CN103930097B - For producing the injection system of the substrate being formed in situ - Google Patents

Abstract

Describing the injection system for generating the substrate being formed in situ, it includes at least one lipophilic ingredients, and this lipophilic ingredients includes at least one polymer based on glycolic and lactic acid and XlogP3 value at least one biocompatible solvent less than 0.2；With at least one hydrophilic component, two kinds of components of at least a part of which exist the most separated from one anotherly, and are not mixed, until spraying or being in injection process, wherein component forms film when being ejected into people's tissue.

Description

For producing the injection system of the substrate being formed in situ

The present invention relates to for preventing adhesion, specifically surgical adhesions, injection or application system.

At damage and Post operation, adhesion frequently occurs.They develop into accumulation and cicatrix, and cause post-operative complication.Tool Body ground, the surgical intervention of abdominal part causes the constitutional tissue adhesion in the patient of up to 94%.Peritoneum, such as serous coat, forms abdomen The liner in chamber.It is made up of visceral layer and parietal layer, wherein has serosity gap, and this serosity gap is filled with the liquid of 5 to 20ml Body, it is allowed to organ is slidably.Histologically, peritoneum include squamous epithelial cancer monolayer its be also referred to as between cortex, and slurry Thin layer of connective tissue under film.Within these few days, corticipetal damage causes being formed between this two-layer and surrounding tissue permanent Adhesion.In addition to the damage that operation causes, a cortex is also by being damaged as follows: the use of swab, perioperative surface are done Dry or contacted with Talcum by Pulvis Talci glove.Even if in Minimally Invasive Surgery, such as laparoscopy, activation process is also being run During set up.

Although the pathophysiology research of peritoneal adhesion has exceeded a century, but discovery up to now is still not exclusively 's.Fig. 1 concludes and shows the pathogeny of peritoneal adhesion and possible Therapeutic Method.Assume that the wound of peritoneal tissues causes inflammatory Reaction, and ooze out inflammatory cell and SFM.These formed fibre structure in about 3 hours, if deposited In enough fibrinolytic activity, then this fibre structure can be dissolved by serine protease plasmin within a few days ago.But It is that, if this situation does not occur, result is then to form the connective tissue of collagen-rich, the most permanent adhesion, its Then will come into question.

Although the most a few days ago, inflammatory process relates generally to neutrophilic granulocyte, but macrophage and mesothelial cell The generation of permanent adhesion plays a significant role.Two kinds of cell types all can be by plasminogen, i.e. the precursor of fibrinolysin, It is discharged in blood flow.In blood capillary, by the former activity factor of serine protease plasmin, (tissue/urine swashs plasminogen Enzyme plasminogen activating factors, t-PA/u-PA) change into fibrinolysin.These protease are also by a cortex secretion.Pass through concentration The inflammatory cytokine such as tumor necrosis factor (TNF), transforming growth factor (TGF β) or the interleukin that increase trigger, activity tPA Concentration reduces at wound after-stage.This causes the fibrinolytic activity in abdominal cavity to significantly reduce, and this causes plasmin Solve between fibrin formation unbalance, and promote permanent Adhesion formation.In tissue, the reduction of activity t-PA concentration is transferred It is owing to the t-PA yield in mesothelial cell reduces and simultaneously plasminogen activating factors inhibitor type 1(PAI-1) The overexpression of the most important inhibitor of tissue plasmin activity factor.It is similar to primary wound close wherein Platelet is increasingly secreted PAI-1 thus is prevented fibrin Premature disintegration and therefore start primary wound Guan Bi, in wound After-stage, the mesothelial cell of a veins beneath the skin and endotheliocyte form plasminogen activating factors inhibitor to be occurred increasing.Therefore, Assume that t-PA/PAI-1 balance is the key point forming peritoneal adhesion.

About the treatment of permanent adhesion, there is different methods, such as:

I) constitutional prevents by avoiding damage to and inflammation,

Ii) prevent from solidifying containing serum exudate by anticoagulant,

Iii) fibre structure is dissolved by cellosolve,

Iv) apply mechanical barrier, until between cortex by separation and regenerate, and

V) prevent fibrous tissue from forming (fibrosation).

The application of cellosolve and the application of physical barriers are considered as promising Therapeutic Method；But, these methods by Do not find to be accepted by clinic in its disadvantages associated.Have been found that currently available cellosolve has the tissue adhesion activity of deficiency, according to It is presumably due to its short-half-life etc. in blood plasma.It is thus desirable to high dose produce strong side effect, and prevent its application. Known cellosolve is that (alteplase, can be with for the t-PA albumen alteplase that generates of streptokinase, urokinase and restructuringObtain) and modified forms reteplase (reteplase is purchased from).Alteplase is in blood plasma Half-life be only 3 to 6 minutes, the plasma half-life of the reteplase of modified forms increases to 13 to 16 minutes.Accordingly, it would be desirable to Multiple using with infusion pump to obtain continuous levels of drugs, it produces high side effect.

Physical barriers also has been used for reducing adhesion.But, post-operative complication can't be demonstrated actively up to now Effect.Currently available physical barriers system is limited to local application region.Known physical barriers is mainly absorbable tissue, as The combination of oxidized fibre cellulose fiber, hyaluronic acid and carboxymethyl cellulose or PEG gel.

Such as, by US2011/0052712A1 it is known that utilize biodegradable polymer as adhesion barrier.The document Proposing the preparation for generating adhesion barrier, it includes in a large number from biodegradable polymer and at least one water-soluble poly The granule of the combination of polymers of compound, it deposits organizationally with form membrane, to prevent adhesion.Use rear water-soluble polymer Purpose is from tissue imbibition such that it is able to realizes film and is formed and the offer of water so that granule gradually decomposes and discharges possibility Including activating agent.These granules can comprise such as antiinflammatory, as activating agent.But, by the property of the film that said preparation obtains Matter depends on using the retrievable water yield of site, and cannot be conditioned with reproduction form.

Have also been proposed and the activating agent preventing adhesion is put on damage or surgical site.Owing to liquid is maintained at the most for a long time Ideal position, have developed such system in the past: wherein activating agent may be encapsulated in biodegradable polymerization In thing, it is provided in pre-formed matrix.But, fixed system is uncomfortable for patients, particularly in abdominal cavity district.Cause This, have also been proposed the gel used that replaces, and it can comprise activating agent.Therefore, WO2004/011054 such as discloses polymerization Thing storage composition, it includes the polymeric matrix being made up of the different types of polymer with as little as high molecular, and this gathers Polymer matrix includes difficult miscible in the solvent of water, to improve the plasticity of polymer.The compositions proposed is polytype polymerization The compound system of thing, therefore produce and in application with high costs and complicated.

By comprising the water solublity or water-swelling polymer absorbing in substrate by water, the water from surrounding is used for The shortcoming of substrate formed known architectures is present in the activating agent that substrate includes, it is discharged the most rapidly by water so that make It is being initially present too high surfactant concentration by site.Be preferably uniformly to discharge, and be started without so-called " quick-fried Fried ".For realizing this target, US2009/0004273 proposes by utilizing polymeric system encapsulating protein and peptide, this polymer System is formed without hydrogel when system contact tissue fluid.For bringing the substantially continuous linear release of activating agent and preventing from opening Exploding during the beginning, two kinds of different polymeric systems that application is made up of with hydrophilic component hydrophobic components, it can be such as with dress Put film or coating form is supplied.

Live for making implant use personality, it is also proposed that be formed in situ film or implant.To this end, such as, DE10001863 retouches Having stated the implant being formed in situ, it is formed in situ by mixed carrier material the most at once and solvent so that at least Component Vectors material dissolves, thus forms liquid crystalline phase in the body.Carrier material provides in powder form, and such as by injection It is dried and obtains.Specifically, when it also includes activating agent, it is necessary to carefully make carrier material be sufficiently mixed, so that activating agent It is evenly distributed in the substrate of generation.

Further, the carrier system being formed in situ has been described for implant and has produced.Owing to the substrate in health is formed Cannot directly apply temperature and pH value change and reactive component, the most the most frequently used technology is solvent deposition.Therefore, exist In known method, implant is most often through the insoluble polymer dissolved in organic solvent and tissue fluid (lymph) Contact and be cured.For promoting precipitation, wherein in some known methods, as it has been described above, water absorption component is added compositions, Such as swellable polymers.Depend on carrier system and the organic solvent used, realize viscosity increase by forming viscogel, or Formed by substrate and realize real carrier system precipitation.To this end, often use lactic acid and the copolymer of glycolic, its precipitation can be led to Cross solvent and polymeric oxidizer controls.Depend on when the molecular size of medicine activity component, release dynamics and release continue Between all can be regulated as one sees fit.Two kinds of technology described in the prior areTechnology, it utilizes N-methyl-2-pyrrolidine Ketone is as water-miscible solvent；WithTechnology, it utilizes slightly water-soluble solvent.It is a known fact that, water miscibility is relatively Height causes implant to be formed comparatively fast, therefore causes matrix porous higher, and slightly water-soluble solvent or high concentration polymer solution Implant is caused to be formed slower.Former approach causes embedding component to discharge rapidly and activating agent initial release is higher, so-called " explode ".The latter's method causes sustained release, and after discharging and only starting from certain time.Based onThe product of technology Can be purchased, it is correlated with the form of hormone preparation of carcinoma of prostate treating advanced hormone.

This system is beneficial in that it directly can be used in preferable site and activating agent also can be in the phase of using Between be embedded into substrate.However, it is known that the greatest problem of the implant being formed in situ be morphology Control and the therefore medicine of implant The control of thing release.The form of implant depends on the condition using site, and therefore repeatability is nearly impossible, and hinders The only predetermined set of release dynamics.

Therefore, the most known system the most still has the disadvantage in that, and also not met application.Therefore, the mesh of the present invention Mark be to provide overcome these shortcomings, convenient use, use process is without complicated or expensive measures and contributes to being reliably prevented Damage and the system of postoperative intestinal adhesion.Additionally, system will provide the probability of delivery of active agent, wherein the release of activating agent will be Foreseeable, adjustable and occur with constant manner, and it is not resulted in the blast when starting, and without long delay.

It is also an object of the invention to provide such application system: it can be injected directly on expection site；Its energy Enough absorbing activity agent, specifically hydrophilizing agent, such as nucleic acid, protein or peptide, and they can be discharged with control mode；It can be Use site and produce stable film, and the releasing properties of this film is adjustable and optimizable.In addition, it will thus provide such Application system: it is PHYSIOLOGICALLY COMPATIBLE, and do not hinder the activity of protein, peptide and nucleic acid, therefore allow release activated product.

It is also an object of the invention to provide can effectively prevent surgical adhesions and contribute to preventing executing of permanent adhesion Use system.

Above-mentioned target is that the sprayable application system limited by claim 1 is realized.Sprayable application system, Hereinafter it is also referred to as injection system, including at least one lipophilic formed by least one polymer dissolved in a solvent Property component and at least one aqueous components and optionally at least a kind of activating agent.It can include further component.

Surprisingly it has been found that, the concrete compositions that the present invention limits provides such carrier material: conveniently use, stable, can Use on preferable site and with desired level, and activating agent can be provided to reach the preferable time period and with preferable rate of release Activating agent is provided.

Useful character is realized by injection system, and this injection system includes two kinds of components, and one of which component has Dissolving at least one polymer in a solvent, and another component has at least one aqueous solvent, wherein component is before administration At once or it is blended together each other during using and by spray application, wherein the component of the present invention is formed in situ substrate, This substrate is decomposed after predetermined amount of time, and discharges the activating agent optionally included in this time period with control mode.

By the film of the System forming according to the present invention, there is high-quality and use site at its place that plays a role Place keeps the scheduled time.Only by the combination of feature of present invention, it is possible to obtain the carrier material with desirable properties.

The key character of the present invention is polymer type and type of solvent and administration form, i.e. the most at once or During injection or the contact of two kinds of components of injection period chien shih.

One of them basic feature of system according to the present invention is lipophilic ingredients, and it includes based on glycolic and lactic acid At least one polymer and at least one biocompatible solvent of described polymer, this solvent has predetermined logP value, as It is described in more below.This lipophilic ingredients the most at once or injection time with include at least one aqueous solvent At least one hydrophilic component blends, and produces substrate by the precipitation of polymer, and this substrate forms physical barriers in injection site, Can effectively prevent surgical adhesions.In a preferred embodiment, lipophilic ingredients and/or hydrophilic component include at least one Activating agent, it embeds film during injection and film are formed, and therefrom discharges with control mode, additionally by physiology and/or life The thing section of learning to do stops surgical adhesions.

Being particularly advantageous in that of this application system, owing to specifically using the selection of component, polymeric matrix passes through polymer Precipitate from solvent and formed in injection period.If activating agent is embedded in compositions in this polymeric matrix comprises work Property agent.Polymer precipitation will mean, and exceed the solubility limit of polymer and polymer not re-dissolved or be dissolved completely in solvent In.By regulating each component, it may be predetermined that the porous of settling rate and film synthesis speed and therefore gained substrate, this Cause controlling releasing properties.In view of the transmutability of these polymer, there is multiple probability to regulate optimal properties；But, look for The easiest to the optimal solution for concrete condition.Therefore, it is described below being capable of the ginseng that Optimal system selects Number.

The key factor of system of the present invention is mainly: polymer used, for dissolving the solvent of polymer, polymer, Solvent and aqueous components content, and the optionally content of activating agent and form.

For substrate formed material should sterilizing, and its activating agent that must be allowed for comprising is in certain time Duan Qizhong can stick together and be formed or synulotic control release.This time period is in the range of at least two weeks up to Six weeks, preferably two to surrounding.Additionally, material must have certain quality so that it keeps its stability to be enough to realize preferable mesh The target time, i.e. be used for preventing adhesion.

Suitably the important parameter of polymeric oxidizer is molal weight (molecular weight).The suitably selection of molecular size is set up solid On the basis of having viscosity (natural logrithm of the relative viscosity of concentration C based on solute).In a way known, by At CHCl at 25 DEG C₃In with 0.1% measure PLGA polymer intrinsic viscosity.For system of the present invention, the most such poly- Compound: its intrinsic viscosity in the range of 0.1 to 0.8, specifically 0.15 to 0.7.If this value is less than 0.1, then polymer is usual Too small, and sufficiently long activity can not be continued.If this value is excessive, then cannot ensure enough film qualities；Additionally, until release The delay started may be long.For realizing optimal properties, it is possible to use have the polymeric blends of different molal weight.

The molal weight of PLGA polymer also can be determined by conventional method, such as, passes through gel permeation chromatography.Find Molal weight PLGA polymer in the range of 10 to 63kDA is especially suitable for.

There is further factor and contribute to selecting to be suitable to the polymer of the application system of the present invention.The system of the present invention must Must be sprayable, this represents that it must be solvable maybe can be suspended in biocompatible solvent.

