fluorescent PCR instrument;
C, response procedures are: 37 DEG C of reaction 10 min, and 50 DEG C of reaction 15 min, then 95 DEG C of insulation 2 min, then by 94 DEG C of 10 s → 60 DEG C 45 s, circulate 45 times, and in 60 DEG C of signals that gather respectively FAM, JOE fluorescence channel;
D, instrument PCR program are carried out result preservation and data analysis by instrument and software requirement after having moved.To get fluorescent value higher than sample noise line and negative control as detection threshold.The detection reaction fluorescence intensity of amplified production all the time under two channels (FAM and JOE): Ct value is 0 or blank: human immunodeficiency virus type 1 is negative; FAM passage detects Ct value and is less than or equal to 40: human immunodeficiency virus type 1 is positive, patient HIV-1 B Subtypes; JOE passage detects Ct value and is less than or equal to 40: human immunodeficiency virus type 1 is positive, patient HIV-1 AE Subtypes.
The inventive method principle is based on TaqMan hydrolysis probes fluorescent PCR principle, taking viral HIV-1 RNA as template, adopts virogene group-specific primers probe, be aided with reversed transcriptive enzyme,
taqarchaeal dna polymerase and UNG enzyme, through single stage method fluorescence RT-PCR experiment, can be fast, accurately human immunodeficiency virus type 1 (HIV-1) RNA template is carried out to gene type analysis; From reverse transcription to fluorescent PCR, a step can complete, and can effectively prevent that multiple operation from polluting.So detection method of the present invention and test kit high specificity, susceptibility is high, easy and simple to handle, result is distinct, reliability is high, can be used for the gene test of human immunodeficiency virus type 1 in serum (HIV-1) B hypotype and AE hypotype.
Embodiment
embodiment 1a kind of human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit.
1. the extraction of human immunodeficiency virus type 1 (HIV-1) RNA
Use Shanghai Xingyao Medical Technology Development Co., Ltd.'s post method purified reagent (pellosil absorption method) to carry out nucleic acid extraction to HIV-1 positive serum sample.
2. reverse transcription and fluorescence RT-PCR amplification (every person-portion 25ul system)
The preparation of a, single stage method fluorescence quantitative RT-RCR reaction solution:
B, single stage method fluorescence quantitative RT-RCR response procedures:
[1] 37℃ 10 min
[2] 50℃ 15 min
[3] 95℃ 2 min
[4] 94℃ 10 s
[5] 60℃ 45 s
[6] Go to [4] ，45 cycles
Gather FAM and JOE passage fluorescent signal in the 5th step,
[7] End。
3. detect:
The present invention is applicable to ABI StepOne, ABI 7500 types and ABI 7300 type quantitative real time PCR Instruments and carries out fluorescent quantitation detection.
4. result judgement:
Instrument PCR program is carried out result preservation and data analysis by instrument and software requirement after having moved.To get fluorescent value higher than sample noise line and negative control as detection threshold.The detection reaction fluorescence intensity of amplified production all the time under two channels (FAM and JOE): Ct value is 0 or blank: human immunodeficiency virus type 1 is negative; FAM passage detects Ct value and is less than or equal to 40: human immunodeficiency virus type 1 is positive, patient HIV-1 B Subtypes; JOE passage detects Ct value and is less than or equal to 40: human immunodeficiency virus type 1 is positive, patient HIV-1 AE Subtypes.
