CN103966178A - Rice yellow-green leaf related protein as well as encoding gene and application of rice yellow-green leaf related protein - Google Patents

Abstract

The invention discloses a rice yellow-green leaf-related protein, its coding gene and application. The rice yellow-green leaf-related protein provided by the present invention is a protein composed of the amino acid sequence shown in SEQ ID No. 1, or the amino acid sequence shown in SEQ ID No. 1 is added, substituted, inserted or added by one or more amino acids. A protein derived from SEQ ID No. 1 that is missing and associated with rice yellow-green leaves. The invention also discloses the gene encoding the protein at the same time, and the gene has the nucleotide sequences shown in SEQ ID No.2 and 3. The yellow-green leaf control gene of the invention can also be used as an indicator mark for pseudo-hybrids in the process of hybrid seed production, and can be used in hybrid breeding and variety improvement.

Description

A rice yellow-green leaf-related protein, its coding gene and application

1. Technical field

The invention relates to a rice yellow-green leaf-related protein and its coding gene and application, belonging to the field of plant genetic engineering.

2. Background technology

Rice is an important food crop, providing food and a source of nutrition for more than half of the world's population. Rice is also an important strategic material, accounting for more than half of my country's total grain output. Increasing rice production is of great strategic significance to ensure my country's food security and sustainable agricultural development. The biological output and economic output of plants are mainly produced by the photosynthesis of their leaves and other organs, and 90-95% of the dry matter of rice plants comes from photosynthesis. The efficiency of photosynthesis depends on the synthesis of photosynthetic pigments and the normal development of chloroplasts. Chlorophyll is an important pigment involved in photosynthesis in the chlorophyll of green plants, and plays an important role in the energy capture and energy transfer of photosynthesis (Fromme P, et al., FEBS Letters, 2003, 555(1): 40-44). Leaf color is a comprehensive expression of various pigments in chloroplasts. In normal rice leaves, chlorophyll is dominant and usually appears green.

Rice leaf color mutation is a relatively common mutation trait. The mutant gene often directly or indirectly affects the synthesis and degradation of chlorophyll, changing the chlorophyll content, so the leaf color mutant is also called a chlorophyll synthesis defect mutant (Huang Xiaoqun, et al. Northwest Acta Bot, 2005, 25(8):1685-1691). Leaf color mutants are ideal materials for studying chlorophyll biosynthesis pathways and photosynthetic mechanisms in rice, and can also be used as marker traits in the utilization of heterosis. According to incomplete statistics, more than 163 rice leaf color mutants have been reported so far, and these mutants can be roughly divided into 8 types: albino, yellow, light green, white emerald, green-white, yellow-green, striped and yellow-green ( Gong H, et al., Sci.Agric.Sin., 2001,34(4):686-689), most of these mutations are controlled by recessive nuclear genes, at least 124 genes have been mapped to specific molecular markers Among them, distributed on all 12 chromosomes of rice, 35 genes related to leaf color have been successfully cloned. These genes are mainly involved in the synthesis and degradation of chlorophyll, the development and differentiation of chloroplasts, etc. (Deng Xiaojuan, et al. Hybrid Rice, 2012, 27(5):9-14).

Although a large number of mutants related to rice leaf color have been reported and some genes have been cloned, the genes related to chlorophyll synthesis and the development mechanism of chloroplast in rice are still poorly understood. Therefore, it is of great theoretical significance and application value to screen and identify mutants related to rice leaf color and to clone and study the functions of genes controlling their traits.

3. Contents of the invention

technical problem:

A rice yellow-green leaf-related protein and a gene encoding the protein are provided, and the invention also provides applications of the protein and the gene encoding the protein.

Technical solutions:

The first aspect of the present invention provides the application of rice yellow-green leaf mutant ygl11 (t), the mutant ygl11 (t) taxonomic designation: rice (Oryza sativa), preservation number CGMCC No.9160, on May 4, 2014 Preserved in the General Microbiology Center of China Microbiological Culture Collection Management Committee, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The rice yellow-green leaf mutant ygl11(t) can be applied in rice hybrid breeding and variety improvement.

At the same time, a rice yellow-green leaf-related protein from rice yellow-green leaf mutant ygl11(t) is provided, and the protein has the amino acid sequence shown in SEQ ID No.1. The protein also includes a protein derived from SEQ ID No. 1 that has one or more amino acids added, substituted, inserted or deleted in the amino acid sequence shown in SEQ ID No. 1 and is related to rice yellow-green leaves.

In another aspect of the present invention, there is provided the ygl11(t) gene encoding the above protein, which has the nucleotide sequences shown in SEQ ID No.2 and 3. The ygl11(t) gene also includes mutants, alleles or derivatives produced by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequences shown in SEQ ID No. 2 and 3.

The gene can be applied in rice hybrid breeding and variety improvement.

Beneficial effect:

The invention provides a rice yellow-green leaf-related protein and its coding gene. The rice yellow-green leaf-related protein participates in the synthesis process of rice chlorophyll a to chlorophyll b. Although the YGL11(t) gene encoding the yellow-green leaf protein reduces the chlorophyll content, but did not affect the net photosynthetic rate of the yellow-green leaf mutant, and the net photosynthetic rate of the mutant was significantly higher than that of the wild type at the tillering stage. The gene encoding the above protein is introduced into the photothermosensitive two-line male sterile line. If the seed production encounters low temperature, a small amount of photothermosensitive male sterile line will self-fertilize and become fruitful, and it will be mixed into the hybrid. When the hybrid is planted in the next season, Since the hybrid plants appear normally green, and the self-fertile plants of the male sterile line appear yellow-green, the seedling stage can be conveniently eliminated by virtue of the leaf color to achieve the effect of removing impurities and maintaining purity, thereby effectively improving the quality of two-line hybridization. Improve rice purity and reduce production risks.

