CN103952381A - NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application - Google Patents
NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application Download PDFInfo
- Publication number
- CN103952381A CN103952381A CN201410127107.2A CN201410127107A CN103952381A CN 103952381 A CN103952381 A CN 103952381A CN 201410127107 A CN201410127107 A CN 201410127107A CN 103952381 A CN103952381 A CN 103952381A
- Authority
- CN
- China
- Prior art keywords
- nad
- aldehyde oxidase
- hydroxypropionaldehyde
- hydroxypropionic acid
- production
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/03—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with oxygen as acceptor (1.2.3)
- C12Y102/03001—Aldehyde oxidase (1.2.3.1), i.e. retinal oxidase
Abstract
The invention discloses an NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application, belongs to the biochemical production field, and relates to the NAD<+>-independent aldehyde oxidase enabling Klebsiella pneumonia to maintain the intracellular coenzyme balance in the catalysis process of the production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde. The sequence of the aldehyde oxidase is represented by SEQ ID NO:1 in a sequence table. Mass screening results show that the aldehyde oxidase in Pseudomonas sp. is independent of NAD<+>, and can catalyze the oxidation of aldehydes to corresponding carboxylic acids. The overexpression of the aldehyde oxidase in the Klebsiella pneumonia is carried out, and the in-vivo and in-vitro 3-hydroxypropionaldehyde catalysis ability is determined. The above enzyme has good 3-hydroxypropionic acid production ability.
Description
Technical field
The invention belongs to biochemical industry production field, relate to one and do not rely on NAD
+aldehyde oxidase, klepsiella pneumoniae (Klebsiella pneumoniae) can be produced in the process of 3-hydroxy-propionic acid at catalysis 3-HPA, keep the balance of coenzyme in born of the same parents.
Background technology
3-hydroxy-propionic acid is a kind of important hardware and software platform compound, and because the synthetic difficulty of chemical synthesis is larger, biological synthesis process receives more concerns in recent years.Klepsiella pneumoniae, because of the rapid and higher glycerine tolerance of its growth, is the desirable host that biological process is produced 3-hydroxy-propionic acid.Glycerine catalysis through glycerol dehydratase in klepsiella pneumoniae body generates intermediate product 3-HPA, and 3-HPA is by NAD subsequently
+the aldehyde dehydrogenase catalysis of dependent form generates 3-hydroxy-propionic acid.
In the biological process of 3-hydroxy-propionic acid is produced, cross the aldehyde dehydrogenase of expressing and caused NAD in cell
+luxus consumption, caused the disorder of coenzyme metabolism in body.In fermenting process, due to NAD
+lack, synthesis rate, biomass growth rate and the glycerol conversion yield of 3-hydroxy-propionic acid are all had a strong impact on.Therefore, urgently develop a kind of NAD
+the key enzyme of self is for the catalysis of 3-HPA.
Through a large amount of screenings, find that the aldehyde oxidase in pseudomonas (Pseudomonas sp.) does not rely on NAD
+, and can be oxidized to corresponding carboxylic acid by catalysis aldehyde material.On this basis, in klepsiella pneumoniae body, this aldehyde oxidase is carried out to overexpression, carried out in body and the ability of external catalysis 3-HPA is measured to it.This enzyme has the ability of good production 3-hydroxy-propionic acid.
Summary of the invention
In view of the aldehyde dehydrogenase of existing catalysis 3-HPA is NAD
+dependent form can cause the metabolism disorder of thalline coenzyme in cell after overexpression, the present invention is intended to find a kind of NAD
+independently key enzyme catalysis 3-HPA.Technical scheme of the present invention is summarized as follows:
Through a large amount of screenings, find a NAD
+independently aldehyde oxidase.After the sequence of this enzyme coding gene is analyzed, this gene is carried out to chemosynthesis.