The quality of the film formed by the application system of the present invention and the tolerance of mechanical stability are the product of substrate and/or film Matter, it can be determined by the method described in embodiment.Fig. 2 shows that the film quality combined about multiple polymers and solvent exists Test result described in embodiment.Film quality is substantially selected by solvent and polymer molar quality determines.Determine about it, Clearly based on the total weight polymers of polymer used at supernatant (loss) and the percentage ratio in precipitation (substrate quality).Resultant layer Or the substrate quality of gained film is most important for the system of the present invention, because system must act at least two weeks and up to six Week.This is only possible in the case of the layer preferable release dynamics of sufficiently stable offer simultaneously of the film formed or formation. Therefore, substrate quality should be at following scope: 80 to 100%, preferably 90 to 100%, most preferably 95 to 100%, and wherein this value exists Determine under room temperature, i.e. about 25 DEG C, during wherein the method is described in embodiment.

Substrate quality depends on the molal weight etc. of polymer.It has been found that have the feelings of higher molar mass at polymer Under condition, by relatively large polymer doped matrix, and in the case of polymer has relatively low molar mass, polymer can be there is Loss (is formed for film).For example, it was discovered that the ratio for lactide and Acetic acid, hydroxy-, bimol. cyclic ester is 75:25 and intrinsic viscosity is 0.5 to 0.7 PLGA polymer for i.e. there is relatively high molal weight and use the polymer with esterification end group, almost 100% Amount of polymers used formed substrate.On the contrary, find that the ratio for lactide and Acetic acid, hydroxy-, bimol. cyclic ester is 50:50 and intrinsic viscosity < 0.6 And for having the PLGA polymer of free end group, polymer runs off during substrate is formed, i.e. it is not embedded into substrate.This Plant effect to be increased by solvent or improve.

As it has been described above, polymer used is one of system solvent.According to the present invention, ethanol acidic group and lactyl polymerization Thing, the most poly-(lactide-co-glycolide), it is common that poly-(D, L-lactide-co-glycolide), hereinafter it is also referred to as PLGA polymer, is used for application system.Polymer based on D, L-lactide can be used and based on mapping pure L-lactide Polymer.

Known lactyl and/or glycolic based polyalcohol quite a while, controlling delivery systme is also.Generally, PLGA polymer is processed to microgranule or implant, and then it can be applied in many ways.PLGA polymer is biocompatible And biodegradable, and its character may be adapted to different purposes.

The present invention utilizes the ethanol acidic group and lactic acid-based polymers dissolved in a solvent.The release dynamics of these polymer Regulated by its molecular weight, molecular weight distribution and end group thereof.

Therefore, by specifically chosen polymer and solvent, whether optional gained substrate realizes what diffusion was dominated, corrodes main Lead, or diffusion is leading and corrodes the release dominating both.The rapid substrate of high-quality realized according to the present invention is formed and constitutes in fact The important tool showing linear release kinetics and be lost without initial activity agent.

It has been found that PLGA polymer is more suitable for the body of the present invention than pure polylactide (PLA) or pure PGA (PGA) System.By regulation lactic acid units and the ratio of glycolic acid units, can domination property the most in a way known, specifically Degraded character.In the application system of the present invention, such PLGA polymer have been demonstrated it is preferable that its lactide unit with The ratio of glycolide units is in the range of about 75 to about 25 to about 25 to about 75.Statement " lactide unit and the ratio of glycolide units " All the time the mol ratio of unit in polymer is meant.The mixture of different types of PLGA polymer can also be used.Can make With the mixture of any kind of PLGA polymer, such as, the wherein mol ratio of lactide unit and glycolide units and/or rub Your quality or intrinsic viscosity and/or lactide unit kind (D/L or L) and/or the different polymeric blends of end group.Can pass through Conventionally test finds the mixture being most suitable for particular use.

The degradation rate of PLGA polymer depends on PGA or PLA content, and wherein PLGA copolymer degradation speed is usually shorter than PLA polymer or PGA polymer.It is therefore preferable that PLGA polymer.The shortest degradation time passes through lactide and the ratio of Acetic acid, hydroxy-, bimol. cyclic ester Polymer for 50:50 realizes.Due to methyl other in lactic acid monomer, the increase of PLA content hinders the hydrolysis of polymer, Increasing hydrophobicity, this causes degradation time longer simultaneously.And, the increase of PGA content or pure three-dimensional enantiomer L-in polymer The use of lactic acid, compared with monomer D-/L-lactic acid, extend the depolymerization time by increase polymer crystallinity, Because water diffuses more readily in amorphous domain.Therefore, more promptly degrade than crystal region in these regions.Therefore, poly- Compound degree of crystallinity steadily increases during degrading.Therefore, by regulating this ratio, degree of crystallinity can be set and degradation time is Predetermined value.Additionally, degradation rate can be promoted by shorter polymer chain and free end group.Free end group, i.e. free hydroxyl group and trip From carboxyl, increase the hydrophilic of polymer so that water and the diffusion rate of inclusions thereof in polymeric matrix increase.Additionally, By reduction intramatrical pH value, catalytic polymer hydrolyzes free carboxy.Therefore, there is the polymer of free end group according to this Invention is preferably used.

According to the present invention it is preferred to use such PLGA polymer: there is free end group, its lactide unit and Acetic acid, hydroxy-, bimol. cyclic ester The ratio of unit is 40:60 to 60:40, more preferably from about 50:50, and/or its intrinsic viscosity is less than 0.6.When use has esterification end During the PLGA polymer of base, preferred lactide unit and the PLGA polymer that ratio is 75:25 of glycolide units.

Suitable PLGA polymer can be purchased, as resomer polymer (be purchased from Evonik Industries AG, Essen, Germany), specifically, fromSeries orThe resomers of series.The suitableeest When polymer be, such as,502H, 503H and 504H orRG755S.Table 1 below lists the most poly- The properties of compound:

Table 1: usedThe character of polymer

* intrinsic viscosity (vein；0.1% chloroformic solution, at 25 DEG C)

* acidic group number (potentiometric titration), derives from manufacturer's information.

* * molal weight, by gpc measurement, and

* * * discharges data, is derived from the disclosure of Eliaz etc., [44 [Eliaz, 2000#257].755S and The release data of 503H relate to the albumin release [44] from Ox blood serum,The release data of 502H and 504H relate to And thymic DNA [45] is from the tetraethylene glycol (TEG) of injectable implant (10% to 20%PLGA(m/v)) release.

Polymeric matrix becomes biocompatibility monomer lactic acid and glycolic by ester hydrolytic degradation, and it is subsequently by Cray cloth This circulation is metabolised to CO₂And water.The degradation model of PLGA implant is based on bulk erosion, it is characterised in that water diffuses into Polymeric matrix is faster than depolymerization.Therefore, this causes the homogeneous quality of the whole cross section of polymeric matrix to be lost.Degraded Journey can be subdivided into three parts generally:

1. hydration: Polymer absorption water also expands, and its small portion ester bond is the most destroyed.But, mass loss is not also sent out Raw.

2. degraded: average molar mass significantly reduces.The hydroxy-acid group produced after ester linkage breaking causes in substrate under pH value Fall, therefore causes the autocatalysis that ester ruptures.The mechanical strength of polymer and/or mechanical stability are lost.

3. solution: at the end of degraded, low molecular weight fraction and oligomer are dissolved in the medium of surrounding, and molten Solve polymer segments so that be hydrolyzed into free carboxy acid.

Degradation time determines encapsulated macromole and the release of nano carrier material, because in view of its size, it is main Matrix erosion to be passed through is released so that can specifically control rate of release by degradation rate.The degraded of PLGA polymer Time can be controlled by the molal weight of its composition and polymer.In the case of commercially available PLGA polymer, intrinsic viscosity Degree is generally shown as molal weight size.

The viscoelasticity of system works equally, as shown in Fig. 3 and embodiment.

It is essential for the application system of the present invention, produce and keep its mechanical strength and/or stability foot Enough long-time to prevent adhesion the high quality material degraded subsequently.When the carrier system quilt formed by the application system of the present invention When loading activating agent, additionally need activating agent and discharge with preferable release dynamics.

The substrate quality of the film obtained by the application system of the present invention depends on polymer used, molten for its solution Agent and water solubility thereof.It has been found that the quality being used for the solvent the dissolving PLGA polymer substrate to producing with it has quite Impact.Therefore, dissolve produced substrate after PLGA in a solvent combines with aqueous phase and depend on type and the consumption of solvent, It is particularly depending on its hydrophilic.

On the other hand, the selection of solvent additionally depends on polymer type used.Polymer lipotropy is the highest, solvent lipotropy Must be the highest.The lipotropy of polymer depends on its end group etc., because the PLGA ratio with free acidic group has esterification end group PLGA more hydrophilic.

On the one hand, solvent must make the polymer of selection be dissolved to the sprayable degree of polymer, and on the other hand, solvent exists Dissolubility in water must be sufficiently high, so that precipitating rapidly after two kinds of component injections.The useful parameter that appropriate solvent selects It it is logP value.

Because as it appears from the above, substrate quality changes according to polymer molar quality also by solvent, the present invention enters one Step key character is solvent.The important parameter selecting solvent is the miscible degree with water.The highest with the miscible degree of water, substrate is formed more Hurry up, but, porous also increases.The miscible degree of water is the lowest, and substrate is formed the slowest, and quality is the highest.

The miscible degree of water of solvent can be determined by logP value.

LogP value represents Octanol/water Partition Coefficients, i.e. the concentration ratio of 1-capryl alcohol and aqueous solvent in two-phase system.LogP value It is defined as follows:

$\log P=\log \frac{c_0^{s_i}}{c_{\mathrm{\&Omega;}}^{s_i}}=\log c_0^{s_i}-\log c_{\mathrm{\&Omega;}}^{s_i}.$

Being calculated or determined of logP value is known per se.The algorithm being adapted to determine that logP value is XlogP3, such as Cheng etc. Described (Cheng T., Zhaoy, Lix, Lin F., Xu Y., Zhang X.Et al., Computation of Octanol- Water Partition Coefficients by Guiding an Additive Model with Knowledge.J.Chem.Inf.Model.2007；47:2140-2148).The logP value calculated in this way is for lipotropy Material generates on the occasion of generating negative value with for hydroaropic substance.It has been found that in the system of the present invention, lipotropy can be used not bery High material so that preferably have XlogP3 negative value or the most minimum XlogP3 on the occasion of solvent.

It is proved such solvent and is suitable to the system of the present invention: its XlogP3 value is less than 0.2, preferably shorter than 0, particularly In the range of-0.2 to-1.5, particularly preferred XlogP3 value solvent between-0.25 and-1.0.If XlogP3 value is relatively Height, then the lipotropy of polymer used is higher.

It has been found that use site when the solvent logP polymer solution less than 0.2 mixes with aqueous components and is injected into Time upper, the form can predefine and reproduce that precipitates occurs, and this produces the polymeric film with desirable properties.

The lipotropy of polymer used is the highest, and the lipotropy of solvent for use must be the highest, and the miscible degree of its water must be got over Low.The difference between polymer solubility in solvent or water is the biggest, and the impact on film Cambium periodicity is the biggest.Therefore, as Fruit PLGA polymer used is to have esterification end group and therefore have the PLGA polymer of relatively highly lipophilic, then solvent for use should be same Sample has relatively highly lipophilic.Compared with the solvent of highly lipophilic, there is the miscible degree of poor water, therefore cause Super matrix quality.It has been found that When close to solubility limit and solvent, the system of polymer and solvent has that possible optimal water is miscible spends, it is thus achieved that most preferably tie Really so that after aqueous phase adds, film is formed quickly and completely, and wherein the polymer of high percentage is present in substrate.

Polymer dissolubility in a solvent has impact equally.Polymer dissolves the most abundant in a solvent, needs after a while The most water are from film precipitation polymers and form film.On the other hand, dissolubility must make enough polymer solubilized in a solvent. It has been found that such solvent suitably forms high quality film: for PLGA used, the dissolubility under its room temperature is at least 5% (mass/volume) (m/v), preferably 5 to 60%, particularly dissolubility 10 to 30%.The selection of appropriate solvent should be based on following relevant Property: solvent reduces with the increase of polymer molar quality for the dissolubility of polymer.The lipotropy of polymer is the highest, i.e. poly- Compound degree of esterification is the highest and/or polymer chain is the longest, and the lipotropy of solvent must be the highest.Therefore, when using highly lipophilic to gather When compound and highly-water-soluble solvent, polymer is by only with minimum degree soluble, and the polymer that lipotropy is relatively low, such as, tool There are free acidic group and the polymer of relatively low molar mass, are soluble in hydrophilic solvent.On the other hand, polymer dissolves the most abundant, Then precipitation needs the most water.It is 5 to 15% and the XlogP3 value of solvent is in the range of-0.3 to-1.0 when selecting dissolubility When polymer and solvent, fabulous result can be obtained.Under this combination, polymer add water time very rapidly precipitate and Form high quality film.XlogP3 value solvent in this range will be known to those skilled in the art.

Therefore, the solvent being highly suitable for is by the miscible degree of water good for combination and following polymer solubility: in desired quantity In the case of polymer, the dissolubility in solvent close to application temperature i.e., the saturation limit at 30 to 40 DEG C.In office In the case of He, the dissolubility under room temperature must be sufficiently high to form stable solution.

Tetraethylene glycol (TEG), glycerol formal and dimethyl isosorbide (DMI) have been observed that particularly suitable.Solvent tetrahydrofurfuryl alcohol Polyethylene Glycol, also referred to as tetraethylene glycol (TEG) or glycogen (glycofurol), be the solvent of parenteral application for a long time.Up to 50% Concentration be employed, and in this diluent, solvent only shows hypotoxicity.

Glycerol formal is odorless solvent, has hypotoxicity, by 1, and 3-bis-Alkane-5-alcohol and 1,3-dioxolanes-4-first The mixture composition of alcohol.It is the fine solvent of multi-medicament and cosmetics.Especially in veterinary drug, it is used as injection solvent. Glycerol formal is commercially available, such as, withWith.The Ivumec of 0.27%^TMGo through to execute under Corii Sus domestica With, and generally apply with 0.1mg/kg.

Dimethyl isosorbide (DMI) becomes known for local application.The commercial preparation comprising DMI isWith.DMI is by topical application, as penetration enhancing substance.Have observed that low hemolytic activity.

It has been found that the film quality by the film of the application system formation of the present invention is the highest, the miscible degree of water of solvent for use is more High.Embodiment discloses the test determining film quality.Fig. 4 shows multiple PLGA polymer and the film quality of solvent combination.Above-mentioned The water solubility of solvent reduces according to following order: glycerol formal > DMI > tetraethylene glycol (TEG).Therefore, as a rule, glycerol acetonide first Aldehyde will be the most preferred solvent of application system of the present invention, as long as it can dissolve enough polymer.Table 2 below provides some to test The character overview of solvent:

Table 2: the character of some solvents

* dynamic viscosity η is determined by rotating cylinder viscometer (MRC100, Paar Physics) at 25 DEG C,

* XlogP3 data are value of calculation [32]

* * dissolubility data derives from Matschke etc., the disclosure [33] of 2002.