4. Description of drawings

Figure 1 is the phenotype diagram of the yellow-green leaf mutant ygl11(t) and the wild type Nanjing 41

(A is the phenotype at the seedling stage; B is the phenotype at the heading stage; C is the leaf at the mature stage; the left side of A, B, and C is the ygl11(t) mutant, and the right side is the wild-type Nanjing 41)

Figure 2 is a graph of the net photosynthetic rate of the yellow-green leaf mutant ygl11(t) and the wild type Nanjing 41 at different stages

Figure 3 is the fine mapping and cloning map of the YGL11(t) gene (A is the preliminary mapping result of the YGL11(t) gene; B is the fine mapping result of the YGL11(t) gene; C is the YGL11(t) gene contained in the localization region Open reading frame (ORF); D is the sequence difference of the coding gene of YGL11(t)

biological deposit

Rice yellow-green leaf mutant ygl11(t), taxonomic name: rice (Oryza sativa), deposit number CGMCCNo.9160. On May 4, 2014, it was preserved in the General Microbiology Center of China Microbiological Culture Collection Management Committee, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

5. Specific implementation

In order to fully disclose a rice yellow-green leaf-related protein of the present invention, its coding gene and its application, the method verification and implementation examples are described below. The specific implementation steps are as follows:

(1) Test materials

The rice yellow-green leaf mutant is derived from the natural mutation of the japonica rice variety Nanjing 41. After multiple generations of self-breeding and selection, the phenotype of the mutant has been stabilized, and it is named ygl11(t). The other parent of the segregation population was the indica sequenced variety Yangdao 6 (also known as: 9311).

Both Nanjing 41 and Yangdao 6 are well-known public materials, and they can be provided free of charge by the medium-term bank of agricultural germplasm resources in Jiangsu Province. Specific references are: Zhong Weigong et al., Breeding and Cultivation Techniques of High-quality and High-yielding Japonica Rice Variety Nanjing 41, Jiangsu Agricultural Sciences, 2003, 4:24-25; Breeding and Utilization of No. 6, China Rice, 2001, 1: 24-26.

(2) Fine mapping of YGL11(t) gene

1. Phenotype of mutant ygl11(t)

The plants and leaves of ygl11(t) were yellow-green throughout the growth period, which was significantly different from wild-type Nanjing 41 (Fig. 1). The chlorophyll content and carotenoid content of ygl11(t) in different periods were significantly lower than that of wild type Nanjing 41, and the chlorophyll content of ygl11(t) in different periods was 45.7%-74.7% of wild type. Among them, the content of chlorophyll a is 55.2%-87.5% of the wild type; the content of chlorophyll b is 12.5%-25.3% of the wild type; the content of carotenoid is 62.3%-97.0% of the wild type (Table 1). The photosynthetic rate of ygl11(t) and wild type was measured at the full tillering stage and 10 days after flowering by LI-6400 portable photosynthetic measuring instrument. The net photosynthetic rate of ygl11(t) at the full tillering stage was extremely significantly higher than that of the wild type, which was 4.9 μ mol m ^-2 s ^-1 higher than that of the wild type; the net photosynthetic rate of ygl11(t) at 10 days after flowering was slightly low, only decreased by 0.95μ molm ^-2 s ^-1 (Fig. 2), the difference was not significant, indicating that the reduction of chlorophyll in ygl11(t) did not reduce its net photosynthetic rate.

Table 1 Chlorophyll and carotenoid contents of mutant ygl1(t) and wild type Nanjing 41 leaves

2. Genetic analysis of ygl11(t)

When ygl11(t) was reciprocally crossed with indica variety 9311, the F ₁ showed normal green color, which indicated that the trait of yellow-green leaves was recessive, and yellow-green leaves were recessive to normal green. The yellow-green leaves and normal green leaves in the F ₂ segregation population were very obvious, which indicated that the traits of yellow-green leaves were controlled by major genes. The segregation ratio of normal green leaves and yellow-green leaves in F ₂ conformed to the segregation ratio of 3:1 (Table 2), indicating that this trait was controlled by a pair of recessive major nuclear genes. The cumulative 3687 yellow-green leaf recessive individuals in F ₂ and F ₃ segregation populations were used for the mapping and cloning of YGL11(t) gene. At the tillering stage, about 1.0 g of young leaves were taken from each plant to extract the total DNA.