embodiment 2clinical detection
200 routine clinical samples are carried out to genotype tests with aforesaid method, wherein human immunodeficiency virus type 1 patient 48 examples, detect positive rate 24%, wherein, it is 39.58%(19/48 that HIV-1 B hypotype detects positive rate), it is 60.42%(29/48 that HIV-1 AE hypotype detects positive rate).Detection method of the present invention and test kit high specificity, susceptibility is high, easy and simple to handle, degree of repeatability is high, can carry out the detection of rapid gene somatotype to human immunodeficiency virus type 1 (HIV-1) RNA.The present invention uses Shanghai Xingyao Medical Technology Development Co., Ltd.'s post method purified reagent (pellosil absorption method) to carry out nucleic acid extraction to HIV-1 positive serum sample, has ensured the purity of template.Meanwhile, utilize single stage method fluorescence somatotype RT-PCR technology.After nucleic acid extraction finishes, directly nucleic acid is joined in reaction system, the synthetic and PCR of cDNA reacts at a pipe, without increasing additional step; And use UNG enzyme to avoid amplified production to pollute.The accuracy of amplification had both been guaranteed in this operation, sensitivity, shorten again the time, reduced pollution, improve the simplicity of fluorescent quantitative PCR detection method, not only can be used for the genotype tests of HIV-1 B hypotype and AE hypotype, also can be used as clinical labororatory to HIV-1 infect aided diagnosis method and the monitoring means of clinical therapeutic efficacy.
Nucleotides sequence list
SEQUENCE LISTING
<110> Shanghai Xingyao Medical Technology Development Co., Ltd.
Shanghai Fosun Pharmaceutical (Group) Co., Ltd.
Late, sharp greatly
Wu, great order
Summer, virtuous
<120> human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit
<130> HIV-1 somatotype
<140> cn
<141> 2012-12-21
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 100
<212> DNA
<213> Human immunodeficiency virus type 1
<400> 1
agacaggatc agaagagatt aaatcattat acaatacagt agcaaccctc tattgtgtac 60
atcaaaggat agaggtaaaa gacaccaagg aagctttaga 100
<210> 2
<211> 100
<212> DNA
<213> Human immunodeficiency virus type 1
<400> 2
agacaggatc agaagaactt aaatcattat ttaacacagt agcagtcctt tggtgcgtac 60
accagaggat agagataaaa gacaccaaag aagctttaga 100
<210> 3
<211> 21
<212> DNA
<213> Artificial
<220>
<223> artificial sequence
<400> 3
agacaggatc agaagaactt a 21
<210> 4
<211> 25
<212> DNA
<213> Artificial
<220>
<223> artificial sequence
<400> 4
tctaaagctt ccttggtgtc tttta 25
<210> 5
<211> 28
<212> DNA
<213> Artificial
<220>
<223> artificial sequence
<220>
<221> HIV-1 genotyping SEQ ID No.5
<222> (2)..(27)
<223> b=FAM; d=TAMRA
<400> 5
bataatatca gtagcaaccc tctattgd 28
<210> 6
<211> 28
<212> DNA
<213> Artificial
<220>
<223> artificial sequence
<220>
<221> HIV-1 genotyping SEQ ID No.6
<222> (2)..(27)
<223> b=JOE; d=TAMRA
<400> 6
bttaatatca rtagcaaccc tctggtgd 28
Claims (5)
1. a human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit, it is characterized in that: the present invention is by investigating human immunodeficiency virus type 1 (HIV-1) genom sequence, and difference compare of analysis is carried out in the specificity site between the each gene hypotype sequence of retrieval gained HIV-1, design a pair of specificity amplification primer, a HIV-1 B hypospecificity fluorescent probe and a HIV-1 AE hypospecificity fluorescent probe, adopt real-time fluorescent quantitative RT-PCR method amplification somatotype testing goal gene.
2. human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit claimed in claim 1, is characterized in that: the gene order of hepatitis C virus specific pcr amplification is:
〈SEQ ID No.1〉
5'-AGACAGGATCAGAAGAGATTAAATCATTATACAATACAGTAGCAACCCTCTATTGTGTACATCAAAGGATAGAGGTAAAAGACACCAAGGAAGCTTTAGA-3'，
〈SEQ ID No.2〉
5'-AGACAGGATCAGAAGAACTTAAATCATTATTTAACACAGTAGCAGTCCTTTGGTGCGTACACCAGAGGATAGAGATAAAAGACACCAAAGAAGCTTTAGA-3'，
Human immunodeficiency virus type 1 gene parting detecting reagent extension increasing sequence total length 100 bp, belong to HIV-1
gagstructure gene district is single-copy sequence.