By the film thickness of the substrate of the injection system formation of the present invention, water diffusion rate had impact.Such as, for Film thickness be 150 to 300 μm PLGA system for wherein water diffusion rate limited, can additionally detect that surface is invaded Erosion.Unrelated with solvent for use, viscoelasticity test in, measure based onAbout 300 μm film layers of the film of 502H.But Be, on the contrary, the increase of the film thickness of longer chain polymeric film be similar to observe from DMI via glycerol formal to tetraethylene glycol (TEG) Release dynamics.

The further very important feature of application system solvent for use of the present invention is its biocompatibility or tissue tolerance Property.In this application, the impact of metabolizing cells viability is determined through the time of 11 hours by tissue tolerance by solvent. Determine that method describes in an embodiment.Find LD₅₀Value is toxicity tolerance.Consider the LD of the solvent for application system of the present invention₅₀ Value must be at least 1, preferably at least 10mg/ml.Above-mentioned particularly preferred solvent meets this requirement.Consequently, it was found that glycerol Formal is particularly suitable.Its LD under incubative time below 6 hours₅₀Value is about 1g/ml.Therefore, glycerol formal is this The particularly preferred solvent of phaneroplasm system.Fig. 5 shows the LD of preferred solvent₅₀It is worth the function as incubative time.

In one embodiment, the application system of the present invention only includes a kind of lipotropy group with polymer and solvent Point, as mentioned above；And water, as second component.If it meets above-mentioned requirements, then can utilize this by mixing and injection A little component produced in situ can effectively prevent the film of surgical adhesions.

It is essential for the present invention, the injection system of the present invention comprises lipophilic ingredients and aqueous components, its phase Separate mutually until spraying.Component can only injection time or injection before at once or injection period mixing.It has been found that relatively small amount water Adding has caused polymer to precipitate.Premature precipitation may interfere with film formed, and injection apparatus possibly also owing to polymer deposition and Blocking.Therefore, mixing should preferably occur directly in injection period, such as, by respectively estimate one's own ability two kinds of components are fed to mixing In room, then directly during mixing sprayed.Therefore, mix and spray and should occur the most simultaneously.

In further embodiment, it is provided that also include the application system of activating agent.Suitable activating agent is all to have Effectiveness uses the material in site in target.The application system of the present invention is particularly useful for discharging nucleic acid, protein and peptide.For This, can directly discharge protein and peptide and its code nucleic acid or even its mixture.It has been found that the application system of the present invention Discharging it with gained film can the nucleic acid of form to express subsequently.Owing to the system of the present invention is provided for preventing adhesion, excellent Select fibrinolytic protein and peptide and/or the corresponding nucleic encoding it is used as activating agent.

Activating agent may be present in one of two kinds of components being in dissolving or dispersity.Can it has been found that aqueous phase amount is too high (negatively) impact forms the quality of film.Therefore, if adding water solubility to be not high enough to generate the activity of highly concentrated solution Agent, the most preferably adding has been the activating agent of precipitation form, such as, dried forms.The little chi being dispersed in lipophilic ingredients The lyophilized products of very little solid form or polycomplex (polyplexes) are particularly suitable.This has the further advantage that at it solid Under bodily form formula, activating agent has relatively high storage stability.

As it has been described above, particularly tissue-specific plasminogen activity factor and inhibitor thereof have in the formation of adhesion Impact.Therefore, according to an embodiment of the invention, " gene activation " film being formed in situ is applied topically by injection, To treat peritoneal adhesion.Due to as it has been described above, in abdominal cavity in the period in Post operation 2 to 3 week, permanent adhesion can occur, and And as it is assumed that this be by between tissue-specific plasminogen activity factor (tPA) and its inhibitor (PAI-1) unbalance touch Send out, according to the present invention by providing tPA and/or suppression PAI-1 to change this unbalance.This is that the film being formed in situ is carried out, This film includes tPA and/or PAI-1 inhibitor and/or encodes its nucleic acid.It has been found that when the injection system using the present invention Time this injection system comprise coding tPA plasmid, when film is formed, plasmid is impregnated in membrane matrix, the most gradually discharges, and And the tPA level at least two weeks rising physiological environment.TPA level in the physiological environment of jet film also can be by by PAI-1 Inhibitor is introduced this environment or is raised by the two combination.In embodiment and Figure 10 and 11, describe and obtained by this film The character obtained and result.

To this end, display in cell culture analytical tPA encoding plasmids the present invention based on glycerol formal withIncorporation in the film of 504H can make tPA level be increased to 2ng/ml the time of 16 days.This is dense corresponding to tPA Degree increases by 4 times compared with the control.Owing to, in the tissue carrying out operation and Inflamed tissue, tPA concentration can be down to standard value 1/5th and lower, the film that generated by the injection system of the present invention therefore can be utilized to realize treatment for a long time relevant TPA level increases, and it can not be realized by prior art preparation.

Furthermore, it was found that stress and/or Inflamed tissue in, inhibitor level can increase to 17 times, causes tPA level notable Reduce.Therefore, tPA/PAI-1 ratio can be changed to the 0.4 of Inflamed tissue from the 3.5 of normal condition.Therefore, for more effectively controlling Process that Post operation occurs and more successfully resist adhesion, the injection system of the present invention particularly preferably includes that at least one tissue is special Opposite sex plasminogen activating factors or its code nucleic acid and at least one plasminogen activating factors inhibitor or its code nucleic acid Inhibitor.As shown in the Examples, can be by having efficient recovery tPA/PAI-1 to balance as follows: the injection system utilizing the present invention is raw Film forming, this film causes the cotransfection of the siRNA of tPA encoding plasmids DNA and anti-PAI-1.Can show, tPA encoding plasmids DNA is with anti- This cotransfection of the siRNA of PAI-1 causes, and 48h after transfection, tPA/PAI-1 are than increasing by 8.3 times, and plasmid is administered alone Will result only in 4.5 times of increases.Therefore, depending on preferably acting on, the injection system of the present invention can include tissue specificity fibrinolytic The activation of zymogen factor, or at least one PAI-1 inhibitor, or corresponding nucleic acid in the case of combination, and/or every kind.Cause This, the system that the present invention provides allows the control to ideal role alterable height.

In the above-described embodiment, nucleic acid can be RNA, DNA, mRNA, siRNA, miRNA, piRNA, shRNA, antisense Nucleic acid, aptamers, ribozyme, catalytic dna and/or its mixture.Term DNA includes the DNA of whole appropriate format, as cDNA, SsDNA, dsDNA etc.；Term RNA includes the RNA of whole appropriate format, such as mRNA, siRNA, miRNA, piRNA, shRNA etc..

Nucleic acid can be linear or ring-type, and it can be strand or double-strand.Term " nucleic acid " also includes codified The mixture of the nucleic acid of identical or different protein or peptide.All coding expection albumen or peptide and can be made it in preferable site The nucleic acid expressed is all suitable.Those skilled in the art will know that suitable nucleic acid, therefore, it is possible to selection is the most suitable Nucleic acid.Nucleic acid may be from any source, such as, from biological or synthesis source, from gene bank or gene sets, its Can be genome or subgenomic dna, derive from cell or the RNA of microorganism or the RNA being synthetically generated, etc..Nucleic acid can include Element needed for its amplification and expression, such as promoter, enhancer, signal sequence, ribosome binding site, afterbody etc..

Nucleic acid can be DNA or RNA, and it can include one or more gene or fragment.Nucleic acid can be autonomous multiple Sequence processed or integration sequence, its can with plasmid, carrier format or other well known to a person skilled in the art that form exists.It is permissible It is linear or ring-type and strand or double-strand.Any nucleic acids activity in cell is suitable at this.Due to " naked " nucleic acid Not being highly stable and fast deactivation or decomposition in cell, preferably by nucleic acid coating, wherein so-called polycomplex is special Not preferred embodiment.

For protection nucleic acid, it can be employed with the form of so-called polycomplex.Outside polycomplex is by polymer The nucleic acid molecules that shell surrounds.Preferably, cationic polymer is used as sheathing material.It has been found that cationically charged granule is comparable Neutral or anionically charged granule is easier to by cellular uptake.But, it also can promote more non-specific adsorption.About encapsulating As the nucleic acid of activating agent, preferred cationic sheathing material, because nucleic acid easily can be encapsulated by cationic substance and protect.Various skills Art is known to those skilled in the art.

Sheathing material can be naturally-occurring, synthesis or the natural materials of cationic derivation, such as lipid or polymerization Thing or oligomer.The example of crude oligos is spermine.The example of synthetic polymer is nitrogenous biodegradable polymers, special It not those with the nitrogen-atoms that can protonate.Especially appropriate is polymine, specifically Branched polyethyleneimine, its It is commercially available.It is appropriate that such as, mean molecule quantity is the Branched polyethyleneimine of 25kDa, and it is commercially available.Send out Existing, this polymer is fully compatible with other components of the injection system of the present invention.Lipid, specifically cation can also be used Or neutral lipid, form sheathing material as natural or optionally derivative film.Lipid can obtain with multiple variant, and can use In such as forming liposome.

When polycomplex is used as activating agent, the ratio of sheathing material and nucleic acid should be regulated in a way known, make Obtain nucleic acid to be still adequately protected, but still can express upon discharge.Without enough sheathing materials, nucleic acid will can not get fully protecting Protect.If sheathing material amount is too high, this may result in problem of resistance on the one hand, and may result on the other hand, too high In the case of sheathing material amount, nucleic acid can no longer be released and/or no longer be expressed.In both cases, transfer effect is equal It is lowered.By a small amount of conventionally test, those skilled in the art can find ratio optimal for concrete condition.It has been found that base Sheathing material and the ratio of nucleic acid in the range of weight, 10:1 to 1:4 are especially appropriate.Particularly preferably 4:1's to 1:4 Sheathing material and the ratio of nucleic acid.When polycomplex comprises polymine as polymer, polymer content also can be by gathering Compound nitrogen content represents with the mol ratio (N/P) of DNA phosphorus acid content；Preferably NP than be in 1 to 10 scope particularly preferably 4 to 8.

Polycomplex molecule is designed such that nucleic acid is storing, transporting and until using period and being protected, and Nucleic acid is released and expresses at target site.In the literature, suitable polymer, art technology have been described in the case of multiple Personnel can select optimal material from lot of materials.

From the clinical research first of 1989, obtain more than 1400 clinical researches utilize nucleic acid as medicine thing The experience of matter.In addition to reverse transcription virus gene transfering system, the also main adenoviral gene transfering system that uses, one the biggest excellent Gesture is the effect of these systems.Therefore, can be shown that the combination of single virus granule be enough to infect target cell.About immunity Originality and potential sudden change, nonviral gene transfer system is safe selection relative to virus system.With reference to non-viral gene Therapeutic Method, it has been described that naked nucleic acid and the combination application of physical method such as electroporation, and nanocomposite is together with synthesis The application of carrier system such as cationic polymer, it is also referred to as polycomplex.About polycomplex produce and application Information can at such as Godbey WT, Mikos AG,, Recent progress in gene delivery using non- Viral transfer complexes ". the article of (J Control Release, 2001,72:115-125) finds；With About cationic-liposome (lipid complex, lipoplexes) information can at Lee RJ, Huang L., Lipidic vector systems for gene transfer“(Crit Rev Ther Drug Carrier Syst.1997;14: 173-206) with Simoes S, Filipe A, Faneca H, Mano M, Penacho N, Duzgunes N, et al., Cationic liposomes for gene delivery“(Expert Opin Drug Deliv.2005,2:237-254) Article in find.Compound system is based on following principle: in physiological conditions, the nucleic acid of positively charged and electronegative carrier material Spontaneously build up to nano-scale particle (" self assembly ").

The injection system of the present invention provides novel and promising method to realize long-acting gene expression.By being formed so Film be in the form of storage system of gene activation, its local application may result in is using region, in limiting time section Interior constant nucleic acid level achieves useful character.Therefore, it can reduce frequent medication and dosage, disadvantageous to prevent Side effect, as transfected its hetero-organization, i.e. so-called " effect of missing the target ", thus avoids non-physiologic proteic level and nucleic acid and carrier Material is that patient causes burden, and improves patient acceptance.

As mentioned above, it is assumed that the comparison surgical adhesions of PA Yu PAI-1 inhibitor is formed and cicatrization has impact.Cause This, in further embodiment, it is provided that such injection system: include PA and PAI-1 inhibitor and/or its code nucleic acid Combination as activating agent.Here, the ratio of PA and PAI-1 inhibitor is in the range of 5:1 to 1:5；When using corresponding core During acid, this ratio can be set so that after expression, find that the ratio of the PA:PAI-1 inhibitor of target site is 5:1 to 1:5. It has been found that when applying this combination, can particularly effectively suppress surgical adhesions to be formed.

The injection system of the present invention is characterised by, after two kinds of components of mixing, polymer very rapidly precipitates, and is formed Film, during wherein activating agent is optionally comprised in one or both components, this component is by co-integration simultaneously to film.Therefore, Both components are stored in independent container before use, the most injected: during its injection or in spray At once it is mixed before penetrating, or it is injected while mixing.Therefore, both components of the injection system of the present invention are mixed To use.Preferably, the component of both independence is provided to mixing chamber to spray, and is directly therefrom sprayed.Excellent Be selected to injection is device known per se, and wherein, after injection valve activates, each agent is provided to mix from two storage vaults Close room, and the most injected from this.By this way, mixing is directly carried out in spray application device after injection, thus anti- Only premature precipitation, premature precipitation may result in injection nozzle blocking.From independent two kinds of components of spray application device successive In the case of, it is impossible to generate high quality film.The present invention be it is essential to both components keep that before it is used This separates, and contacts with each other in injection period so that, at spraying collision rift, the film formed by polymer precipitation can be deposited in mesh Mark site.The spray application device keeping the two kinds of components separated before being suitable to mixing/injection is known in the prior art 's.The known devices being suitable for using according to the present invention shows in fig. 8, and sprays set group and can be purchased from Baxter company.

The supply dosage of two kinds of components can be controlled.Each dosage depends on application type, component type and optionally lives Property agent.After application, two kinds of components should mix with following ratio (based on liquor capacity/liquid volume): 10:90 to 90:10, excellent Select 25:75 to 75:25, the ratio of more preferably 40:60 to 60:40.Component supply for produced film depends on the preferable chi of film Very little and thickness.It can be conditioned in a way known.Abdominal cavity is used, it has been found that each component 0.5 to 5ml, preferably 0.7 Amount to 3ml is suitable.

Following combination has been observed that advantageous particularly:

Lipophilic ingredients: the 10%(m/v in glycerol formal, tetraethylene glycol (TEG) or DMI) PLGA solution (H Series),

Hydrophilic component: water for injection,

Activating agent: pDNA/l-PEI polycomplex, is dissolved in aqueous favoring (mix and select A) as lyophilized products, or logical Cross homogenizer and be dispersed in lipotropy PLGA solution (mix and select B).

Optionally, concentration is 10%(m/v) sucrose as the cryoprotective agent of lyophilization.