Table 2 Phenotypes of ygl11(t) and 9311 reciprocal cross F ₁ and F ₂

3. Genomic DNA extraction from rice plants

Take about 1.0 g of rice leaves (i.e. the young leaves of rice in step 2), and extract the genomic DNA of rice plants with reference to the SDS method (Dellaporta S L, et al., Plant Mol Biol Rep, 1983, 1(1):19221.). The specific steps are: take about 1.0 g of rice leaves at the tillering stage, grind them with liquid nitrogen in a mortar pre-cooled at -20°C, and put them into a 2.0 mL centrifuge tube; add 600 uL of extract (20% SDS, 1M Tris-HCl, 0.5 M EDTA, 5M NaCl, preheated at 65°C), shake well, incubate at 65°C for 30 minutes, shake 3-4 times in the middle; add 1/4 volume of 5M KAC, shake well and place on ice for 30 minutes; add chloroform-isoamyl alcohol ( 24:1) 300-400uL, shake fully on a shaker, 120rpm, 30min; centrifuge at 8000-10000rpm for 15 minutes, the liquid surface is stratified, the lower layer is darker in color, and the upper layer is slightly yellow-green. Take the supernatant (about 400uL) to another A centrifuge tube; add an equal volume of chloroform-isoamyl alcohol (24:1), shake fully on a shaker, 80-90rpm, 30min; centrifuge at 8000rpm for 15 minutes, transfer the supernatant (about 400uL) to a new centrifuge tube; add 2 times Volume -20°C pre-cooled absolute ethanol, shake gently until flocs are produced, centrifuge at 12,000rpm for 6min; discard absolute ethanol, add 4°C 70% ethanol, let stand for 10min, discard supernatant, ultra-clean workbench Air-dry for 1 hour; add 100-200 uLTE and store at -20°C.

4. Synthesis of SSR, InDel and CAPs markers

SSR primers are public primers, and the primer sequences are from http://www.gramene.org/.

Development of InDel and CAPs markers: Find out the sequence deletion or insertion sites of Nipponbare and 9311 in the target region according to the research results of Shen et al. (Shen Y J, et al., Plant Physiology,2004,135(3):1198-1205) , using Primer Premier5.0 to select sequences containing ≥ 8bp deletion or insertion sites to design upstream and downstream primers for amplifying PCR products with a length of 100-300bp; in order to perform fine mapping and clone the YGL11(t) gene more reliably, according to the preliminary positioning of the gene As a result, the SNP between Nipponbare and 9311 was found in the relevant section, and the restriction site analysis was performed with BioXM2.6, and the CAPs primers were designed by Primer Premier5.0 for the SNP sequence containing the restriction site, and the primers were provided by Shanghai Ying Synthesized by Weijieji Company.

5. Localization of YGL11(t) gene

Preliminary location of YGL11 (t) gene: The location of yellow-green leaf gene YGL11 (t) was proposed by Michelmore et al. The BSA Act. The normal individual plants and yellow-green leaf individual plants in the F ₂ segregation population were divided into 2 groups, and the DNAs of 10 plants were mixed in each group to form 2 pools of normal individual plants and yellow-green leaf individual plants. Polymorphism analysis between the two pools was performed using 600 SSR markers that evenly covered the whole genome, and then linkage analysis was performed on the albino-green individual plants in the F ₂ segregation population using the markers that showed polymorphism between the two pools. During genome-wide polymorphism analysis, it was found that the SSR markers RM258, RM171, RM147, RM591 and RM590 on chromosome 10 were polymorphic between the two pools. Using these five SSR markers for further population detection, it was found that the yellow-green gene YGL11(t) was linked to these molecular markers to varying degrees, confirming that the gene was located on chromosome 10. Linkage analysis using MAPMAKER3.0 software showed that YGL11(t) was located between RM147 and RM591, and the genetic distance to both RM147 and RM591 was 0.4cM (Fig. 3A).

Fine mapping of the YGL11(t) gene: In order to further fine-map the gene, we developed multiple pairs of InDel and CAPs markers in the segment between RM147 and RM591, using markers that were differential between the two gene pools (Table 3) YGL11(t) was finally mapped to a segment of 58.1 kb between I4 and D3 on PAC clone AC087599 on chromosome 10 ( FIG. 3B ).

20μL PCR reaction system includes: 10×PCR Buffer (Mg ²⁺ ) 2.0mL, dNTP (10mmol/L) 0.5μL, Taq enzyme (5U/μL) 0.2μL, forward primer (10pmol/L) 1.0μL, reverse Primer (10 pmol/L) 1.0 μL, DNA 2.0 μL, ddH ₂ O 13.3 μL.

PCR reaction conditions include: pre-denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 1 minute, annealing at 53°C for 1 minute, extension at 72°C for 1.5 minutes, 32 cycles, and finally extension at 72°C for 10 minutes, cooling at 10°C for 10 minutes, and adding the amplified product buffer to stop the reaction.

PCR product detection: After the reaction, the amplification product was added with an indicator (0.25% bromophenol blue, 0.25% xylene cyanol FF, 40% sucrose aqueous solution), and the amplification product was electrophoresed on 3.5% agarose, stained with DuRed, and ultraviolet The gel phase system saves the image.

(3) Cloning of YGL11(t) gene

Using the gene annotation results of the PAC clone AC087599 sequence of rice chromosome 10 provided in the TIGR website (http://www.tigr.org), the candidate gene analysis was performed on the 58.1kb segment between markers I4 and D3, There are 6 open reading frames (ORFs) in this region, and we obtained the gene annotation results of 6 open reading frames (Fig. 3C). Among them, ORF2 and ORF4 encode enzymes related to chlorophyll synthesis, namely chlorophyll acid Ester oxidase 1 (chlorophyllide a oxygenase1, CAO1) and chlorophyllide oxidase 2 (CAO2). 8 pairs of primers (Table 3) capable of amplifying the DNA sequences of these 2 genes were designed respectively. These 8 pairs of primers were used to carry out PCR amplification of the 2 genes in the mutant and wild type respectively, and the PCR products were passed through agarose gel. After electrophoresis recovery, it was sent to Shanghai Yingwei Jieji Company for sequencing. Using BioXM2.6 software to compare the mutant and wild-type sequences with the Nipponbare CAO1 and CAO2 genes in the database, it was found that the mutant had two base deletions in the 117th to 118th positions of the 9th exon of the CAO1 gene, The wild-type sequence was completely consistent with Nipponbare (Fig. 3D). This mutation causes a translational frameshift, leading to premature termination of protein translation.