3. human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit as claimed in claim 1, a sequence in a pair of HIV-1 specificity amplification primer sequence is identical with the partial sequence shown in SEQ ID No.1 and SEQ ID No.2, the partial sequence complementation shown in another sequence and SEQ ID No.1 and SEQ ID No.2; HIV-1 B hypospecificity probe is identical or complementary with the partial sequence shown in SEQ ID No.1; HIV-1 AE hypospecificity probe is identical or complementary with the partial sequence shown in SEQ ID No.2, wherein, described a pair of HCV Auele Specific Primer, its sequence can be selected from SEQ ID No. 3 and SEQ ID No.4,
< SEQ ID No.3 > is: 5'-AGACAGGATCAGAAGAACTTA-3',
< SEQ ID No.4 > is: 5'-TCTAAAGCTTCCTTGGTGTCTTTTA-3';
A pair of HIV-1 specific primer sequence can be also the sequence that above-mentioned sequence is extended 10 ~ 20 Nucleotide forward or backward, or is greater than more than 85% with above-mentioned sequence homology; Described HIV-1 B hypospecificity probe, can be selected from the sequence of SEQ ID No.5,
< SEQ ID No.5 > is: 5'-FAM-ATAATATCAGTAGCAACCCTCTATTG-TAMRA-3',
Its middle probe 5'-end flag F AM fluorophor, probe 3'-hold equal mark quenching group (as, TAMRA), HIV-1 fragments specific probe sequence can be also the sequence that above-mentioned sequence is extended 10 ~ 20 Nucleotide forward or backward, or is greater than more than 85% with above-mentioned sequence homology; Described HIV-1 AE hypospecificity probe, can be selected from the sequence of SEQ ID No.6,
< SEQ ID No.6 > is: 5'-JOE-TTAATATCARTAGCAACCCTCTGGTG-TAMRA-3',
Its middle probe 5'-end mark JOE fluorophor, probe 3'-hold equal mark quenching group (as, TAMRA), HIV-1 fragments specific probe sequence can be also the sequence that above-mentioned sequence is extended 10 ~ 20 Nucleotide forward or backward, or is greater than more than 85% with above-mentioned sequence homology.
4. human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit as claimed in claim 1, it is characterized in that: test kit comprises following composition: RT-PCR reaction solution, RT-PCR enzyme mixture, primer probe, negative control, HIV-1 B hypotype positive control and HIV-1 AE hypotype positive control, wherein, RT-PCR reaction solution is Tris-HCl (pH8.3) 20 mM, KCl 100 mM, gelatin 0.2 mg/ml, dATP, dGTP, each 0.4 mM of dCTP, dUTP, MgCl
2the mixed solution of 6 mM; Described enzyme mixture be reversed transcriptive enzyme,
taqthe mixture of archaeal dna polymerase and UNG enzyme (reversed transcriptive enzyme 3 U/ul,
taqarchaeal dna polymerase 2 U/ul, UNG enzyme 1 U/ul); Described primer probe is mixed solution (each 6.25 uM of primer of a pair of HIV-1 Auele Specific Primer, a HIV-1 B hypospecificity probe and a HIV-1 AE hypospecificity probe, HIV-1 B hypospecificity probe 2.5 uM, HIV-1 AE hypospecificity probe 2.5 uM); Described negative control is the normal human serum without HIV-1 RNA; Described HIV-1 B hypotype positive control is the human serum of the slow virus that contains HIV-1 B subtype gene fragment; Described HIV-1 AE hypotype positive control is the human serum of the slow virus that contains HIV-1 AE subtype gene fragment.