The injection system of the present invention is provided for treatment use.It is pre-by the region of using of its matrix system generated Prevention of postsurgical adhesion, in abdominal cavity, tissue adhesion can develop into permanent adhesion after surgery, and it is swashed by tissue-specific plasminogen That lives between the factor and its inhibitor unbalance causes [56,64,65].The crucially time frame of 2 weeks at this, including Post operation 2 To the acute stage of 5 days.Comprise tPA encoding plasmids particularly suitable as the storage system of activating agent.In addition to pharmacological activity component, Polymeric film also constitutes other tissue adhesion barrier, resists adhesion.For example, it is also possible to by the injection of the endoscope injection present invention In the case of in system, such as abdominal cavity, endoscope intervenes.

The present invention obtains further example by accompanying drawing.

Accompanying drawing display embodiments of the present invention and the result obtained by it.

Fig. 1 shows the pathogenetic schematic diagram about surgical adhesions.

Fig. 2 show comparatively show selectThe film quality figure of polymer: A) PLGA50:50, H system Row, B) PLGA75:25, S series.The percentage ratio of the polymer used of its display formation jet film, and remainder, as solvable Property part, is lost in supernatant.Data are given with meansigma methods ± standard deviation (n=4).Statistically-significant difference asterisk mark Note (P < 0.05(*), P < 0.01(**)).

Fig. 3 shows the result figure that film viscoelasticity is tested:The A of H series) storage modulu (G`), B) loss Modulus (G``), in the case of different solvents, compares at a frequency of 1 hz.

Fig. 4 shows the film quality realized by test solvent: A) utilizeThe film that 503H is formed in situ；B) The film quality drawn for partition coefficient P.Data show with meansigma methods ± standard deviation, n=4 preparation.

Fig. 5 compares the LD of display test solvent₅₀Value: the LD of test solvent₅₀Function as mesothelial cell's incubative time. In every case, metabolizing cells viability is determined by ATPlite Assay.

Fig. 6 shows the release dynamics figure of the different formulations about the film being formed in situ: (A)RG502H, parent Polycomplex in aqueous phase；(B)RG502H, lipotropy mutually in polycomplex；(C) 504H, the polycomplex in aqueous favoring；(D)504H, lipotropy mutually in polycomplex.Utilize difference Polymer solution (DMI(●), tetraethylene glycol (TEG) (zero) and glycerol formal ()), the polycomplex of lyophilizing is mixed in film, And analyze the release 30 days of pDNA.Data are given with the standard deviation (n=3) of meansigma methods ± anomaly average.

Fig. 7 shows that the lyophilizing l-PEI/pDNA polycomplex utilizing different cryoprotective agent is for the transfection of pneumonocyte system Effect.Under adding Heparan sulfate (HS), separate DNA topology-lyophilizing pDNA/l-PEI by agarose gel electrophoresis Polycomplex.For this purpose it is proposed, polycomplex is resuspended in water for injection (WfI).Data are with meansigma methods ± standard deviation Difference ((a) n=7, (b) n=4)) display.Statistically-significant difference is by asterisk labelling (P < 0.05(*), P < 0.01(**)) labelling. PCMV-Luc compares (C), dimension mark (L), water for injection (WfI),(UT), homogenizer (H).

Fig. 8 shows the Setup Experiments generating the film being formed in situ.

Fig. 9 shows the film result figure used external for mesothelial cell of invention: based on504H's Film use on mesothelial cell after luciferase gene expression.Plasmid DNA/l-PEI polycomplex is mixed in aqueous favoring, And study its expression through the time of 29 days by luciferase assay.The photon (RLU) of transmitting is measured after background correction 10s.Result is with the standard error of meansigma methods ± SEM(meansigma methods) (n=3) be given.

Figure 10 shows the film the being formed in situ result used external for mesothelial cell.(A) based onRG504H Film substrate release, and (B) with propidium iodide (propidium iodide) dyeing after, the fluorescent reporter of the plasmid-DNA of incorporation Record.PCMV-tPA-IRES-Luc/l-PEI polycomplex is dissolved in aqueous favoring, jet film is injected in mesothelial cell On, and determined tPA level through 29 days by ELISA.Result is with meansigma methods ± SEM(n=3) be given.

Figure 11 shows the plasmid DNA/siRNA cotransfection for mesothelial cell: a) PAI-in Western Blot after 48h 1 and tPA detection, b) tPA/PAI-1 ratio, as the function of time.Utilize l-PEI N/P than for 10(based on pDNA measure) feelings Under condition in HBS preparation include pCMV-tPA-IRES-Luc(ptPA) or control plasmid (pUC) and difference siRNAs(PAI-1, EGFP) polycomplex.For comparing, the expression of display untreated cell (UN).Western is passed through at different time Blot determines tPA-and the PAI-1 level in supernatant.

Figure 12 shows the schematic diagram of pCMV-tPA-IRES-Luc plasmid.

Figure 13 shows l-PEI/pDNA polycomplex diluent series in PBS.

Figure 14 shows the standard curve of buman tPA antigenic analysis.

Figure 15 shows the Transfection efficiencies of the polycomplex of the powder type using different cryoprotective agent: lyophilizing l-PEI/ PDNA polycomplex is for the Transfection efficiencies of pneumonocyte system, and (A) uses different cryoprotective agent (10%(m/v) sucrose or manna Sugar, 4%(m/v) glucosan 5000), B) after the homogenizing of lyophilizing polycomplex, use 10%(m/v) sucrose is as cold Freeze protective agent.

The present invention by further example, but is not in any way restricted in this by the following example:

Embodiment 1

Material and method

Nucleic acid

Plasmid pCMVLuc, can acquisition as described in [19], it comprises Lampyridea Photinus under the control of a cmv promoter The luciferase gene (Luc) of pyralis, promoter is from cytomegalovirus.Equally, under the control of CMV promoter, build Luciferase gene secreting type luciferase [20] of body pMetLuc coding Marine copepod Metridia longa.

Cloned construct pCMV-tPA-IRES-Luc, and be schematically illustrated in Figure 12.Except luciferase (Luc) and outside the sequence of tissue-specific plasminogen activity factor (tPA), its also include CMV promoter (CMV-IE, big and small Cellular virus-at once-in early days).

Utilize pIRES-Luc carrier cloning pCMV-tPA-IRES-Luc plasmid [21].By utilizing restricted enzyme MluI and FseI(New England Biolabs Inc., USA), under the control of CMV promoter, tissue specificity will be encoded The sequence of plasminogen activating factors (tPA) is cloned in this carrier.Therefore, matter is expanded by polymerase chain reaction (PCR) The sequence (insert) [22] of grain pCMV-tPA.In addition to luciferase gene, pIRES-Luc carrier also comprises internal ribosome and enters Angle of striking (IRES), this internal ribosome entry site makes it possible to translate independently of each other transcript.

PUC21 carrier (Invitrogen, Germany), it is without expression cassette and only comprises bacterial backbone, with comparing matter Grain.

Synthesis following oligonucleotide: use for the siRNA(PAI-1 of plasminogen activating factors inhibitor 1,5 '- GGAACAAGGAUGAGAUCAG [4,23]-3 '), and as comparison, use for EGFP siRNA(5 '- GCAAGCUGACCCUGAAGUUCAU [dT] [dT]-3 ').The sample of lyophilizing is dissolved in resuspension buffer with 20 μMs (Qiagen) neutralization is dissolved in 100 μMs of stock solutions for releasing research, and incubation 1.5min at 90 DEG C is shaken gently at 37 DEG C 1h, and store with equal portions at-20 DEG C.

Polymine

According to the formula of [24] such as Plank, synthesis molal weight is the L-PEI of 22kDa.It is similar to this join Side, by the poly-(2-ethyl-2-of propionic acidOxazoline) 50Da acidic hydrolysis obtain linear PEI, the propanoic acid quilt wherein discharged Extract out from synthesis batch as azeotropic mixture continuously so that reaction can run its course the most completely.Subsequently, by free alkali Precipitated under pH12 by sodium hydroxide, washing lyophilizing.The l-PEI of lyophilizing is stored at 4 DEG C, and as needed, is dissolved in In distilled water, regulate the pH value to 7.4, dialyse (ZelluTrans dialyzer T2, MWCO8-10kDa), and carry out aseptic filtration.

Utilizing copper sulfate to test, under 285nm, on spectrophotometer (Ultrospec3100Pro), photometry is quantitative PEI solution [25].The l-PEI batch of concentration known is used as reference.Pass through¹H-NMR POP (Bruker250MHz, Karlsruhe) purity of synthetic product is detected.Utilize multiple angle laser light scattering detector (GPC-MALLS), pass through gel infiltration Chromatography, measures molal weight, and demonstrates the molal weight of 20-22kDa.

PLGA polymer

Following polymers, from Boehringer Ingelheim company, Germany, for the preparation of film:

·502,503 and 504H

·752,755S

Cell line

Use ATCC, Germany(CRL-9444) pleural mesothelial cell (people), in short Met5A.By cell line 37 ℃、5%CO₂With under 100% humidity in M199(Gibco-BRL, Great Britain) and MCDB105(Sigma-Aldrich, Germany) 1:2 mixture is cultivated.Except 10% hyclone (PPA Laboratories, Austria) outward, also by epidermis Somatomedin (5ng/ml, Sigma-Aldrich, Germany) and hydrocortisone (400ng/ml, Sigma-Aldrich, Germany) culture medium [26] is added.Additionally, by the passage in about 80% junction, and for the test in up to 20 generations.

The preparation of polycomplex

The formation of complex is spontaneously carried out by electrostatical binding power.The character of the polycomplex formed substantially depends on In the ionic strength of culture medium, polymer used and N/P ratio.The latter represents protonation nitrogen-atoms (N) and the core of polymer architecture The mol ratio of the electronegative phosphorus atoms (P) in acid.For obtaining small-sized monodispersity granule, isopyknic have relatively low charge density Solution nucleic acid solution, move into pipet and there is the solution polymer solution of higher charge density, and by moving Liquid pipe adds and removal carries out mixing (5 to 8 times).Subsequently, by solution incubation 20 minutes in room temperature (rt), then carry out into one Pacing tries.Water for injection (siRNA, plasmid DNA lyophilized products) and HBS pH7.4(plasmid-DNA liquid) it is used as medium.

The preparation of the polycomplex of powder type and sign

In water for injection, polycomplex is prepared, as mentioned above with N/P Billy pCMVLuc and l-PEI of 10.For surveying Try different cryoprotection materials, by polycomplex after incubation period with 20%(m/v) sucrose solution, 20%(m/v) mannose Solution or 4%(m/v) glucosan 5,000 solution 1:2 dilution, mixing, and decile.Then can by equal portions quick freeze in liquid nitrogen, And under the peak power of freeze dryer lyophilizing about 24h.By lyophilized products in various media resuspended floating to 0.02 μ g/ μ l Final concentration (equal initial concentration), and the BEAS-2B cell in 96 orifice plates is transfected, its mode is similar to hereafter institute State.

After the incubative time of 10min, add the sucrose of powder type, and by complex incubation 10min again, wherein adding Particle size is controlled by PCS with before and after sucrose.After freeze drying, can homogenize in band pestle mortar powder, subsequently profit With homogenizer, with glass pestle cylindrical glass container (Sch ü tt Labortechnik, Germany) or pass through(level 3,14sec, Ika Labortechnik, Germany), is suspended in PLGA solution.Optional Ground, is resuspended in water for injection after powder is directly resuspended in water for injection or is homogenized in mortar.By lyophilized products The resuspended ultimate density floating to 0.02 μ g/ μ l in each medium.

Determine particle size and zeta potential

By in the half miniature cuvette of double steaming solution (0.02 μ g/ μ l pDNA) with 600 μ l polycomplexs Photon correlation spectroscopy, determine the hydrodynamics cross section of polycomplex, there is 1.6ml polycomplex solution (respectively Be 0.02 and 0.1 μ g/ μ l pDNA) big cuvette in by the zeta potential of electrophoretic light scattering.Apply following setting: measure for 5 times (dimensional measurement), 5 operations (zeta potential) of each sample every 10 cycles；Water viscosity (0.89cP) and/or HBS(1.14cP)；Folding Penetrate rate 1.33；Dielectric constant 78.5；Temperature 25 DEG C.Zeta potential is calculated according to Smoluchowski.Enter on the basis of standard curve Row Size Evaluation.By the polystyrene rubber granule of a size of 92nm (Duke Scientific Cooperation, CA, USA) and the zeta potential of charged+50mV is with reference to Bl-LC-ZRZ(Laborchemie, Vienna, Austria), make regular check on equipment.

Agarose gel electrophoresis

Agarose gel electrophoresis is utilized to may determine that the nucleic acid (plasmid DNA, mRNA) Compound Degree in polycomplex. Therefore, as it has been described above, combine with 6 times of load buffers concentrated, prepare polycomplex, and 100ng pDNA is applied respectively In 0.8% agarose gel containing ethidium bromide (10 μ g/100 μ l).Corresponding dimension mark is used as reference.Delay at 1 × TAE Rush and liquid carries out under 125V electrophoresis about 1.5h.Subsequently, under UV light (360nm), detect nucleic acid belt, and by gel phase Machine shoots.

In agarose gel, can based on gel middle reaches freestone acid existence with stay in gel pockets (gel pocket) Polycomplex identification is the most compound.Further, it is possible to the signal intensity from gel pockets draws the knot about condensation level Opinion.Following applicable: band is the most weak, and the nucleic acid being condensed by cationic polymer is the most.By adding polyanion (0.1 μ g sulphuric acid Heparan (HS)/μ g pDNA, incubative time 45min), remove nucleic acid from complex, and nucleic acid integrity degree can be checked (topological structure, degraded).

Embodiment 2

The sign of the film being formed in situ

Film quality is determined according to biomaterial and solvent

Formed for film can be further characterized according to solvent for use and polymer type, spray in petri diss Test.To this end, prepare 10%(m/v in each solvent) polymer solution, and under 1.5bar, spray 1ml polymer solution respectively (syringe 1) and 1ml water for injection (syringe 2).The waiting time of 5min means to allow substrate to be formed completely.For carrying out base The visual inspection of matter, dyes aqueous phase light blue G, and by the distance with jeting surface to being set to 11cm.Carry out without fixing Test further, because it is possible to obtain the film of more homogenizing.Result shows in the diagram.

For can preferably evaluate substrate quality, supernatant is removed, and at vacuum systems (Speed-Vac, Dieter Piatkowski, Germany) in be dried, until constant weight.Similarly, by substrate freeze dryer (Lyovac GT2, LH Leybold, Germany) in be dried, until constant weight.Then can determine in supernatant based on the total consumption of polymer The polymer content of (substrate quality) in (loss) and precipitation.