Therefore, the nucleotide sequence in SEQ ID NO.2 and 3 in the sequence listing is the sequence of the YGL11(t) gene, and the protein encoded by the yellow-green leaf of rice is shown in SEQ ID NO.1 in the sequence listing.

Sequenced the locus of 10 individuals with yellow-green leaves in the F ₂ segregation population, and found that all 10 individuals with yellow-green leaves had the deletion of the above two bases at this site. It was further verified that the YGL11(t) gene is related to the function of rice yellow-green leaves.

The ygl11(t) gene also includes mutants, alleles or derivatives produced by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequences shown in SEQ ID No. 2 and 3. The encoded protein related to yellow-green leaves of rice also includes addition, substitution, insertion or deletion of one or more amino acids in the amino acid sequence shown in SEQ ID No.1 and is derived from SEQ ID No.1 related to yellow-green leaves of rice. of protein.

The ygl11(t) gene can be applied in rice hybrid breeding and variety improvement.

Table 3 The primers used for YGL11(t) gene mapping and sequencing

SEQ ID NO.1

Amino acid sequence encoded by YGL11(t):

MVTLLIETTQGVGRYGGIKVYAVLGDDGADYAKNNAWEALFHVDDPGPRVPIAKGKFLDVNQALEVVRFDIQYCDWRARQDLLTIMVLHNKVVEVLNPLAREFKSIGTLRKELAELQEELAKAHNQVHLSETRVSSALDKLAQMETLVNDRLLQDGGSSASTAECTSLAPSTSSASRVVNKKPPRRSLNVSGPVQPYNPSLKNFWYPVAFSSDLKDDTMVPIDCFEEQWVIFRGKDGRPGCVMNTCAHRACPLHLGSVNEGRIQCPYHGWEYSTDGKCEKMPSTKMLNVRIRSLPCFEQEGMVWIWPGNDPPKSTIPSLLPPSGFTIHAEIVMELPVEHGLLLDNLLDLAHAPFTHTSTFAKGWSVPSLVKFLTPSSGLQGYWDPYPIDMEFRPPCMVLSTIGISKPGKLEGKSTKQCSTHLHQLHICLPSSRNKTRLLYRMSLDFAPWIKHVPFMHILWSHFAEKVLNEDLRLVLGQQERMINGANVWNWPVSYDKLGIRYRLWRRH

SEQ ID NO.2

YGL11(t)genomic DNA:

ATGACCACTGTGGCATCGCTGTCTTTGCTGCCGCACTTGCTCATCAAGCCTTCCTTCAGGTGTTGCTCCAGAAAGGTGAGTTCTTCTTGTTGTTCCTTGAATCTGTTTTTGTTGTTGTTGTTTGGCGATTCTTGAATTTGTTTTGGGGTATCTGGCGATGGGAGGAACCATGTTTCTTGTTTGGTTTTTGGGTTCAGGTGGCCATTCTTGATGAAAAACTGAGTGTTTGAGTTTGAGCAGTGCAATGGAGTTACCATTTTTGTTCTTCTGATTGGATTCTTTGTGATGGTTGATGTTTTTGTTCAGACAATGGTTTCAAGGTTCTGTGATTCTTCAGACCCCATATCTTAAAACCTGTTGTATTGAAGTAAGCAAAAAAACAAATCTTGATCAAGGACAGCCTAGTTGCCAATTTTTCTTTGCAAATCTGAATGCAATTCAATCTCTTTCTTCCAGCAAATGCGTGCAGCTTTCCCCCAGTAACCACAGGCTTATCTCTGACACTGATTTAACTAGATTTTGCTAATCTCTTTGATACTAGTTTGTCTGCTAAAATAGAGTGCATGTGAGGTTGATGAAAATTGATGGTGACCTTGCTGATTGAAACTACACAGGGTGTTGGTAGATATGGAGGAATCAAGGTGTATGCGGTGCTCGGTGATGATGGAGCTGACTATGCAAAGAACAACGCATGGGAGGCCTTGTTCCATGTCGATGACCCGGGGCCAAGGGTTCCAATTGCAAAAGGCAAGTTCTTGGATGTCAACCAAGCTCTTGAGGTGGTCCGGTTCGATATCCAGTATTGCGATTGGAGGGCGCGGCAGGACCTCCTCACCATCATGGTTCTTCACAACAAGGTAGGAAGCATTGGACAAGTCACAAGTTCAGAGAAGAGGTCAAAGCTTTCATAGTCTGAATTTTACAGATCATGGGATTCAAAATTGGACTGCATACTGAATAATGCTTGAGGTTGAAGTTTCGGATGACTGACATAGGTTAA CTTAAATGAATTTTTGAACATTGAAATGCAGGTGGTAGAGGTTCTTAATCCTTTAGCAAGGGAGTTCAAGTCAATTGGAACCTTGAGGAAAGAGCTTGCAGAATTACAGGAAGAATTGGCAAAAGCTCACAATCAGGTATTGTACTTTCAGGAGACAGGAGCCAAATGAAAAACTTCAATATTATATGGATTCTGATGTTTTACATGTCTAATCCAGGTTCATCTGTCGGAAACTAGAGTATCATCTGCCCTTGATAAGTTGGCACAAATGGAGACCCTTGTCAACGACAGACTGTTGCAAGATGGAGGCTCTAGCGCATCTACAGCCGAGTGCACTTCCCTTGCTCCAAGCACGTCATCAGCGTCCCGTGTTGTAAACAAGAAACCTCCTCGCCGGAGTCTGAACGTGTCTGGTCCAGTGCAGCCATACAATCCCAGTCTGAAGAACTTCTGGTACCCAGTTGCTTTCTCCAGTGACCTAAAAGACGATACAATGGTAAAAACAACGTGCGATTCAGGCATTTTTTTACGAGGTCAGAGTTAGCAGTTGCAGAAACTTATGTTTATTTGATGTGGTTTGCGCATTCTCAGGTGCCAATAGATTGTTTTGAGGAGCAGTGGGTAATTTTCCGAGGAAAGGATGGGAGACCTGGATGTGTTATGAACACATGTGCTCACAGAGCTTGCCCTCTTCATCTTGGCTCAGTTAATGAGGGCAGAATCCAATGCCCTTACCATGGTAAGAAAAGACAGCTTTACATGAACTTTCATTTCTGCATGCTTCCGCATTTATTTCTGAAGTCTTCAGATGAAAATTTGCCAACAGAGAGAAGTTGCGAAAGTAGTATTTCAGTTTTTTTTTGTTTTCATAACCTTCAGGTTGGGAGTATTCAACTGATGGAAAATGTGAGAAAATGCCATCCACAAAGATGCTCAACGTGCGCATCCGGTCATTACCATGCTTTGAGCAAGAAGGAATGGTTTGGATATGGCCTGGCAA