Aldehyde oxidase sequence is:atgcgtatcg cattcatcgg cctgggcaac atgggcgcgc ccatggcccg caacctgatc aaggccgggc accagctgaa cctgttcgac cttaaccaga ccgtgctggc cgagctcgccgaactcggcg ggcaggtcag cgcctcgccc aagaacgcgg ctgccagcag cgagctggtg attaccatgttgccggcggc ggcccatgtc cgcagcgtct acctgggcga cgatggcgtg ctggccggcg tgcgccccggcacgccgacc gtggattgca gcaccatcga cccgcagacc gcccgcgagg tgtccaaggc tgcggcggccaagggtgtgg acatgggcga tgcgccggtg tccggtggca ccggtggcgc agcggcaggt acgttgacgttcatggttgg cgccagcgcc gagctgttcg ccgcgctcaa gccggtgctc gagcagatgg gccgtaacatcgtgcattgt ggtgaagtcg gcaccggaca gatcgccaag atctgcaaca acctgctgct gggcatctcgatgatcggcg tgtccgaggc gatggccctg ggcaacgcgc tcggcatcga cacccaggtg ctggccgggatcatcaacag ttcgaccggg cgttgctgga gttccgatac ctacaacccg tggccgggca tcatcgagaccgcgccggcg tcgcgtggtt ataccggtgg ctttggtgcc gagctgatgc tcaaggacct gggcctggccaccgaggccg cccgccaggc gcatcaaccg gtgatcatgg gcgcactggc gcagcagctg taccaggccatgagcctgcg cggcgatggc ggcaaggact tctcggcgat cgtcgagggc taccgcaaga aggactga, in all 888bp。
After having checked order, by this enzyme overexpression in klepsiella pneumoniae body, measure in body and the external catalytic capability to 3-HPA.In vitro, this enzyme reaches 13.7U/mg, K to the enzyme work of 3-HPA
mand V
maxvalue reaches respectively 6.68mM and 41.8 μ M/min/mg.Through shake flask fermentation, improved engineering bacteria 3-hydroxy-propionic acid resultant quantity in the time of 24 hours reaches 0.89g/L, has more nearly one times than the 0.47g/L of control group.In 5L fermentor tank, cultivate this project bacterium, after 24 hours, 3-hydroxy-propionic acid output reaches 3g/L.Because this enzyme is NAD
+self, can not affect internal cell coenzyme metabolism, therefore has good application prospect.
brief description of the drawings
Figure 1A is in shake flask fermentation experiment, and the contrast of 24h3-hydroxy-propionic acid output is schemed.
Figure 1B is in upper tank fermenting experiment, and when 24h, the contrast of 3-hydroxy-propionic acid output is schemed.
Embodiment
Concrete grammar below can make the present invention of those skilled in the art's comprehend, but does not limit the present invention in any way.
The concrete steps of the inventive method comprise:
1. the clone of aldehyde oxidase enzyme in klepsiella pneumoniae
Bacterial strain and plasmid: intestinal bacteria (E.coli) top10 is purchased from Beijing Bo Maide company, and klepsiella pneumoniae (Klebsiella pneumoniae) DSM2026 buys from German DSM, expression vector pET-pk is for preserving in this laboratory.
Substratum: LB substratum (g/L) peptone 10, yeast extract 5, NaCl10, pH7.0.In solid medium, add 1.5% agar.Resistance culture base need add 50 μ g/mL sulphuric acid kanamycins.
Klepsiella pneumoniae fermention medium (g/L): K
2hPO
43H
2o, 3.4; KH
2pO
4, 1.3; (NH
4)
2sO
4, 4; MgSO
47H
2o, 0.5; CaCO
3, 0.1; Yeast powder, 3; Glycerine, 40; Trace element, 1.25mL/L.
Trace element solution (g/L) FeSO
47H
2o, 1; ZnCl
2, 0.07; CuCl
22H
2o, 0.02; MnCl
24H
2o, 0.1; NiCl
26H
2o, 0.025; H
3bO
3, 0.06; Na
2mO
42H
2o, 0.035; CoCl
22H
2o, 0.2; HCl (37%), 4mL.
Molecular cloning and expression: the gene order that screening is obtained is carried out chemosynthesis, be connected in carrier pET-pk, proceeds to and in intestinal bacteria top10, carry out sequence verification.Afterwards the plasmid electroporation of extraction is converted into klepsiella pneumoniae and verifies.It is correct that the result shows that aldehyde oxidase connects.
2. the expression of aldehyde oxidase
In fermention medium, cultivate recombinant bacterium, take out fermented liquid at 12h, the centrifugal 10min of 12000rpm, removes supernatant.PBS damping fluid (KH by the thalline of collecting with 50mM
2pO
4, 0.27g/L; Na
2hPO
4, 1.42g/L; NaCl, 8g/L; KCl, 0.2g/L) resuspended.Subsequently thalline is placed on ice, ultrasonication cell, power is 100W, work 3s, stops 2s, totally 50 times.After fragmentation, appropriate broken liquid is added to enzyme and lives in reaction system (50mMPBS damping fluid, 0.2mM3-hydroxy propanal, 0.4mM aminoantipyrene, 7mM phenol, 7U catalase), under 500nm, measure absorbancy after reacting 5min for 37 DEG C.Enzyme work is defined as under this condition, and 1min catalysis generates the needed enzyme amount of 1 μ mol hydrogen peroxide.