5. human immunodeficiency virus type 1 single stage method gene type RT-PCR detection kit as described in claim 1, is characterized in that: preparation and the amplification program of described RT-PCR reaction solution are as follows:
The preparation of a, single stage method gene type RT-PCR reaction solution:
RT-PCR reaction solution, RT-PCR enzyme mixture, primer probe are mixed according to the ratio of 12.5:0.5:2, and reaction solution volume is 25 ul;
B, single stage method gene type RT-PCR response procedures:
[1] 37℃ 10 min
[2] 50℃ 15 min
[3] 95℃ 2 min
[4] 94℃ 10 s
[5] 60℃ 45 s
[6] Go to [4] ，45 cycles
Gather FAM and JOE passage fluorescent signal in the 5th step,
[7] End 。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310028194.1A CN103966355A (en) | 2013-01-25 | 2013-01-25 | Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310028194.1A CN103966355A (en) | 2013-01-25 | 2013-01-25 | Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103966355A true CN103966355A (en) | 2014-08-06 |
Family
ID=51236355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310028194.1A Pending CN103966355A (en) | 2013-01-25 | 2013-01-25 | Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966355A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795699A (en) * | 2021-02-09 | 2021-05-14 | 南方医科大学 | Universal primer, probe and detection method for detecting different subtypes of HIV-1 virus by RT-RAA fluorescence method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020055095A1 (en) * | 2000-09-01 | 2002-05-09 | Yang Yeasing Y. | Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations |
| US20020177127A1 (en) * | 2000-10-23 | 2002-11-28 | Yang Yeasing Y. | Compositions and methods for detecting human immunodeficiency virus 2 (HIV-2) |
| WO2012112884A2 (en) * | 2011-02-17 | 2012-08-23 | THE GOVERNMENT OF THE USA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, CENTERS FOR DISEASE CONTROL & PREVENTION | Real-time pcr point mutation assays for detecting hiv - 1 resistance to antiviral drugs |
-
2013
- 2013-01-25 CN CN201310028194.1A patent/CN103966355A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020055095A1 (en) * | 2000-09-01 | 2002-05-09 | Yang Yeasing Y. | Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations |
| US20020177127A1 (en) * | 2000-10-23 | 2002-11-28 | Yang Yeasing Y. | Compositions and methods for detecting human immunodeficiency virus 2 (HIV-2) |
| WO2012112884A2 (en) * | 2011-02-17 | 2012-08-23 | THE GOVERNMENT OF THE USA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, CENTERS FOR DISEASE CONTROL & PREVENTION | Real-time pcr point mutation assays for detecting hiv - 1 resistance to antiviral drugs |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795699A (en) * | 2021-02-09 | 2021-05-14 | 南方医科大学 | Universal primer, probe and detection method for detecting different subtypes of HIV-1 virus by RT-RAA fluorescence method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN111004870B (en) | Novel coronavirus N gene nucleic acid detection kit | |
| CN111705161A (en) | Novel coronavirus 2019-nCoV nucleic acid detection primer composition and kit | |
| CN111534637B (en) | Universal primer, probe and kit for enterovirus nucleic acid detection | |
| CN113930547B (en) | RT-RAA fluorescence detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| CN111394513A (en) | Fluorescent quantitative PCR detection method for novel coronavirus SARS-CoV-2 and application thereof | |
| CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN112176109A (en) | Influenza A and B virus nucleic acid detection kit and use method thereof | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN103255232A (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN108753768B (en) | Nucleic acid for detecting enterovirus and application thereof | |
| CN101812538B (en) | Enterovirus 71-detecting fluorescent quantitative RT-PCR kit | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN102851391A (en) | Human enterovirus four-color fluorescence RT-PCR detection kit and detection method | |
| CN112226539A (en) | Norovirus nucleic acid detection kit | |
| CN109457049B (en) | Composition, kit and method for genotyping detection of hepatitis B virus | |
| CN116042918B (en) | Five virus joint inspection compositions, kit, method and application thereof | |
| CN111676315A (en) | Primer and probe for detecting novel coronavirus ORF1ab gene, kit and method thereof | |
| CN111206122A (en) | Novel coronavirus nucleic acid detection kit | |
| CN100422344C (en) | Fluorescent PCR detecting method for hepatitis B virus gene parting and reagent kit | |
| CN104278024B (en) | For identifying Primer composition and their application of human adenovirus 55 type | |
| CN111549175B (en) | Novel multi-fluorescence RT-PCR detection reagent for detecting port input 2019 coronavirus | |
| CN105936944B (en) | Triple fluorescent RT-PCR detection kit, primer and probe for CSFV, PRRSV and SIV H1 subtypes | |
| CN103966355A (en) | Human immunodeficiency virus type 1 one-step genotyping RT-PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140806 |