TGACCCACCGAAGTCGACTATCCCTTCTCTGCTGCCTCCTTCAGGATTTACAATTCACGCAGAGGTAAAAGGAGATCATGTCATGCTGCAGCAACCATACTATGTGGAACTGTCCTGTGCATTTCAAGATTTTTACTGGACTGAAAAGTAATGGAATTGTTCTTGATCATCAACAGATAGTGATGGAGCTACCAGTGGAGCATGGACTTCTTCTGGACAATCTATTAGATCTTGCTCATGCTCCTTTTACTCATACATCCACCTTTGCCAAGGGTTGGAGTGTTCCAAGGTATTTACATACATATATTTTCACAGCCATGTGGAATTCTTTTTTTTTTTTTTAGAAAATGGATAGCCATGTGGAAATGTCTTCAGAAATCATCATGCTGATGCTATGTTCATTTCCCAGCTTGGTGAAGTTCTTGACACCTTCATCTGGGCTTCAAGGATACTGGGATCCATACCCGATCGACATGGAATTTCGACCACCATGCATGGTGTTGTCAACCATTGGCATCTCAAAGCCTGGAAAACTAGAGGGGAAGAGCACCAAGCAATGTTCGACGCATCTCCACCAGCTCCATATCTGTTTGCCCTCCTCTAGGAATAAAACCAGGCTGCTCTACCGGATGTCTCTCGACTTCGCTCCATGGATCAAGCATGTCCCTTTCATGCATATACTATGGTCACATTTTGCTGAGAAGGTGAGTCCGAAAAATTCAGAGCAACTTCATACTAAACTGTTGTCCATCTCATGTCATTACAGTTTGCACCTGACTATAGTATGCGGTTACCTTTGTTTTGCATACTGTCCTCTATACAACATCTATAATAATCTTGTATGATCTTTCTGCAGGTCTTGAATGAGGATCTTCGACTCGTGCTCGGGCAGCAAGAACGGATGATCAATGGCGCAAATGTCTGGAACTGGCCAGTATCATATGACAAGCTTGGTATCCGGTATCGGTTGTGGAGACGCCATTGAGAGGGGAGTAGACAG GTTGCCATTCAGTAACCAAAGTGAGAGTGGATCATAG

SEQ ID NO.3

YGL11(t) cDNA:

ATGACCACTGTGGCATCGCTGTCTTTGCTGCCGCACTTGCTCATCAAGCCTTCCTTCAGGTGTTGCTCCAGAAAGGGTGTTGGTAGATATGGAGGAATCAAGGTGTATGCGGTGCTCGGTGATGATGGAGCTGACTATGCAAAGAACAACGCATGGGAGGCCTTGTTCCATGTCGATGACCCGGGGCCAAGGGTTCCAATTGCAAAAGGCAAGTTCTTGGATGTCAACCAAGCTCTTGAGGTGGTCCGGTTCGATATCCAGTATTGCGATTGGAGGGCGCGGCAGGACCTCCTCACCATCATGGTTCTTCACAACAAGGTGGTAGAGGTTCTTAATCCTTTAGCAAGGGAGTTCAAGTCAATTGGAACCTTGAGGAAAGAGCTTGCAGAATTACAGGAAGAATTGGCAAAAGCTCACAATCAGGTTCATCTGTCGGAAACTAGAGTATCATCTGCCCTTGATAAGTTGGCACAAATGGAGACCCTTGTCAACGACAGACTGTTGCAAGATGGAGGCTCTAGCGCATCTACAGCCGAGTGCACTTCCCTTGCTCCAAGCACGTCATCAGCGTCCCGTGTTGTAAACAAGAAACCTCCTCGCCGGAGTCTGAACGTGTCTGGTCCAGTGCAGCCATACAATCCCAGTCTGAAGAACTTCTGGTACCCAGTTGCTTTCTCCAGTGACCTAAAAGACGATACAATGGTGCCAATAGATTGTTTTGAGGAGCAGTGGGTAATTTTCCGAGGAAAGGATGGGAGACCTGGATGTGTTATGAACACATGTGCTCACAGAGCTTGCCCTCTTCATCTTGGCTCAGTTAATGAGGGCAGAATCCAATGCCCTTACCATGGTTGGGAGTATTCAACTGATGGAAAATGTGAGAAAATGCCATCCACAAAGATGCTCAACGTGCGCATCCGGTCATTACCATGCTTTGAGCAAGAAGGAATGGTTTGGATATGGCCTGGCAATGACCCACCGAAGTCGACTATCCCTTCTC TGCTGCCTCCTTCAGGATTTACAATTCACGCAGAGATAGTGATGGAGCTACCAGTGGAGCATGGACTTCTTCTGGACAATCTATTAGATCTTGCTCATGCTCCTTTTACTCATACATCCACCTTTGCCAAGGGTTGGAGTGTTCCAAGCTTGGTGAAGTTCTTGACACCTTCATCTGGGCTTCAAGGATACTGGGATCCATACCCGATCGACATGGAATTTCGACCACCATGCATGGTGTTGTCAACCATTGGCATCTCAAAGCCTGGAAAACTAGAGGGGAAGAGCACCAAGCAATGTTCGACGCATCTCCACCAGCTCCATATCTGTTTGCCCTCCTCTAGGAATAAAACCAGGCTGCTCTACCGGATGTCTCTCGACTTCGCTCCATGGATCAAGCATGTCCCTTTCATGCATATACTATGGTCACATTTTGCTGAGAAGGTCTTGAATGAGGATCTTCGACTCGTGCTCGGGCAGCAAGAACGGATGATCAATGGCGCAAATGTCTGGAACTGGCCAGTATCATATGACAAGCTTGGTATCCGGTATCGGTTGTGGAGACGCCATTGAGAGGGGAGTAGACAGGTTGCCATTCAGTAACCAAAGTGAGAGTGGATCATAG