Experimental result shows, aldehyde oxidase has reached 13.7U/mg to the activity of 3-HPA in vitro.Through calculating, aldehyde oxidase is the K to 3-HPA under this reaction conditions
mand V
maxvalue reaches respectively 6.68mM and 41.8 μ M/min/mg.This experiment has found one there is no in vitro NAD first
+under the condition existing, the key enzyme of energy catalysis 3-HPA, has measured its activity.
3. ferment containing shaking flask and the upper tank of aldehyde oxidase engineering bacteria
In 250ml shaking flask, pack 100ml fermention medium into, be placed in shaking table, 37 DEG C of 150rpm carry out shake flask fermentation.Carry out the mensuration of 3-hydroxy-propionic acid output every 3h taking-up one time fermentation liquid.Upper tank fermentation completes in 5L fermentor tank (Shanghai is protected emerging), and liquid amount is 3L, at 37 DEG C, carries out, and pH maintains 7.0 automatically, air flow 1.5vvm, and mixing speed is 400rpm, every 3h sampling and measuring makes the content of glycerine maintain 30g/L left and right.Analytical procedure is as follows: the product quality concentration in fermented liquid adopts Shimadzu high performance liquid chromatography SPD-20A to measure, and chromatographic column is C
18post, 30 DEG C of column temperatures, moving phase is 0.05% phosphoric acid, and working flow rate is 0.8mL/min, and detector adopts UV-detector.Get the centrifugal 10min of 1mL fermented liquid 12000rpm, get supernatant liquor and detect for high performance liquid chromatography, sample analysis is front through 0.22 μ m micro-filtrate membrane filtration.What the measuring method of glycerine used is sodium periodate oxidation.
Experimental result shows, in shake flask fermentation experiment, when 24h, 3-hydroxy-propionic acid output has reached 0.89g/L, and control group is only 0.47g/L(Figure 1A), experimental group 3-hydroxy-propionic acid output is 1.89 times of control group.In upper tank fermenting experiment, when 24h, 3-hydroxy-propionic acid output reaches 3g/L(Figure 1B).The result of shake flask fermentation and upper tank fermentation shows, aldehyde oxidase has been brought into play good effect in klepsiella pneumoniae body, has improved the output of 3-hydroxy-propionic acid.As NAD
+independently a key enzyme, has huge application prospect.
Claims (2)
1. one does not rely on NAD
+catalysis 3-HPA produces the aldehyde oxidase of 3-hydroxy-propionic acid, it is characterized in that:
The sequence of aldehyde oxidase is the SEQ ID NO:1 in sequence table.
2. one according to claim 1 does not rely on NAD
+catalysis 3-HPA produces the application of the aldehyde oxidase of 3-hydroxy-propionic acid, it is characterized in that: be applied to and produce 3-hydroxy-propionic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410127107.2A CN103952381A (en) | 2014-03-31 | 2014-03-31 | NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410127107.2A CN103952381A (en) | 2014-03-31 | 2014-03-31 | NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103952381A true CN103952381A (en) | 2014-07-30 |
Family
ID=51329735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410127107.2A Pending CN103952381A (en) | 2014-03-31 | 2014-03-31 | NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103952381A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805112A (en) * | 2015-04-20 | 2015-07-29 | 北京化工大学 | Construction method of 3-hydroxy propionate high-yielding strain recombinant plasmids |
| CN108949760A (en) * | 2018-07-27 | 2018-12-07 | 北京化工大学 | A kind of combined promoter and its application in the 3- hydracrylic acid yield for improving klepsiella pneumoniae |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0091810B1 (en) * | 1982-04-12 | 1987-03-25 | Kyowa Hakko Kogyo Co., Ltd. | Aldehyde oxidase, process for its production and microorganism therefor |
| CN101445813A (en) * | 2007-12-21 | 2009-06-03 | 清华大学 | Method for producing 3-hydracrylic acid |
-
2014
- 2014-03-31 CN CN201410127107.2A patent/CN103952381A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0091810B1 (en) * | 1982-04-12 | 1987-03-25 | Kyowa Hakko Kogyo Co., Ltd. | Aldehyde oxidase, process for its production and microorganism therefor |
| CN101445813A (en) * | 2007-12-21 | 2009-06-03 | 清华大学 | Method for producing 3-hydracrylic acid |
Non-Patent Citations (2)
| Title |
|---|