Determine the tissue tolerance of solvent

The cytotoxicity of solvent is determined by analysis based on ATP (ATPlite, Perkin Elmer).24h before analysis Cell is inoculated in 96 orifice plates, the most at once removes medium, with PBS washed cell once, and add 50 μ l containing serum Medium, wherein adds antibiotic (penicillin/streptomycin 0.1%(v/v)；Gentamycin 0.5%(v/v), Gibco-BRL, Great Britain).Then, add every kind of different solvents concentration (16-500 μ g/ μ l) that 50 μ l dilute in water for injection, and 37 ℃、5%CO₂With the time (15,30,60,221,360 and 640min) of incubation different length under 100% humidity.After incubation period, By medium sucking-off, with PBS washed cell once, 50 μ l PBS are added in every hole, and determine cell survival according to the explanation of manufacturer Power.Plate reader (Wallac Victor2/1420Multilabel Counter, PerkinElmer Inc., USA) is surveyed Amount luminosity, wherein the luminosity of untreated cell (50 μ l water for injection) is used as 100% viability reference value.For each time Point, draws solvent strength for the cell viability (meansigma methods ± standard deviation runs from n=4) measured, and uses non-thread Property canonical function:

y=min+[(max-min)/(1+(x/EC50)^{Hill slope (Hillslope)})]

This function all demonstrates good regulation for whole solvents: tetraethylene glycol (TEG) (R2=0.9181-0.9900), glycerol acetonide Formaldehyde (R2=0.9268-0.9945), dimethyl isosorbide (R2=0.9647-0.9894).LD₅₀Be derived from being drawn returns Return the estimated value of curve.It is that can to record cell viability be still the concentration residing for 50%.

The viscoelasticity of the film being formed in situ

For understanding the viscoelasticity of substrate, carry out rheology test.Therefore, film is injected in rotating cylinder viscometer (Physica MCR301) on plate, and dynamic shearing test according to solvent for use test biomaterial (RG504H and 502H).Here, put on sample by having the resonance shear stress limiting amplitude and frequency, and determine that the shearing of gained becomes Shape its characterized by two response parameters, response amplitude and response frequency, it is also referred to as phase shift.Two response parameters are equal Can be converted into storage modulu G` and loss modulus G`` by mathematical method, wherein storage modulu characterizes the kinetic energy and/or change introduced Storage share in shape energy, is therefore reusable share (elastic share)；And loss modulus is owing to vibration is with hot shape The tolerance of the energy of formula release, is therefore the share (friction share) lost.

Determine the test of release dynamics

At 37 DEG C, in closed petri diss (petri diss, without absorbent 50 × 9mm, PAll), carry out Determine the test of release dynamics, wherein shake continuously in incubation case.Therefore, by water for injection, sample is sprayed as mentioned above Penetrate.Before by the l-PEI/pCMVLuc complex (N/P ratio 10,10% sucrose, 25 μ g pDNA/ preparations) of lyophilizing with the shape that homogenizes Formula (mortar and pestle) is dispersed in PLGA solution, or is resuspended in aqueous phase.Water for injection is with comparing.After the injection, wait 5min, removes it supernatant (0h value) and adds 1ml PBS.Then regular complete exchange supernatant, wherein sample be stored in- At 20 DEG C, until analyzing.

By photometry quantitatively from the plasmid DNA of the substrate release being formed in situ.For this purpose it is proposed, extract with chloroform before measuring Take sample (1ml, 400g, RT, 10min) to separate the PLGA catabolite [27] that photometry will be disturbed quantitative.Pass through subsequently By photometric measurement sample (Nanodrop-1000, PEQLAB Biotech, Germany) under 260nm.In the preproduction phase, L-PEI/pDNA polycomplex (pDNA concentration 100 μ g/ml) is generated in water for injection, and under 5 independent skies are at 260nm Determining the standard series of the stepwise dilution liquid diluted with PBS, the release that can calculate complex plasmid DNA the most on this basis is dense Degree.Result shows in fig. 13.As comparison, analyze unsupported film (background correction), by weighing sample on the basis of water density Product consider a small amount of volume deviation.

Embodiment 3

Analyzed in vitro

Transfection

For carrying out in-vitro transfection research, 90,000 to 120,000 cell (24 orifice plate) of 24h every hole inoculation before transfection. Only will be used for transfecting to the cell in the 20th generation.This junction causing transfecting the same day about 70%.Before transfection at once, medium is removed, will Cells rinsed with PBS once, and adds 200 μ l(24 orifice plates) serum-free medium.Subsequently, by corresponding for 50 μ l polycomplexs Plasmid DNA amount (24 orifice plate) in 1 μ g adds medium.At 37 DEG C, 5%CO₂After 4h incubation period under 100% humidity, remove Polycomplex, washed once with PBS again by cell, and is replaced by containing serum medium, wherein add antibiotic (penicillin/ Streptomycin 0.1%(v/v), gentamycin 0.5%(v/v), Gibco-BRL, Great Britain).

The realization of injection test

Preparation L-PEI/ plasmid DNA polycomplex (N/P ratio 10,100 μ g pDNA/ preparation), is utilized as mentioned above 10% sucrose lyophilizing, and make it homogenize by mortar and pestle so that it can be given by weight, or warp before being dispersed in Cross in the PLGA solution of aseptic filtration, or be resuspended in aqueous phase (water for injection).Non-additive water for injection is used as feminine gender Comparison.PMetLuc and pCMV-tPA-IRES-Luc applies with equivalent, as plasmid DNA.

Test first 3 days, Met5A cell is inoculated in the suspension insert with polyethylene terephthalate-(PET) film On (1 μm PET Millicell), its permission controls cell by optical microscope.Each offer 1.5ml cell culture medium, makes Insert balances 2min wherein, is inoculated on the film in 1.5ml culture medium (medium) by 250,000, every hole cell subsequently. Before testing, remove culture medium, washed once with PBS, and sample is ejected on cell, as mentioned above.Initially, carry out every day Sampling, sampling in the most every two to three days, and change culture medium completely.Sample is placed directly within ice, and at being stored in-80 DEG C, Determine until analyzing.

Transfection efficiencies is determined by uciferase activity measurement result

For the pCMVLuc plasmid analysis gene transfer efficiency by utilizing encoding reporter gene luciferase, after transfection 24h is by measuring uciferase activity as follows: with PBS washed cell once, 100 μ l1 × cell lysis buffer solution is added in every hole (25mM Tris/HCl pH7.8,0.01%Triton-X100), and under RT after 10min incubative time, shaken 60sec. Subsequently, can automatically add 100 μ l fluorescein substrates (470 μMs of D-fluoresceins, 270 μMs of coenzyme, 33.3mM DTT, 530 μMs ATP, 1.07mM(MgCO₃)₄Mg₂×5H₂O, 2.67mM MgSO₄, 0.1mM EDTA0.1mM, 20mM tricin) to 50 μ l etc. Part, and at plate reader (Wallac Victor²/ 1420Multilabel Counter, PerkinElmer Inc., USA) in Measure the luminescence of 5sec time.Before adding substrate, determine the background of 5sec time equally.Will be to launch photon (light list relatively Position, RLU) after the time of background correction 10sec and total protein concentration based on cell quality is whole for the uciferase activity measured Close.It is determined by standard protein analysis (according to the method for Biorad) before total protein.

Transfection efficiencies is determined by the expression of Metridia luciferase

The most external injection test utilizes l-PEI/pMetLuc and l-PEI/pIRES-Luc-tPA polycomplex Mixture is carried out.The luciferase of the plasmid-encoded emiocytosis of pMetLuc, Metridia luciferase, therefore, it is possible to pass through sample Expression of enzymes in product supernatant measures gene transfer efficiency.Luciferase catalytic fluorometry element is coelenterazine in the present case Oxidative deamination, simultaneously launch wavelength 482nm light.In the sample time selected, pass through Ready-To-Glow Automation Kit(Clontech, A Takara Bio Company, France) analyze sample by by it at ice Upper defrosting, and according to the explanation of manufacturer at plate reader (Wallac Victor²/ 1420Multilabel Counter, PerkinElmer Inc., USA) in measure the luminescence of 5sec time and need not previously dilute.Before adding substrate, determine equally The background of 5sec time so that uciferase activity (RLU value) can after background correction the time of integrated 10sec, and respectively Individual negative control can be subtracted from this value.Untreated cell serve as bolus give (in water for injection full pDNA amount single to Give) negative control, and unsupported film be used as matrix system negative control.

Tissue plasmin total concentration is determined by ELISA

In the sample selected, in addition to determining uciferase activity, also by ELISA(Human tPATotal Antigenassays, Innovative Research, Dunn Labortechnik GmbH, Germany) determine cell conditioned medium Tissue plasmin total concentration in liquid.Used analysis not only detects free and the most active tPA, also detects it and combines Potential form in inhibitor.Owing to supernatant derives from cell culture, similar with the cell culture medium sample with cell used Mode dilution standard product without FCS in the case of.Positive control (bolus gives) dilution is as follows: 1:50(48h, 9d), 1: 10(16,23 and 29d).Sample from interior room is supplied (30 μ l samples add to 100 μ l), and analyze in the case of undiluted Sample from mistress.Analyze and carry out according to the explanation of manufacturer, and at plate reader (Wallac Victor²/ 1420Multilabel Counter, PerkinElmer Inc., USA) in measure under 450nm, the absorbance of 0.1sec time. Standard curve shows in fig. 14.The use of negative control is described above.

Fluorescence microscope images

After injection test completes, remove culture medium, and will be left in the plasmid DNA propidium iodide stain in substrate.For This, under RT in the PBS diluent of 1:10 incubation substrate and propidium iodide 10min, again wash with PBS before picture shooting Wash, and utilize epifluorescence microscope (Axiovert135, Carl Zeiss, Jena, 10x lens) to shoot picture.Propidium iodide Excitation carry out under 470 ± 20nm, and be transmitted under 540 ± 25nm detection.Software Axiovision LE4.5 is utilized to carry out Evaluate, and utilize Alexa560nm filter to be analyzed at light field (Brightfield) place.

Embodiment 4

SiRNA and the cotransfection of plasmid DNA and determine tPA/PAI-1 ratio by Western blotting

As above transfect in 24 orifice plates, but have some distinguishing characteristicss.In each case, 750ng plasmid DNA is used It is 10 to carry out being combined (based on plasmid DNA amount) with 30pmol siRNA with l-PEI with N/P ratio.Culture medium is changed after 6h. After transfection, by western blot analysis protein, i.e. tissue-specific plasminogen activity factor and Class1 fibrinolysin Former activity factor inhibitor (PAI-1).Owing to protein is secretary protein, it can be detected in cell supernatant, Make to remove the 20 each cell supernatants of μ l at different time points, the sample (n=3) of every kind of prepared product is merged, and Centrifugal 10min at 14.000rcf and 4 DEG C, to separate dead cell.Sample is stored on ice all the time, and cold at-20 DEG C Freeze, until final analysis.

Protein is made to be separated according to its molal weight by SDS-polyacrylamide gel electrophoresis (SDS-PAGE).It is broken Two grades of bad egg's white matter and tertiary structure, prepared product (3.75 μ l samples, 15 μ l4 × load buffer (130mM Tris/HCl PH7.4,20% glycine, 10%SDS, 0.06% bromophenol blue, 4%DTT) add 60 μ l waters for injection), degeneration at 95 DEG C the most 5min.By the 20 each prepared products of μ l by electrophoresis 7.5%Tris-HCl gel (Bio-Rad Laboratories GmbH, Germany) upper separation, and electrotransfer (1h, 200mA transfer buffer) is to Kynoar (PVDF) film.After trace, cut Cut film, for together with various first antibodies incubation, at 50Da(dimensional standard, exact value adds protein standards) under, and RT, In the case of being shaken gently for, block buffer (5% milk powder, at 20mM Tris/HCl pH7.4,137mM NaCl, In 0.1%Tween20) middle blocking-up nonspecific proteins binding site 1h.With the incubation of first antibody at 4 DEG C, with being shaken gently for In the case of overnight carry out (mice anti-α-actin 1:15,000Chemicon, Germany；Mice anti-huPAI-1 Dan Ke Grand 1:200American Diagnostics, Germany；Mouse-anti-hutPA monoclonal 1:400Calbiochem, Germany, Dilution at 1:10 blocks in buffer).About detection, apply at 1:10,000 diluent (tPA, PAI-1) or 1:20,000 Second antibody in diluent (actin) (in conjunction with goat-anti-mouse HRP, Bio-Rad Laboratories, Germany), and by film at RT, with incubation 1.5h in the case of being shaken gently for.Subsequently, ECL chemiluminescence can be passed through (Amersham Bioscience, USA) detection membrane (Amersham Hyperfilm ECL, GE Healthcare, Germany) On labelled protein, and carry out quantitative analysis by Image J Basics Version1.38.Based on untreated cell Actin bands makes value standardization.

Statistical evaluation

Unless otherwise indicated, result is given with meansigma methods ± standard deviation.Show by means of non-paired t test computational statistics Write difference.Assume that significance,statistical is respectively at α=0.05(*) or α=0.01(**).

The relevant parameter that appropriate solvent selects is i) medicine relevance grade, ii) good organization's tolerance level, the iii) miscible degree of water, Iv) polymer dissolubility in a solvent.Based on these parameters, select some solvents for screening further.

Being widely used in and using the solvent of injectable storage system is tetraethylene glycol (TEG) (tetrahydrofurfuryl alcohol Polyethylene Glycol), also referred to as sugar Protoplasm [28,29].Since the sixties, tetraethylene glycol (TEG) is the most with up to 50%(v/v) concentration be used as parenteral solvents (vein, muscle), and under this dilution factor, only show hypotoxicity [30].

Glycerol formal is tasteless solvent, has hypotoxicity equally, by 1, and 3-bis-Alkane-5-alcohol and 1,3-dioxolanes- Mixture composition [30] of 4-methanol.It is the fine solvent of multi-medicament and cosmetics.Recently, it is mainly used in veterinary drug, makees For injection solvent.Such as, Ivomec^TM0.27% subcutaneous administration being approved for pig, and apply [31] with 0.1ml/kg.

About dimethyl isosorbide (DMI) and ethyl lactate, almost without any research set up at solvent compatible In property.Ethyl lactate is used as the parenteral suitable carrier of anabolic agent, and does not consider its GRAS number, be considered to have with Toxicity and slight hemolysis that anesthetis is relevant are active.DMI is mainly locally used as penetration enhancers, and it is observed gently equally Micro-hemolytic activity [30,34].Additionally, the research of Matschke etc. can show, glyceride has good toleration, is PLGA/ The appropriate solvent [33] of PLA polymer.To this end, test triacetin, have hypotoxic short chain triglyceride [35, 36], it is described the most, as an alternative the alternative of NMP and DMSO, for the preparation extending release being formed in situ [29,37-39].

Film quality is determined according to solvent for use

The important prerequisite condition forming the storage system being formed in situ is polymer dissolubility in a solvent.At document In, assume that based on PLGA the dissolubility of the system that is formed in situ is at least 10%(m/v) [40].Different PLGA polymer are molten typical case Dissolubility data in agent such as NMP and DMSO and in ethyl lactate is collected [41].Respectively study display, polymer molten Xie Du increases with molal weight and reduces.Additionally, the water yield needed for in-situ precipitate and polymer dissolubility in solvent for use Relevant.Polymer dissolubility in solvent for use is the best, forms the water needed for storing substrate the most.On the contrary, the water yield of needs Increase with polymer content and reduce.