SEQUENCE LISTING

<110> Jiangsu Academy of Agricultural Sciences

<120> A rice yellow-green leaf-related protein and its coding gene and application

<130> 0

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 508

<212> PRT

<213> Oryza sativa

<220>

<221> Amino acid sequence encoded by YGL11(t)

<222> (1)..(508)

<223>

<400> 1

Met Val Thr Leu Leu Ile Glu Thr Thr Gln Gly Val Gly Arg Tyr Gly

1 5 10 15

Gly Ile Lys Val Tyr Ala Val Leu Gly Asp Asp Gly Ala Asp Tyr Ala

20 25 30

Lys Asn Asn Ala Trp Glu Ala Leu Phe His Val Asp Asp Pro Gly Pro

35 40 45

Arg Val Pro Ile Ala Lys Gly Lys Phe Leu Asp Val Asn Gln Ala Leu

50 55 60

Glu Val Val Arg Phe Asp Ile Gln Tyr Cys Asp Trp Arg Ala Arg Gln

65 70 75 80

Asp Leu Leu Thr Ile Met Val Leu His Asn Lys Val Val Glu Val Leu

85 90 95

Asn Pro Leu Ala Arg Glu Phe Lys Ser Ile Gly Thr Leu Arg Lys Glu

100 105 110

Leu Ala Glu Leu Gln Glu Glu Leu Ala Lys Ala His Asn Gln Val His

115 120 125

Leu Ser Glu Thr Arg Val Ser Ser Ala Leu Asp Lys Leu Ala Gln Met

130 135 140

Glu Thr Leu Val Asn Asp Arg Leu Leu Gln Asp Gly Gly Ser Ser Ser Ala

145 150 155 160

Ser Thr Ala Glu Cys Thr Ser Leu Ala Pro Ser Thr Ser Ser Ser Ala Ser

165 170 175

Arg Val Val Asn Lys Lys Pro Pro Arg Arg Ser Leu Asn Val Ser Gly

180 185 190

Pro Val Gln Pro Tyr Asn Pro Ser Leu Lys Asn Phe Trp Tyr Pro Val

195 200 205

Ala Phe Ser Ser Asp Leu Lys Asp Asp Thr Met Val Pro Ile Asp Cys

210 215 220

Phe Glu Glu Gln Trp Val Ile Phe Arg Gly Lys Asp Gly Arg Pro Gly

225 230 235 240

Cys Val Met Asn Thr Cys Ala His Arg Ala Cys Pro Leu His Leu Gly

245 250 255

Ser Val Asn Glu Gly Arg Ile Gln Cys Pro Tyr His Gly Trp Glu Tyr

260 265 270

Ser Thr Asp Gly Lys Cys Glu Lys Met Pro Ser Thr Lys Met Leu Asn

275 280 285

Val Arg Ile Arg Ser Leu Pro Cys Phe Glu Gln Glu Gly Met Val Trp

290 295 300

Ile Trp Pro Gly Asn Asp Pro Pro Lys Ser Thr Ile Pro Ser Leu Leu

305 310 315 320

Pro Pro Ser Gly Phe Thr Ile His Ala Glu Ile Val Met Glu Leu Pro

325 330 335

Val Glu His Gly Leu Leu Leu Asp Asn Leu Leu Asp Leu Ala His Ala

340 345 350

Pro Phe Thr His Thr Ser Thr Phe Ala Lys Gly Trp Ser Val Pro Ser

355 360 365

Leu Val Lys Phe Leu Thr Pro Ser Ser Gly Leu Gln Gly Tyr Trp Asp

370 375 380

Pro Tyr Pro Ile Asp Met Glu Phe Arg Pro Pro Cys Met Val Leu Ser

385 390 395 400

Thr Ile Gly Ile Ser Lys Pro Gly Lys Leu Glu Gly Lys Ser Thr Lys

405 410 415

Gln Cys Ser Thr His Leu His Gln Leu His Ile Cys Leu Pro Ser Ser

420 425 430

Arg Asn Lys Thr Arg Leu Leu Tyr Arg Met Ser Leu Asp Phe Ala Pro

435 440 445

Trp Ile Lys His Val Pro Phe Met His Ile Leu Trp Ser His Phe Ala

450 455 460

Glu Lys Val Leu Asn Glu Asp Leu Arg Leu Val Leu Gly Gln Gln Glu

465 470 475 480

Arg Met Ile Asn Gly Ala Asn Val Trp Asn Trp Pro Val Ser Tyr Asp

485 490 495

Lys Leu Gly Ile Arg Tyr Arg Leu Trp Arg Arg His

500 505

<210> 2

<211> 3037

<212>DNA

<213> Oryza sativa

<220>

<221> YGL11(t) genomic DNA

<222> (1)..(3037)