| YASUTAKA SASAKI ET AL: "Cloning and sequencing of a gene encoding of aldehyde oxidase in Pseudomonas sp. AIU 362", 《JOURNAL OF BIOSCIENCE AND BIOENGINEERING》, vol. 114, no. 1, 7 May 2012 (2012-05-07), pages 28 - 32, XP028497428, DOI: doi:10.1016/j.jbiosc.2012.02.018 * |
| YING LI ET AL: "NAD+-independent aldehyde oxidase catalyzes cofactor balanced 3-hydroxypropionic acid production in Klebsiella pneumoniae", 《BIOTECHNOL LETT》, vol. 36, 1 July 2014 (2014-07-01), pages 2215 - 2221, XP035397869, DOI: doi:10.1007/s10529-014-1590-6 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805112A (en) * | 2015-04-20 | 2015-07-29 | 北京化工大学 | Construction method of 3-hydroxy propionate high-yielding strain recombinant plasmids |
| CN104805112B (en) * | 2015-04-20 | 2018-08-03 | 北京化工大学 | A kind of construction method of 3- hydracrylic acids Producing Strain recombinant plasmid |
| CN108949760A (en) * | 2018-07-27 | 2018-12-07 | 北京化工大学 | A kind of combined promoter and its application in the 3- hydracrylic acid yield for improving klepsiella pneumoniae |
| CN108949760B (en) * | 2018-07-27 | 2022-06-10 | 北京化工大学 | Composite promoter and application thereof in increasing yield of 3-hydroxypropionic acid of klebsiella pneumoniae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10731138B2 (en) | Formate dehydrogenase mutant with improved enzyme activity and stability and construction method thereof | |
| Köpke et al. | Reconstruction of an acetogenic 2, 3-butanediol pathway involving a novel NADPH-dependent primary-secondary alcohol dehydrogenase | |
| Xu et al. | Biotechnological routes to pyruvate production | |
| CN105671010B (en) | A kind of aldehyde Ketoreductase mutant, gene, engineering bacteria and its application | |
| Durgapal et al. | Production of 1, 3-propanediol from glycerol using the newly isolated Klebsiella pneumoniae J2B | |
| CN104388373A (en) | Construction of escherichia coli system with coexpression of carbonyl reductase Sys1 and glucose dehydrogenase Sygdh | |
| CA2727549A1 (en) | Production of butanediol by anaerobic microbial fermentation | |
| CN106701698B (en) | Carbonyl reductase, mutant and its preparing the application in antimycotic pharmaceutical intermediate | |
| US11162124B2 (en) | Alcohol dehydrogenase mutant and application thereof in cofactor regeneration | |
| US11535873B2 (en) | Production of glycolate from ethylene glycol and related microbial engineering | |
| Han et al. | Production of 2, 3-butanediol by a low-acid producing Klebsiella oxytoca NBRF4 | |
| Lin et al. | Deletion of poxB, pta, and ackA improves 1, 3-propanediol production by Klebsiella pneumoniae | |
| Muschallik et al. | (R, R)-Butane-2, 3-diol dehydrogenase from Bacillus clausii DSM 8716T: Cloning and expression of the bdhA-gene, and initial characterization of enzyme | |
| Liu et al. | Enzyme-catalyzed sequential reduction of carbon dioxide to formaldehyde | |
| Zhu et al. | Identification of the enzymes responsible for 3-hydroxypropionic acid formation and their use in improving 3-hydroxypropionic acid production in Gluconobacter oxydans DSM 2003 | |
| Schwarz et al. | Acetogenic conversion of H2 and CO2 into formic acid and vice versa in a fed-batch-operated stirred-tank bioreactor | |
| Humphreys et al. | Establishing Butyribacterium methylotrophicum as a platform organism for the production of biocommodities from liquid C1 metabolites | |
| Zhou et al. | Three multi-enzyme cascade pathways for conversion of C1 to C2/C4 compounds | |
| CN103952381A (en) | NAD<+>-independent aldehyde oxidase catalyzing production of 3-hydroxypropionic acid from 3-hydroxypropionaldehyde, and its application | |
| CN107653259B (en) | A kind of method of external enzyme reaction production D- (-) -3-hydroxy-2-butanone | |
| CN104805112A (en) | Construction method of 3-hydroxy propionate high-yielding strain recombinant plasmids | |
| TW202122583A (en) | Method of creating recombinant microorganism for manufacturing fermentation product | |
| CN103184243A (en) | Fermentation production method for xylitol | |
| CN1800364A (en) | Engineered bacterium lacking lactic acid production path and its construction method and uses | |
| EP3011040B1 (en) | Method for storing gaseous hydrogen via enzymatic production of methanoate (formate) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140730 |
|
| RJ01 | Rejection of invention patent application after publication |