First preparation and dissolubility test utilize Model PolymersRG503H is carried out.In order to more preferably visualize, Aqueous phase blue dyes light blue dyes.For whole test solvent, 10%(m/v can be prepared) polymer solution.But film, About the incorporation in substrate of stability, homogeneity and aqueous phase, demonstrate clearly difference the most visually.Result exists in display In Fig. 4.Visible, in the case of triacetin is as solvent, it is impossible to enough to realize homogeneous membrane, contrary formation is clearly visible W/O emulsion.Other solvents all cause film to be formed, and wherein the incorporation of aqueous phase is dramatically different.Based on color substrates, the incorporation of aqueous phase Reduce according to following order: triacetin≤ethyl lactate < < tetraethylene glycol (TEG) < glycerol formal～DMI.

If, with aqueous phase incorporation in the polymer matrix in the LogP value comparison diagram 4 of each solvent, will clearly deposit At the dependency of film quality Yu the water solubility of solvent for use, it is characterized by polymer low-loss in supernatant.Must be false If triacetin and ethyl lactate, as lipophilic solvent (XlogP > 0), the miscible degree of its water is less than another solvent, therefore The failure film quality of soluble substrate.Therefore, the solution for great lipophilic PLGA polymer will only consider these solvents. Possibly, solvent mixture is more suitable for.Although injection can not be generated in the case of the test setting utilizing triacetyl glycerol Film, but ethyl lactate causes the most inhomogeneous porous membrane structure, the most only can mix very small amount dyestuff.On the contrary, sweet when using When oil formal, DMI or tetraethylene glycol (TEG), form film in situ.Therefore, if it can, preferably XlogP value is the solvent less than 0.

For can preferably evaluated for film quality, determine by returning title (backweighing) dry matrices in injection test (loss) and the amount of polymers of (implant) in precipitating in amount supernatant.When drawing solvent partition coefficient P for substrate quality, As shown in Figure 4 B, find that film quality is the linear function of the miscible degree of aqueous solvent.Chart clearly illustrates, substrate is formed can be with solvent The miscible degree of water increases and improves.<under the P value of 0.25, the polymer volume of about 80% is impregnated in substrate.

About test further, test and the different polymer of solvent glycerin formal, DMI and tetraethylene glycol (TEG) combination.Three second Acyl glyceride is not studied further owing to failure film is formed, ethyl lactate due to unstable and porous heterogeneity membrane structure also And not studied further due to its strong hemolytic activity.

The tissue tolerance of solvent

Additionally, the impact that the solvent of research 11 hours sections is on metabolizing cells viability.Metabolizing cells viability is passed through Cell ATP value determines, cell ATP value is the tolerance of viability.In the case of material has acute toxicity, under this value is rapid Fall, therefore, it is possible to identify the tissue tolerance of solvent.Fig. 5 show all test solvent by the LD of measuring and calculation₅₀Value, as temperature Educate the function of time.

The toleration of solvent reduces according to following order: glycerol formal > > DMI > tetraethylene glycol (TEG).At LD₅₀Value is about 1g/ml's In the case of, under the incubative time less than 6h, glycerol formal demonstrates the minimum toxicity in test solvent.Sweet with DMI and four Alcohol is compared, and this shows that toleration raises 220 times and 400 times at the end of test respectively.

Embodiment 5

Biological material analysis

The biomaterial analyzed is the biodegradable copolymer of lactic acid and glycolic, poly-(D, Pfansteihl-copolymerization-ethanol Acid) (PLGA) polymer, from Boehringer Ingelheim(trade name), it is used by FDA approval In parenteral administration.

The dependency of the polymer of substrate quality and selection

As it has been described above, the polymer content percentage ratio that can mix film changes according to the water solubility of solvent for use.Similar Ground, will utilize different polymer research substrate quality in more detail.Owing to about test polymer, tetraethylene glycol (TEG) can not be steamed Send out, the most not data of this solvent.Fig. 2 shows the result of the polymer with following composition: (a) PLA/PGA50:50, tool There is free acidic group (H series)；(b) PLA/PGA75:25, has esterification end group (S series).Due to its higher lactic acid content and Esterification end group, the latter is than H series more lipotropy.

Sample chart, in the case of polymer molar quality is higher, all has relatively large polymer to be incorporated in two series Enter substrate.This effect is significant for DMI in H series, and is all significant for two kinds of solvents in S series.When Use glycerol formal andDuring 755S, almost the polymer volume of 100% forms substrate (97.6 ± 0.6%).

The comparison of series of polymers and test solvent combination shows, compared with H series and with in two series of polymers DMI compares, and glycerol formal is lost reduction by 20% with the polymer volume of S series.These results can be again by two kinds of solvents The miscible degree of different water explain, it causes polymer different solubilities in a solvent, and the power learning aid forming film Have a significant impact.Although two series all can be soluble in DMI, but S series is insoluble in glycerol formal compared with H series.The latter shows Strong expansion performance is shown.Therefore, it is necessary to it is assumed that S series in glycerol formal is configured proximate to the body of solubility limit System.In conjunction with the miscible degree of good water of glycerol formal, this causes film quickly and completely to be formed.

The viscoelasticity of the film being formed in situ

In dynamic shearing is tested, the viscoelasticity of analyzing film.To this end, should by having the oscillatory shear limiting amplitude and frequency Power puts on sample, and determines the detrusion of gained, and it characterizes also referred to as phase shift again by amplitude and frequency.This Two kinds of response parameters can be converted into storage modulu G` and loss modulus G`` by mathematical method subsequently, and wherein storage modulu characterizes Storage share in the kinetics introduced or strain energy of distortion, is therefore reusable share (elastic share), and mould is lost Amount is the tolerance owing to vibrating the energy discharged in the form of heat, therefore constitutes the share (viscosity share) lost.In figure 3, H system Two modulus of the different films of row are shown at the driving frequency of 1Hz.

When being compared to each other elasticity and the viscosity share of two kinds of films, obtain the viscoelastic personality that different solvents is the most different Sensitivity.Although in the case of 502H film, viscoelasticity can by select suitable solvent (maximum factor: be respectively 29(G`) and 22(G``)) rather broadly regulated, but 504H film is demonstrated that rheology shows, and unrelated with solvent for use.The latter shows Go out the mechanical strength [46] of 2 to the 4kPa of the meat fiber (8 to 17kPa) that can be equal to, and there is the main damage based on elasticity Consumption factor (G`/G``) > 1 so that in testing these films behave like solid.Unique exception is DMI, its original position film Based on viscosity, its loss factor is 0.85.Thickness > 500 μm these films with502H film is compared relatively thick (DMI:500 μm, glycerol formal: 600 μm, tetraethylene glycol (TEG): 800 μm).The latter is at the plate vertical spread of flow graph, and only demonstrates The thickness of 300 μm, and unrelated with solvent for use.

Based onThe loss factor of the film of 502H all < 1, and demonstrate that gel sample shows, between solvent Notable strength difference is apparent.Only in the case of tetraethylene glycol (TEG), can realize film-strength can be equal to504H, its Loss factor is 0.79.The intensity respectively 130 and DMI of 900Pa and glycerol formal are not even roughly the same, Er Qiexian Illustrate that notable viscosity is main performance (loss factor > 0.5).

Embodiment 6

The preparation of the film being formed in situ

Based on the experience from the injection test carried out, have developed such preparation: include i) PLGA polymer, molten In one in the used three kinds of solvents of Xie Yu, ii) aqueous phase, and iii) plasmid DNA, as model active agents.In theory, The plasmid DNA of " exposed " and complex form can be impregnated in substrate.But, due to " exposed " plasmid DNA the most relatively inefficient transfect Cell, before embedding film, plasmid DNA is compound (N/P ratio 10) with l-PEI, and as nanoscale polycomplex doped matrix. By so, it still prevents Medium Culture pH and declines, and pH declines and occurs to pass through polymer during polymer architecture is degraded Monomer is released in substrate, and typically comprises the problem [47] of sensitivity macromole.

Polycomplex can be impregnated in as follows stromatolysis in aqueous phase [44] or be dispersed in PLGA solution [28, 45].But, it has been found that directly add a small amount of water (about 5%) in utilizing the preliminary test as an example of PLGA/ tetraethylene glycol (TEG) system Polymer can be caused to precipitate.Therefore, in the case of jet film high capacity, need to use high concentration plasmid DNA solution, but, High concentration plasmid DNA solution has low stability and easily forms aggregation.Therefore, protein formulation [28,45] it is similar to In PLGA solution, disperse the polycomplex as lyophilized products or to be resuspended in aqueous phase before use be favourable.Logical Often, preparation composition is as follows:

1) lipophilic phase (1ml): the 10%(m/v in glycerol formal, tetraethylene glycol (TEG) or DMI) PLGA polymer (502H, 504H)

2) aqueous favoring (1ml): water for injection

3) activating agent: the lyophilizing polycomplex being resuspended in lipotropy or aqueous favoring

The polycomplex preparation of powder type

In pharmaceutical industry, lyophilizing is one of standard method of stabilization formulations during storing.By molecule is embedded assistant In agent substrate, can during drying stabilization formulations.Depend on being dried phase, different protective agents can be used.Therefore, cryoprotective agent Prevent solution from crystallizing in refrigerating process.System is solidified into subcooling films, and be separated the most completely (solidification liquid, glass). On the contrary, freeze drying protectant provides the protection in the progress further of refrigerating process.It replaces activating agent under the formation of hydrogen bridge Key with water.

Polycomplex also can be lyophilized under adding cryoprotective agent and freeze drying protectant so that after can preventing resuspension Aggregation formed [48,49].As lyophilized products, polycomplex preferably can be stored [48], and up to 1mg/ml The solution concentration of plasmid DNA concentration becomes possible [50].Sugar, such as sucrose or trehalose, serves as freeze drying protectant and cryoprotection Agent, and have been observed that and be suitably stable for polycomplex [48,49].The water-soluble substances similar to it can promote big point further Sub-activating agent discharges based on PLGA film from be formed in situ.During substrate is formed, the hole that water is filled is dissolved due to these materials And produce, can be spread from substrate subsequently by this hole activating agent.About the similar effect of substrate high capacity be described [27, 33]。

The different sugar [48,49] of the concentration that test uses in standard base.Polycomplex based on l-PEI is being frozen It is resuspended to after Gan in water for injection, does not homogenizes, and test its transfection effect to human bronchial epithelial cell Power.Realizing good transfection efficiency under each concentration applied together with disaccharide sucrose, its effect is compared with brand-new polycomplex Increase by 10 times.Result shows in fig .15.Suitable value was described by [48] such as Talsma.Can expect that may result in granule exists More than the only 2 times concentration of osmotic effect mixing increase in cell [50].But, particle size measures display, and particle size exists It is slightly increased after lyophilizing.The particle size of the granule of brand-new is～100nm, and depends on disperse medium used, and granule is freezing 200-300nm is grown at PI < 0.2 time after Gan.

For the polycomplex of powder type can be used and mixed preparation, should be equal in mortar after freeze drying by it Matter and pass through Ultra-Turrax(UT) or glass homogenizer (H) be dispersed in PLGA solution.Tested by transfection and agar Sugar gel electrophoresis analysis polycomplex stability after homogenization and the subsequently resuspension in water for injection.To pneumonocyte The test result of system shows to homogenize and does not changes Transfection efficiencies (Figure 15 B).Add the plasmid DNA topology under Heparan sulfate right According to also without the difference (Fig. 7) demonstrated in water for injection between lyophilizing polycomplex.

For all three process for dispersing (UT, homogenizer dissolve), it is resuspended in the sample in water for injection (untreated) Similar band figure is all demonstrated with those polycomplexs passing through homogenize (grinding in mortar) before resuspension.With right Compare according to not compound plasmid DNA, the most all observe lax form (relaxed form) slightly Increase.For water for injection, the degraded of plasmid DNA is inconspicuous.

As an example, glycerol formal shows as solvent.The band that untreated or before homogenizing sample compares with water Do not find differences between figure.Utilize homogenizer as process for dispersing, the most unchanged be observed.Utilize Ultra-Turrax, PDNA mainly stays in gel pockets with complex form.Here, for untreated samples, compared with another sample, can detect that two The most weak individual band.It should be noted, however, that when using equivalent Heparan sulfate, under the influence of glycerol formal, the biggest Amount pDNA stays in bag with complex form.About the UT sample homogenized, gel is observed slightly stain；But, heavy at this Shen, the plasmid DNA without pieces is destroyed and can be observed.

Embodiment 7

Determine the release dynamics of the plasmid-DNA polycomplex of preparation

Activating agent in theory can from polymeric matrix diffusion, (diffusion be leading due to i) activating agent from being released in of implant Release) or the erosion (corrode leading release) [51,52] of ii) substrate.About activating agent from bulk erosion polymers substrate Release, such as the situation of PLGA system, describes a phase or two according to drug loading, polymer molar quality used and polymer concentration Phase release characteristic [53,54].

Additionally, the initial release of activating agent can occur, precipitate completely even up to polymer.Mole matter according to polymer Amount, solvent for use and incorporation select, the release dynamics of the film that test is formed in situ.Test following combination:

1. lipophilic phase (1ml):502H or 504H10%(m/v), be dissolved in glycerol formal, tetraethylene glycol (TEG) or In DMI

2. aqueous favoring (1ml): water for injection

3. activating agent: the polycomplex (l-PEI/pDNA) of lyophilizing, homogenize form

After freeze drying, polycomplex is homogenized in mortar, and be resuspended in aqueous favoring (mix and select A) or logical Cross homogenizer and be dispersed in lipotropy PLGA solution (mix and select B).502H and 504H uses different solvents Two kinds incorporation select release characteristics show in figure 6.

Figure line shows: figure (A):502H, the polycomplex in aqueous favoring；Figure (B): RG502H, lipophilic mutually in polycomplex；Figure (C):504H, the polycomplex in aqueous favoring, figure (D):504H, lipophilic mutually in polycomplex.

When observation polycomplex mixes film by being dissolved in aqueous favoring in the ban, it may be clearly seen that polymer used Molal weight and the solvent for use appreciable impact (Fig. 6 A, C) on release dynamics.Utilize DMI as solvent, combination short chain polymerization Thing502H, activating agent can not be impregnated in (Fig. 6 A).During polymer precipitates, the polycomplex of 100% is just It is released.But, utilize longer chain polymer504H, it is achieved that general biphase release.This includes The release (stage 1, spill release characteristic) that initial propagations is leading, then corrodes leading release (stage 2, linear kinetics) (Fig. 6 C).To this end, it is readily apparent that when using DMI, the most all realize the highest initial release, its basis Mix selection and polymer chain length and change between 10% to 100%.

On the contrary, glycerol formal shows low initial release, spreads leading release the most slowly.Only along with matrix erosion Start to corrode, it was observed that polycomplex accelerated release in vitro, it depends on that the chain length of polymer used is respectively after 15 and 26 days Start.But, film based on tetraethylene glycol (TEG) shows, at 32%(respectively502H) and 50%( After medium initial release 504H), observe time frame in medium to zero release.Only in the situation of longer chain polymer Under, there is the low release (Fig. 6 C) caused after 26 days due to matrix erosion.