<223>

<400> 2

atgaccactg tggcatcgct gtctttgctg ccgcacttgc tcatcaagcc ttccttcagg 60

tgttgctcca gaaaggtgag ttcttcttgt tgttccttga atctgttttt gttgttgttg 120

tttggcgatt cttgaatttg ttttggggta tctggcgatg ggaggaacca tgtttcttgt 180

ttggtttttg ggttcaggtg gccattcttg atgaaaaact gagtgtttga gtttgagcag 240

tgcaatggag ttaccatttt tgttcttctg attggattct ttgtgatggt tgatgttttt 300

gttcagacaa tggtttcaag gttctgtgat tcttcagacc ccatatctta aaacctgttg 360

tattgaagta agcaaaaaaa caaatcttga tcaaggacag cctagttgcc aatttttctt 420

tgcaaatctg aatgcaattc aatctctttc ttccagcaaa tgcgtgcagc tttcccccag 480

taaccacagg cttatctctg aactagattt aactagattt tgctaatctc tttgatacta 540

gtttgtctgc taaaatagag tgcatgtgag gttgatgaaa attgatggtg accttgctga 600

ttgaaactac acagggtgtt ggtagatatg gaggaatcaa ggtgtatgcg gtgctcggtg 660

atgatggagc tgactatgca aagaacaacg catgggaggc cttgttccat gtcgatgacc 720

cggggccaag ggttccaatt gcaaaaggca agttcttgga tgtcaaccaa gctcttgagg 780

tggtccggtt cgatatccag tattgcgatt ggagggcgcg gcaggacctc ctcaccatca 840

tggttcttca caacaaggta ggaagcattg gacaagtcac aagttcagag aagaggtcaa 900

agctttcata gtctgaattt tacagatcat gggattcaaa attggactgc atactgaata 960

atgcttgagg ttgaagtttc ggatgactga cataggttaa cttaaatgaa tttttgaaca 1020

ttgaaatgca ggtggtagag gttcttaatc ctttagcaag ggagttcaag tcaattggaa 1080

ccttgaggaa agagcttgca gaattacagg aagaattggc aaaagctcac aatcaggtat 1140

tgtactttca ggagacagga gccaaatgaa aaacttcaat attatatgga ttctgatgtt 1200

ttacatgtct aatccaggt catctgtcgg aaactagagt atcatctgcc cttgataagt 1260

tggcacaaat ggagaccctt gtcaacgaca gactgttgca agatggaggc tctagcgcat 1320

ctacagccga gtgcacttcc cttgctccaa gcacgtcatc agcgtcccgt gttgtaaaca 1380

agaaacctcc tcgccggagt ctgaacgtgt ctggtccagt gcagccatac aatcccagtc 1440

tgaagaactt ctggtaccca gttgctttct ccagtgacct aaaagacgat acaatggtaa 1500

aaacaacgtg cgattcaggc atttttttac gaggtcagag ttagcagttg cagaaactta 1560

tgtttatttg atgtggtttg cgcattctca ggtgccaata gattgttttg aggagcagtg 1620

ggtaattttc cgaggaaagg atgggagacc tggatgtgtt atgaacacat gtgctcacag 1680

agcttgccct cttcatcttg gctcagttaa tgagggcaga atccaatgcc cttaccatgg 1740

taagaaaaga cagctttaca tgaactttca tttctgcatg cttccgcatt tatttctgaa 1800

gtcttcagat gaaaatttgc caacagagag aagttgcgaa agtagtattt cagttttttt 1860

ttgttttcat aaccttcagg ttgggagtat tcaactgatg gaaaatgtga gaaaatgcca 1920

tccacaaaga tgctcaacgt gcgcatccgg tcattaccat gctttgagca agaaggaatg 1980

gtttggatat ggcctggcaa tgacccaccg aagtcgacta tcccttctct gctgcctcct 2040

tcaggatta caattcacgc agaggtaaaa ggagatcatg tcatgctgca gcaaccatac 2100

tatgtggaac tgtcctgtgc atttcaagat ttttactgga ctgaaaagta atggaattgt 2160

tcttgatcat caacagatag tgatggagct accagtggag catggacttc ttctggacaa 2220

tctattagat cttgctcatg ctccttttac tcatacatcc acctttgcca agggttggag 2280

tgttccaagg tatttacata catatatttt cacagccatg tggaattctt tttttttttt 2340

ttagaaaatg gatagccatg tggaaatgtc ttcagaaatc atcatgctga tgctatgttc 2400

atttcccagc ttggtgaagt tcttgacacc ttcatctggg cttcaaggat actgggatcc 2460

atacccgatc gacatggaat ttcgaccacc atgcatggtg ttgtcaacca ttggcatctc 2520

aaagcctgga aaactagagg ggaagagcac caagcaatgt tcgacgcatc tccaccagct 2580

ccatatctgt ttgccctcct ctaggaataa aaccaggctg ctctaccgga tgtctctcga 2640

cttcgctcca tggatcaagc atgtcccttt catgcatata ctatggtcac attttgctga 2700

gaaggtgagt ccgaaaaatt cagagcaact tcatactaaa ctgttgtcca tctcatgtca 2760

ttacagtttg cacctgacta tagtatgcgg ttacctttgt tttgcatact gtcctctata 2820

caacatctat aataatcttg tatgatcttt ctgcaggtct tgaatgagga tcttcgactc 2880

gtgctcgggc agcaagaacg gatgatcaat ggcgcaaatg tctggaactg gccagtatca 2940

tatgacaagc ttggtatccg gtatcggttg tggagacgcc attgagagggg gagtagacag 3000

gttgccattc agtaaccaaa gtgagagtgg atcatag 3037

<210> 3

<211> 1624

<212>DNA

<213> Oryza sativa

<220>

<221> YGL11(t) cDNA

<222> (1)..(1624)

<223>

<400> 3

atgaccactg tggcatcgct gtctttgctg ccgcacttgc tcatcaagcc ttccttcagg 60

tgttgctcca gaaagggtgt tggtagatat ggaggaatca aggtgtatgc ggtgctcggt 120

gatgatggag ctgactatgc aaagaacaac gcatgggagg ccttgttcca tgtcgatgac 180

ccggggccaa gggttccaat tgcaaaaggc aagttcttgg atgtcaacca agctcttgag 240

gtggtccggt tcgatatcca gtattgcgat tggagggcgc ggcaggacct cctcaccatc 300

atggttcttc acaacaaggt ggtagaggtt cttaatcctt tagcaaggga gttcaagtca 360

attggaacct tgaggaaaga gcttgcagaa ttacaggaag aattggcaaa agctcacaat 420

caggttcatc tgtcggaaac tagagtatca tctgcccttg ataagttggc acaaatggag 480

acccttgtca acgacagact gttgcaagat ggaggctcta gcgcatctac agccgagtgc 540

acttcccttg ctccaagcac gtcatcagcg tcccgtgttg taaacaagaa acctcctcgc 600

cggagtctga acgtgtctgg tccagtgcag ccatacaatc ccagtctgaa gaacttctgg 660

taccccagttg ctttctccag tgacctaaaa gacgatacaa tggtgccaat agattgtttt 720

gaggagcagt gggtaatttt ccgaggaaag gatgggagac ctggatgtgt tatgaacaca 780

tgtgctcaca gagcttgccc tcttcatctt ggctcagtta atgagggcag aatccaatgc 840

cctaccatg gttgggagta ttcaactgat ggaaaatgtg agaaaatgcc atccacaaag 900

atgctcaacg tgcgcatccg gtcattacca tgctttgagc aagaaggaat ggtttggata 960

tggcctggca atgacccacc gaagtcgact atcccttctc tgctgcctcc ttcaggattt 1020

acaattcacg cagagatagt gatggagcta ccagtggagc atggacttct tctggacaat 1080

ctattagatc ttgctcatgc tccttttact catacatcca cctttgccaa gggttggagt 1140

gttccaagct tggtgaagtt cttgacacct tcatctgggc ttcaaggata ctgggatcca 1200

tacccgatcg acatggaatt tcgaccacca tgcatggtgt tgtcaaccat tggcatctca 1260

aagcctggaa aactagagggg gaagagcacc aagcaatgtt cgacgcatct ccaccagctc 1320

catatctgtt tgccctcctc taggaataaa accaggctgc tctaccggat gtctctcgac 1380

ttcgctccat ggatcaagca tgtccctttc atgcatatac tatggtcaca ttttgctgag 1440

aaggtcttga atgaggatct tcgactcgtg ctcgggcagc aagaacggat gatcaatggc 1500

gcaaatgtct ggaactggcc agtatcatat gacaagcttg gtatccggta tcggttgtgg 1560

agacgccatt gagaggggag tagacaggtt gccattcagt aaccaaagtg agagtggatc 1620

atag 1624

Claims (6)

1. The application of the yellow-green leaf mutant ygl11(t) of rice. The mutant ygl11(t) is classified and named: Rice ( Oryza sativa ), and the preservation number is CGMCC No.9160. The Committee's General Microbiology Center for preservation, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. 2. A rice yellow-green leaf-related protein from the rice yellow-green leaf mutant ygl11(t) according to claim 1, characterized in that: the protein has the amino acid sequence shown in SEQ ID No.1. 3. The rice yellow-green leaf-associated protein according to claim 2, characterized in that: said amino acid sequence also includes addition, substitution, insertion or deletion of one or more amino acids in the amino acid sequence shown in SEQ ID No.1 and A protein derived from SEQ ID No. 1 associated with yellow-green leaves of rice. 4. A gene encoding the protein of claim 2, characterized in that the gene has the nucleotide sequences shown in SEQ ID No.2 and 3. 5. The gene according to claim 4, characterized in that: the nucleotide sequence also includes one or more additions, substitutions, insertions or deletions in the nucleotide sequence shown in SEQ ID No.2 and 3 Mutants, alleles or derivatives produced from nucleotides. 6. The application of the gene described in claim 4 or 5 in rice hybrid breeding and variety improvement.