But, when (mixing and select B) during polycomplex being dispersed in lipotropy PLGA solution, whole polymer/solvent The polycomplex initial release rate of combination and the diffusion from substrate all reduce, and release is substantially carried out corroding leading releasing Put (Fig. 6 B, D).Test solvent demonstrates the similar release profiles that varying strength postpones that has, and wherein rate of release is according to following Order increases: tetraethylene glycol (TEG) < < glycerol formal < DMI.Although the release characteristic of DMI and glycerol formal appears clearly from short chain The erosion rate of 502H polymer is shorter than long-chain 504H polymer (the 17th day-ratio-the 29 day), but in the case of tetraethylene glycol (TEG), Due to the strong delay of substrate, between polymer, zero difference can be observed (5.4%-is than-8.8% cumulative release after 30 days).

In a word, DMI demonstrates the fastest release for whole combinations of long-chain or short chain polymer and different incorporation selection. The release continuously of up to 100% activating agent release is available504H, real by incorporating active agents into aqueous favoring Existing.Mix the release that the polycomplex display of film based on tetraethylene glycol (TEG) is dominated without diffusion.Observe time interim, in initial release After, the additionally pDNA amount of releasable up to 14%, wherein initial release changes between 0 and 48%.Mixing the situation selecting A Under, it is of a relatively high, and when polycomplex be dispersed in lipophilic mutually in time, can be observed without initial release.Based on glycerol acetonide The film of formaldehyde demonstrates low initial release, and unrelated with embedding grammar；But, even if when using these films, polycomplex The most only can be released by matrix erosion after 23 days.

Embodiment 8

Analyze in-vitro transfection effect

First release in vitro feature is determined as it has been described above, by utilizing reporter gene luciferase to carry out.At these On the basis of data and dosage form require, selective polymer504H, DMI is as solvent in combination, comes for film.Two Plant activating agent and will be impregnated in the aqueous favoring of substrate with lyophilized form.By preliminary test, it is contemplated that the activating agent initial release of 55%. This can largely facilitate adhesion region after surgery use cover Post operation acute stage (the 2nd to 5 day) [79-81].But, Here, the non-physiology of tPA concentration should be avoided to increase, because can increase peritoneum oozes out (bleeding) risk.Alternatively, survey Try by504H and the film without initial release of glycerol formal composition.Reaffirming at this, polycomplex is dissolved in parent In aqueous phase.First with activating agent 1 analyzed in vitro preparation, this activating agent 1 and l-PEI are incorporated in lyophilizing under interpolation 10% sucrose again.Separately Outward, with 1:1 form of mixtures use coding by the pMetLuc plasmid of the luciferase of emiocytosis, as comparison.

About the testing in vitro in cell analysis, mesothelial cell (Met5A) is made to grow on insert, and subsequently will polymerization Thing film is ejected on cellular layer.Hole can be divided into dual chamber system by the application of insert, and wherein mistress and Nei room are equivalent to peritoneum Original position dissect, constant mass exchange can be carried out between it so that cell can be supplied from top side and bottom side with medium.Carefully Born of the same parents' form is controlled by optics by optical microscope, but on film, injection causes it to have difficulties.Can divide by utilizing insert Analyse the expression of reporter gene luciferase through 30 day time in two Room.

Figure 10 shows room.Give in water for injection, wherein use complete plasmid DNA dosage with bolus, and without Delivery systme is compared, and the film being formed in situ demonstrates that luciferase level reduces by 10³To 10⁴Times.Gene expression is described above Carry out.At these about in the research of release dynamics, the film on DMI basis demonstrates the initial release of 56%pDNA consumption, and In further process, until within the 26th day, demonstrating the release of further 38%.According to this release characteristic, for DMI basis For film, have been observed that gene expression increases after 2 days, after again 7 days, drop to base value, and increased again by the 23rd day To medium value.On the contrary, when glycerol formal is used as solvent, gene expression is in biphase middle generation, and without at the beginning of polycomplex Begin to discharge.After 10 days before express the most medium increase of speed control, further maximum, Qi Zhongji can be observed after 23 days Twice is increased because expressing.Low molecular weight fraction instruction in cell culture medium starts to corrode.

Including glycerol formal andThe tPA of the substrate of 504H expresses display in Figure 10 A with independent The film (inactive film) of medicament and inactive dose compares.It is similar to luciferase expression, without activating agent independent of storage system Medicament produces high protein level in the time through 29 days, and wherein tPA concentration increases by 100 to 40 times compared with base value.Class As concentration Recomposed tPA (alteplase) in intraperitoneal gives blood plasma realize [82] afterwards.Therefore, can be real by matrix formulations Existing value presents and is in close proximity to physiological condition.For blood plasma and peritoneal fluid, the free tPA-antigen concentration of 4 to 6ng/ml Being described [82-84], additionally the meansigma methods of 1.3ng/ml tPA is restricted to PAI-1 [84].Surprisingly, by inactive Film use the value being slightly increased, wherein when release starts by active membrane (there is the activating agent of embedding) with inactive Film is compared and is realized 4 times of increases.This effect is until walking flat on the 16th day, and is down to base value in 2ng/ml, tPA level.This is assumed It is because the following fact: (seeing the 7.3rd chapter) can be released by the 15th day from substrate almost without more polycomplexs.Surveying At the end of examination, substrate is not corroded completely so that embeds polycomplex and can be detected (Figure 10 B) in jet film.

Embodiment 9

The tissue plasmin concentration caused by common application siRNA and pDNA is increased

The outer tPA concentration increase of born of the same parents caused by using tPA encoding plasmids successfully can show on mesothelial cell.Hereafter How many tPA/PAI-1 can be realized than increase by using the siRNA of anti-PAI-1 simultaneously by analyzing.

Research before is it has been shown that l-PEI is primarily adapted for internal using siRNA and plasmid DNA [23].Therefore, by pDNA/ SiRNA/l-PEI polycomplex in HBS with N/P than 10(based on pDNA concentration) prepare, and testing needle is to PAI-1 not Same siRNA sequence.The tPA/PAI-1 of different pDNA/siRNA combinations is than display in fig. 11.SiRNA sequence used is just In pacing examination, under optium concentration 0.12 μM, most effective suppression PAI-1 expresses the siRNA sequence of (PAI-1A).48h after transfection, TPA/PAI-1 in the case of jointly using increases by 8 times than compared with untreated cell.By pDNA or combination NOT function are administered alone Energy property siRNA(EGFP siRNA) use pDNA, the most only can realize 4 times and 5 times increases.When using control plasmid (pUC), Find that siRNA causes tPA/PAI-1 ratio to increase by 2 times.

Embodiment 10

The application system in Baxter company is set up in the research and development of the film being formed in situ controlling release for polycomplex On the basis of, as shown in Figure 8.Therefore, double syringe system is loaded with lipophilic ingredients (syringe 1) and includes being dissolved in Biodegradable polymer in machine solvent, and aqueous components (syringe 2) water for injection.The pDNA/l-PEI of lyophilizing Polycomplex is used as activating agent.These can be subsequently dispersed in lipophilic mutually in or be dissolved in aqueous favoring.About release dynamics, Mix selection to two kinds to be analyzed, as mentioned above.

Embodiment 11

In cell viability is tested, glycerol formal shows the optimal compatibility on mesothelial cell.Here, measure LD₅₀Value is the highest 200 and 400 times compared with DMI and tetraethylene glycol (TEG).Under the incubation period of 6h, these retain about 1g/ml, i.e. when making During with about 780 μ l pure glycerin formal, the mesothelial cell of 50% is dead.Data in literature disclose in rodent body vein to Give the comparable LD of rear DMI and glycerol formal₅₀Value, and the toxicity of tetraethylene glycol (TEG) is high 2 to 3 times.By manufacturer about for animals Anti-parasite medicineInformation, after intravenous administration 50% glycerol formal solution, 4 to 4.8g/kg body weight can be obtained The LD of (mice)₅₀.It is similarly to the EMA in the symposium of Committee for Veterinary Products [85] Description.After vein gives DMI, acute toxicity is only minimally different from glycerol formal.By using 40%DMI etc. Ooze saline solution (v/v) LD afterwards₅₀For 5.4g/kg body weight (rat) after using 20% solution and LD₅₀(little for 6.9g/kg body weight Mus), DMI seems preferably to be tolerated after vein gives.Since the sixties, tetraethylene glycol (TEG) is with up to 50%(v/v) Concentration is used as parenteral solvents (vein, muscle), and is classified as nonirritant under this dilution factor.LD₅₀Without dilute For 3.8g/kg body weight (mice) after being given by vein in the case of releasing, less than the description [86] for other two kinds of solvents.

List of references

[1]Rosenberg SA,Aebersold P,Cornetta K,Kasid A,Morgan RA,Moen R,et al.Gene transfer into humans--immunotherapy of patients with advanced melanoma,using tumor-infiltrating lymphocytes modified by retroviral gene transduction.N Engl J Med.1990;323:570-578.

[2]Edelstein ML,Abedi MR,Wixon J.Gene therapy clinical trials worldwide to2007--an update.J Gene Med.2007;9:833-842.

[3]Gene Therapy Clincial Trials Worlwide.Journal of Gene Medicine; 2009.

[4]Seisenberger G,Ried MU,Endress T,Buning H,Hallek M,Brauchle C.Real-time single-molecule imaging of the infection pathway of an adeno- associated virus.Science.2001;294:1929-1932.

[5]Godbey WT,Mikos AG.Recent progress in gene delivery using non- viral transfer complexes.J Control Release.2001;72:115-125.

[6]Lee RJ,Huang L.Lipidic vector systems for gene transfer.Crit Rev Ther Drug Carrier Syst.1997;14:173-206.

[7]Simoes S,Filipe A,Faneca H,Mano M,Penacho N,Duzgunes N,et al.Cationic liposomes for gene delivery.Expert Opin Drug Deliv.2005;2:237- 254.

[8]Nishikawa M,Takakura Y,Hashida M.Pharmacokinetics of Plasmid DNA- Based Non-viral Gene Medicine.Adv Genet.2005;53PA:47-68.

[9]Pack DW,Hoffman AS,Pun S,Stayton PS.Design and development of polymers for gene delivery.Nat Rev Drug Discov.2005;4:581-593.

[10]Pannier AK,Shea LD.Controlled release systems for DNA delivery.Mol Ther.2004;10:19-26.

[11]Elfinger M,Uezguen S,Rudolph C.Nanocarriers for Gene Delivery- Polymer Structure,Targeting Ligands and Controlled-Release Devices.Current Nanoscience.2008;4:322-353.

[12]Packhaeuser CB,Schnieders J,Oster CG,Kissel T.In situ forming parenteral drug delivery systems:an overview.Eur J Pharm Biopharm.2004;58: 445-455.

[13]Hatefi A,Amsden B.Biodegradable injectable in situ forming drug delivery systems.J Control Release.2002;80:9-28.

[14]Dadey EJ.The Atrigel Drug Delivery System.In:Rathbone MJ,Hadgraft J,Roberts MS,Lane ME,editors.Modified-release drug delivery technology.2ed.New York:Informa Healthcare USA,Inc.;2008.p.183-190.

[15]Chen G,Junnarkar G.Alzamer Depot Bioerodible Polymer Technology.In:Rathbone MJ,Hadgraft J,Roberts MS,Lane ME,editors.Modified- release drug delivery technology.2ed.New York:Informa Healthcare USA,Inc.; 2008.p.215-225.

[16]Brodbeck KJ,DesNoyer JR,McHugh AJ.Phase inversion dynamics of PLGA solutions related to drug delivery.Part II.The role of solution thermodynamics and bath-side mass transfer.J Control Release.1999;62:333-344.

[17]Graham PD,Brodbeck KJ,McHugh AJ.Phase inversion dynamics of PLGA solutions related to drug delivery.J Control Release.1999;58:233-245.

[18]Fried I,Traitel T,Goldbart R,Shmilowitz D,Wolfson M,Kost J.Cancer gene therapy using pH-sensitive polyplexes released from an injectable PLGA implant.In:Society CR,editor.33rd Annual Meeting of the Controlled Release Society Vienna,Austria:Controlled Release Society2005.p.598.

[19]Plank C,Zatloukal K,Cotten M,Mechtler K,Wagner E.Gene transfer into hepatocytes using asialoglycoprotein receptor mediated endocytosis of DNA complexed with an artificial tetra-antennary galactose ligand.Bioconjug Chem.1992;3:533-539.

[20]Markova SV,Golz S,Frank LA,Kalthof B,Vysotski ES.Cloning and expression of cDNA for a luciferase from the marine copepod Metridia longa.A novel secreted bioluminescent reporter enzyme.J Biol Chem.2004;279:3212-3217.

[21]Sakata Y,Yoshioka W,Tohyama C,Ohsako S.Internal genomic sequence of human CYP1A1gene is involved in superinduction of dioxin-induced CYP1A1 transcription by cycloheximide.Biochem Biophys Res Commun.2007;355:687-692.

[22]Sakamoto T,Oshima Y,Nakagawa K,Ishibashi T,Inomata H,Sueishi K.Target gene transfer of tissue plasminogen activator to cornea by electric pulse inhibits intracameral fibrin formation and corneal cloudiness.Hum Gene Ther.1999;10:2551-2557.

[23]Bonnet ME,Erbacher P,Bolcato-Bellemin AL.Systemic delivery of DNA or siRNA mediated by linear polyethylenimine(L-PEI)does not induce an inflammatory response.Pharm Res.2008;25:2972-2982.

[24]Orgris M,Wagner E.Linear polyethylenimine:Synthesis and transfection procedures for in vitro and in vivo.In:Friedman T,Rossi J, editors.Gene Transfer:Delivery and Expression of cDNA and RNA,A Laboratory Manual:Cold Spring Habor Laboratory Press;2007.p.521-528.

[25]Ungaro F,De Rosa G,Miro A,Quaglia F.Spectrophotometric determination of polyethylenimine in the presence of an oligonucleotide for the characterization of controlled release formulations.J Pharm Biomed Anal.2003;31:143-149.

[26]Arbeiter K,Bidmon B,Endemann M,Bender TO,Eickelberg O, Ruffingshofer D,et al.Peritoneal dialysate fluid composition determines heat shock protein expression patterns in human mesothelial cells.Kidney Int.2001; 60:1930-1937.

[27]Csaba N,Caamano P,Sanchez A,Dominguez F,Alonso MJ.PLGA:poloxamer and PLGA:poloxamine blend nanoparticles:new carriers for gene delivery.Biomacromolecules.2005;6:271-278.

[28]Eliaz RE,Kost J.Characterization of a polymeric PLGA-injectable implant delivery system for the controlled release of proteins.J Biomed Mater Res.2000;50:388-396.

[29]Chern RZ,J.Liquid polymeric compositions for controlled release of bioactive agents.In:Patent U,editor.2004.

[30]Mottu F,Laurent A,Rufenacht DA,Doelker E.Organic solvents for pharmaceutical parenterals and embolic liquids:a review of toxicity data.PDA J Pharm Sci Technol.2000;54:456-469.

[31]Lifschitz A,Pis A,Alvarez L,Virkel G,Sanchez S,Sallovitz J,et al.Bioequivalence of ivermectin formulations in pigs and cattle.J Vet Pharmacol Ther.1999;22:27-34.

[32]Cheng T,Zhao Y,Li X,Lin F,Xu Y,Zhang X,et al.Computation of octanol-water partition coefficients by guiding an additive model with knowledge.JChem Inf Model.2007;47:2140-2148.

[33]Matschke C,Isele U,van Hoogevest P,Fahr A.Sustained-release injectables formed in situ and their potential use for veterinary products.J Control Release.2002;85:1-15.

[34]Mottu F,Stelling MJ,Rufenacht DA,Doelker E.Comparative hemolytic activity of undiluted organic water-miscible solvents for intravenous and intra-arterial injection.PDA J Pharm Sci Technol.2001;55:16-23.

[35]Jain RA.The manufacturing techniques of various drug loaded biodegradable poly(lactide-co-glycolide)(PLGA)devices.Biomaterials.2000;21: 2475-2490.

[36]Jain RA,Rhodes CT,Railkar AM,Malick AW,Shah NH.Controlled release of drugs from injectable in situ formed biodegradable PLGA microspheres: effect of various formulation variables.Eur J Pharm Biopharm.2000;50:257-262.

[37]Chandrashekar G,Udupa N.Biodegradable injectable implant systems for long term drug delivery using poly(lactic-co-glycolic)acid copolymers.J Pharm Pharmacol.1996;48:669-674.

[38]Singh UV,Udupa N.In vitro characterization of methotrexate loaded poly(lactic-co-glycolic)acid microspheres and antitumor efficacy in Sarcoma- 180mice bearing tumor.Pharm Acta Helv.1997;72:165-173.

[39]Bleiberg B,Beers TR,Persson M,Miles JM.Metabolism of triacetin- derived acetate in dogs.Am J Clin Nutr.1993;58:908-911.

[40]Dunn R,English J,Cowsar D,Vanderbilt D.Biodegradable in-situ forming implants and methods for producing the same.In:Patent U, editor.US1994.

[41]Shively M,Coonts B,Renner W,Southard J,Bennett A.Physico-chemical characterization of a polymeric injectable implant delivery system.J Control Release.1995;33:237-243.

[42]Sitter T,Toet K,Quax P,Kooistra T.Fibrinolytic activity of human mesothelial cells is counteracted by rapid uptake of tissue-type plasminogen activator.Kidney Int.1999;55:120-129.

[43]Elfinger M,Maucksch C,Rudolph C.Characterization of lactoferrin as a targeting ligand for nonviral gene delivery to airway epithelial cells.Biomaterials.2007;28:3448-3455.

[44]Eliaz RE,Szoka FC,Jr.Robust and prolonged gene expression from injectable polymeric implants.Gene Ther.2002;9:1230-1237.

[45]Eliaz RE,Wallach D,Kost J.Delivery of soluble tumor necrosis factor receptor from in-situ forming PLGA implants:in-vivo.Pharm Res.2000;17: 1546-1550.

[46]Engler AJ,Sen S,Sweeney HL,Discher DE.Matrix elasticity directs stem celllineage specification.Cell.2006;126:677-689.

[47]Capan Y,Woo BH,Gebrekidan S,Ahmed S,DeLuca PP.Influence of formulation parameters on the characteristics of poly(D,L-lactide-co- glycolide)microspheres containing poly(L-lysine)complexed plasmid DNA.J Control Release.1999;60:279-286.

[48]Talsma H,Cherng J,Lehrmann H,Kursa M,Ogris M,Hennink WE,et al.Stabilization of gene delivery systems by freeze-drying.Int J Pharm.1997; 157:233-238.

[49]Cherng JY,vd Wetering P,Talsma H,Crommelin DJ,Hennink WE.Stabilization of polymer-based gene delivery systems.Int J Pharm.1999;183: 25-28.

[50]Anchordoquy TJ,Armstrong TK,Molina MC.Low molecular weight dextrans stabilize nonviral vectors during lyophilization at low osmolalities:concentrating suspensions by rehydration to reduced volumes.J Pharm Sci.2005;94:1226-1236.

[51]Fan L,Singh S.Controlled release:a quantitative treatment1989.

[52]Goepferich A.Mechanisms of polymer degradation and elimination.Handbook of biodegradable polymers1997.p.451-471.

[53]Goepferich A,Sieh L,Langer R.Aspects of polymer erosion.Materials Research Society Symposium Proceedings1995.p.155-160.

[54]Ramchandani M,Robinson D.In vitro and in vivo release of ciprofloxacin from plga50:50implants.J Control Release.1998;54:167-175.

[55]Menzies D.Peritoneal adhesions.Incidence,cause,and prevention.Surg Annu.1992;24Pt1:27-45.

[56]Hellebrekers BW,Trimbos-Kemper TC,Trimbos JB,Emeis JJ,Kooistra T.Use of fibrinolytic agents in the prevention of postoperative adhesion formation.Fertil Steril.2000;74:203-212.

[57]DeCherney AH,diZerega GS.Clinical problem of intraperitoneal postsurgical adhesion formation following general surgery and the use of adhesion prevention barriers.Surg Clin North Am.1997;77:671-688.

[58]Ellis H,Moran BJ,Thompson JN,Parker MC,Wilson MS,Menzies D,et al.Adhesion-related hospital readmissions after abdominal and pelvic surgery: a retrospective cohort study.Lancet.1999;353:1476-1480.

[59]Parker MC,Ellis H,Moran BJ,Thompson JN,Wilson MS,Menzies D,et al.Postoperative adhesions:ten-year follow-up of12,584patients undergoing lower abdominal surgery.Dis Colon Rectum.2001;44:822-829;discussion829-830.

[60]Holmdahl L,Risberg B.Adhesions:prevention and complications in general surgery.Eur J Surg.1997;163:169-174.

[61]Brokelman W,Holmdahl L,Falk P,Klinkenbijl J,Reijnen M.The peritoneal fibrinolytic response to conventional and laparoscopic colonic surgery.J Laparoendosc Adv Surg Tech A.2009;19:489-493.

[62]Cheong YC,Laird SM,Li TC,Shelton JB,Ledger WL,Cooke ID.Peritoneal healing and adhesion formation/reformation.Hum Reprod Update.2001;7:556-566.

[63]Ivarsson ML,Bergstrom M,Eriksson E,Risberg B,Holmdahl L.Tissue markers as predictors of postoperative adhesions.Br J Surg.1998;85:1549-1554.

[64]Treutner KH,Schumpelick V.[Prevention of adhesions.Wish and reality].Chirurg.2000;71:510-517.

[65]Rout UK,Saed GM,Diamond MP.Expression pattern and regulation of genes differ between fibroblasts of adhesion and normal human peritoneum.Reprod Biol Endocrinol.2005;3:1.

[66]Kumar S,Wong PF,Leaper DJ.Intra-peritoneal prophylactic agents for preventing adhesions and adhesive intestinal obstruction after non- gynaecological abdominal surgery.Cochrane Database Syst Rev.2009:CD005080.

[67]Ahmad G,Duffy JM,Farquhar C,Vail A,Vandekerckhove P,Watson A,et al.Barrier agents for adhesion prevention after gynaecological surgery.Cochrane Database Syst Rev.2008:CD000475.

[68]Binda MM,Hellebrekers BW,Declerck PJ,Koninckx PR.Effect of Reteplase and PAI-1antibodies on postoperative adhesion formation in a laparoscopic mouse model.Surg Endosc.2009;23:1018-1025.

[69]Farquhar C,Vandekerckhove P,Watson A,Vail A,Wiseman D.Barrier agents for preventing adhesions after surgery for subfertility.Cochrane Database Syst Rev.2000:CD000475.

[70]Diamond MP.Reduction of de novo postsurgical adhesions by intraoperative precoating with Sepracoat(HAL-C)solution:a prospective, randomized,blinded,placebo-controlled multicenter study.The Sepracoat Adhesion Study Group.Fertil Steril.1998;69:1067-1074.

[71]Gago LA,Saed GM,Chauhan S,Elhammady EF,Diamond MP.Seprafilm (modified hyaluronic acid and carboxymethylcellulose)acts as a physical barrier.Fertil Steril.2003;80:612-616.

[72]Mettler L,Audebert A,Lehmann-Willenbrock E,Schive K,Jacobs VR.Prospective clinical trial of SprayGel as a barrier to adhesion formation: an interim analysis.J Am Assoc Gynecol Laparosc.2003;10:339-344.

[73]Dunn R,Lyman MD,Edelman PG,Campbell PK.Evaluation of the SprayGel adhesion barrier in the rat cecum abrasion and rabbit uterine horn adhesion models.Fertil Steril.2001;75:411-416.

[74]Fazio VW,Cohen Z,Fleshman JW,van Goor H,Bauer JJ,Wolff BG,et al.Reduction in adhesive small-bowel obstruction by Seprafilm adhesion barrier after intestinal resection.Dis Colon Rectum.2006;49:1-11.

[75]Yagmurlu A,Barlas M,Gursel I,Gokcora IH.Reduction of surgery- induced peritoneal adhesions by continuous release of streptokinase from a drug delivery system.Eur Surg Res.2003;35:46-49.

[76]Yeo Y,Bellas E,Highley CB,Langer R,Kohane DS.Peritoneal adhesion prevention with an in situ cross-linkable hyaluronan gel containing tissue- type plasminogen activator in a rabbit repeated-injury model.Biomaterials.2007;28:3704-3713.

[77]Hill-West JL,Dunn RC,Hubbell JA.Local release of fibrinolytic agents for adhesion prevention.J Surg Res.1995;59:759-763.

[78]Ferland R,Mulani D,Campbell PK.Evaluation of a sprayable polyethylene glycol adhesion barrier in a porcine efficacy model.Hum Reprod.2001;16:2718-2723.

[79]diZerega GS,Campeau JD.Peritoneal repair and post-surgical adhesion formation.Hum Reprod Update.2001;7:547-555.

[80]Menzies D,Ellis H.The role of plasminogen activator in adhesion prevention.Surg Gynecol Obstet.1991;172:362-366.

[81]Harris ES,Morgan RF,Rodeheaver GT.Analysis of the kinetics of peritoneal adhesion formation in the rat and evaluation of potential antiadhesive agents.Surgery.1995;117:663-669.

[82]Hellebrekers BW,Trimbos-Kemper TC,Boesten L,Jansen FW,Kolkman W, Trimbos JB,et al.Preoperative predictors of postsurgical adhesion formation and the Prevention of Adhesions with Plasminogen Activator(PAPA-study): results of a clinical pilot study.Fertil Steril.2009;91:1204-1214.

[83]Ince A,Eroglu A,Tarhan O,Bulbul M.Peritoneal fibrinolytic activity in peritonitis.Am J Surg.2002;183:67-69.

[84]Nordenhem A,Wiman B.Tissue plasminogen activator(tPA)antigen in plasma:correlation with different tPA/inhibitor complexes.Scand J Clin Lab Invest.1998;58:475-483.

[85]products Cfvm.Glycerol Formal:Summary Report.In:Agency EM, editor.:EMA;1996.

[86]Spiegel AaN,MM.Use of non-aqueous solvents in parenteral products.J Pharm Sci.1963;52:917-927.

[87]Ramchandani M,Robinson D.In vitro and in vivo release of ciprofloxacin from PLGA50:50implants.J Control Release.1998;54:167-175.

[88]Goepferich A,Shieh L,Langer R.Aspects of polymer erosion.Materials Research Society Symposium Proceedings1995.p.155-160.

[89]Lambert WJ,Peck KD.Development of an in situ forming biodegradable poly-lactide-co-glycolide system for controlled release of proteins.J Control Release.1995;33:189-195.

[90]Leuneberger H.Physikalische Pharmazie:Wissenschaftliche Verlagsgesellschaft;2002.

Claims (21)

1. for generating the injection system of the substrate being formed in situ, including

A) at least one lipophilic ingredients, it includes at least one polymer based on glycolic and lactic acid, and XlogP3 value is little In at least one biocompatible solvent of 0.2, and

B) at least one hydrophilic component,

Wherein said at least two component exists the most separated from one anotherly, and is only mixed for injection or mixed when injection Closing, wherein said component forms film when being ejected into people's tissue.

Injection system the most according to claim 1, it is characterised in that it farther includes activating agent, described activating agent quilt Dissolve and/or be dispersed in the one in the two component or in two kinds of components.

3. according to injection system in any one of the preceding claims wherein, it is characterised in that described lipophilic ingredients includes PLGA polymer and the biocompatible solvent of described PLGA polymer.

4. according to injection system in any one of the preceding claims wherein, it is characterised in that described biocompatible solvent XlogP3 value is 0.2 to-1.0.

5. according to injection system in any one of the preceding claims wherein, it is characterised in that described biocompatible solvent selects From tetraethylene glycol (TEG), dimethyl isosorbide and/or glycerol formal.

6. according to injection system in any one of the preceding claims wherein, it is characterised in that the LD of described solvent₅₀It is at least 1mg/ml。

7. according to injection system in any one of the preceding claims wherein, it is characterised in that described polymer is poly-(D, L-third Lactide-co-Acetic acid, hydroxy-, bimol. cyclic ester) polymer, wherein the ratio of lactide and Acetic acid, hydroxy-, bimol. cyclic ester is 25:75 to 75:25；And/or described polymer Be intrinsic viscosity angle value be the PLGA of 0.16 to 0.70dl/g；And/or described PLGA polymer measured by gel permeation chromatography Molal weight be 10 to 63kDa.

8. according to injection system in any one of the preceding claims wherein, it is characterised in that PLGA and biocompatible solvent It is selected so that every 100 parts of solvents dissolve 5 to 60 parts of PLGA.

9., according to injection system in any one of the preceding claims wherein, it is characterised in that described hydrophilic component is water, appoint Selection of land, wherein dissolves or disperses activating agent.

10. according to injection system in any one of the preceding claims wherein, it is characterised in that the described film formed after the injection It it was 2 to 6 weeks at the described degradation rate using site.

11. according to injection system in any one of the preceding claims wherein, it is characterised in that described activating agent includes at least one Plant nucleic acid.

12. according to the injection system described in aforementioned claim, it is characterised in that it nucleic acid including encoding fibrinolytic factor.

13. injection system according to claim 12, wherein said fibrinolytic factor is tPA.

14. according to injection system in any one of the preceding claims wherein, it is characterised in that described activating agent includes suppression fibre The material of plasminogen activator inhibitor.

15. according to the injection system described in aforementioned claim, it is characterised in that the material of the described PAI of described suppression is siRNA。

16. according to injection system in any one of the preceding claims wherein, it is characterised in that described nucleic acid and carrier mass one Rise and be present in complex；Described carrier mass is the carrier mass with positively charged group.

17. injection system according to claim 16, wherein said carrier mass is polymine.

18. according to injection system in any one of the preceding claims wherein, it is characterised in that the film of described formation shows biphase Release dynamics.

19. according to injection system in any one of the preceding claims wherein, it is characterised in that it includes that N/P ratio is 1 to 10 Polycomplex.

20. according to injection system in any one of the preceding claims wherein, it is characterised in that it include tPA coding DNA and PAI inhibitor, its ratio is 5:1 to 1:5.

21. according to injection system in any one of the preceding claims wherein, and it, for using on peritoneum, is specifically used for preventing Only surgical adhesions and cicatrization.