CN103923933A - Reconstruction method for cellulosome gene and obtained novel cellulase - Google Patents

Abstract

The invention relates to a reconstruction method for a cellulosome gene and a new enzyme obtained through gene reconstruction, in particular relates to a gene reconstruction method based on a cellulosome and a monomeric enzyme of clostridium thermocellum and a novel lignocellulose hydrolase produced through gene reconstruction, and belongs to the field of gene engineering and enzyme engineering. A dockerin in a monomeric enzyme peptide chain of the cellulosome is excided through a gene reconstruction technology to reduce redundant components, and a CBD on a scaffolding protein is grafted to a molecule of the monomeric enzyme by a short chain to obtain a novel independent enzyme which has different molecular structures, can be independently bound with a substrate and has high activity compared with the monomeric enzyme; the invention further establishes an over-expression technology of the new enzyme. The novel cellulase NcelD without depending on a cellulosome structure is successfully obtained; the CMC hydrolysis activity and stability of the novel cellulase NcelD are improved obviously compared with a natural monomeric enzyme CelD; the NcelD coding gene obtained through gene reconstruction is subjected to soluble over-expression in a pHsh system.

Description

The reconstruction method of cellulase body gene and the novel cellulose enzyme of acquisition

affiliated technical field:

The present invention relates to a kind of reconstruction method of cellulase body gene and reconstruct the new enzyme obtaining by gene, the monomeric enzyme that is specifically related to a kind of cellulase body taking Clostridium thermocellum and it is basic gene reconstruction method, and the novel wooden fiber hydrolase of gene reconstruction generation, belong to genetically engineered and enzyme engineering field.

background technology:

Wood fibre is the supporting tissue of earth plant, and main component is by photosynthesis carbohydrate, is the natural resources enriching very much.Meanwhile, a lot of microorganisms of nature and phytophagy animal can produce a series of enzymes wood fibre is hydrolyzed, thereby form the important step of nature Carbon cycle.In hydrolyzing lignocellulose, the main enzyme of cellulose components comprises cellulase, Mierocrystalline cellulose excision enzyme, cellobiase and b-glucuroide etc.Cellulase is b-1, the abbreviation of 4 endoglucanases; The catalyzed reaction of cellulase is the rate-limiting step in cellulose hydrolysis.

Cellulase tool in cellulose utilization and processing has been widely used.In paper industry, cellulase is important biological catalyst in the deinking of waste paper is processed, and can increase the strength property of paper pulp simultaneously, the energy expenditure while significantly reducing mechanical jordaning before machinery pulping with cellulase pre-treatment; In textile industry, utilize cellulase to the processing of scraping of polishing of cotton fabric and BLENDED FABRIC thereof, can make the hardness of fabric suitably decline, degree of dangling, rebound resilience and the pliability of fabric are improved; As fodder additives, cellulase can improve the quality of silage, strengthens the absorption of body to nutritive substance, improves the Fermentation Function of cud, thereby increases the quality that increases day by day of animal body, improves milk yield and milk quality, increases economic efficiency.Cellulase also has been widely used in food-processing and herbal medicine processing and other fields in addition.But the cellulosic structure densification that plant produces, has very strong resistivity to the attack of cellulase; All natural cellulose enzymes of finding so far all can only, with limited speed, be hydrolyzed natural crystalline cellulose lentamente.

Clostridium thermocellum ( clostridium thermocellum) be a kind of thermophilic anaerobic bacterium; It can produce at cell surface the multienzyme polymer of a kind of hydrocellulose and hemicellulase, i.e. cellulase body (cellulosome).Owing to deriving from thermophilic bacterium and having the synergy of plurality of enzymes, the stability of cellulase body better, the apparent activity of degraded cellulose is very high.Therefore in decades, cellulase body has attracted large quantities of scholars to study it.The structure of cellulase body is fully resolved: there is 1 scaffolding protein at cellulase Ti center, has individual cellulose binding domain (CBD) and multiple adhesions territory (cohesin) in its peptide chain; On the support of cellulase body, adsorb the monomer of plurality of enzymes, comprising cellulase, zytase etc.; In the peptide chain of each monomeric enzyme, all there is one section of conservative sequence, be called grappling territory (dockerin), monomeric enzyme synthesized respectively and be secreted into cell surface after combine with the adhesion territory on support with grappling territory, thereby form the polymer of plurality of enzymes.Cellulase body is attached on cellulose fibril it is cleared up by CBD.Various of monomer enzyme in cellulase body is attached to 1 support and shares with 1 cellulose binding domain (CBD), and this structure is unfavorable for producing by gene overexpression.

In today of molecular biotechnology high development, we find that the production of cellulase body has its fatal weakness: it is thermophilic anaerobic bacterium that (1) cellulase body produces bacterium, culture condition harshness, and cell density is low, and the efficiency of enzymatic production is very low; (2) cellulase body is by multiple genes encodings, and total molecular mass exceedes 2000 kDa, is difficult to carry out in-vitro recombination expression; (3) cellulase body contains nearly 20 kinds of different monomeric enzymes, and wherein many monomers are not that cellulose hydrolysis is necessary, goes back the activity of some monomeric enzyme not as good as the same fermentoid in other sources, thereby, produce the waste that these monomeric enzymes are bio-energies; (4) in cellulase body, the activity of various monomeric enzymes depends on the CBD on support, and the catalytic activity of leaving monomeric enzyme after support declines.

summary of the invention

Object of the present invention:

Each monomer in cellulase body is all by genes encoding independently, and these genes can be produced by the high efficient expression restructuring of gene allos.But there is no the effect of the cellulose binding domain (CBD) of scaffolding protein, the activity of recombinase can not be given full play to, and now on subunit grappling territory also become unnecessary.The technical problem solving is to set up a kind of method of the monomeric enzyme in cellulase body being carried out to molecule reconstruction, the monomeric enzyme that depends on scaffolding protein in cellulase body is built into independent enzyme, obtain the novel wooden fiber hydrolase that biological activity obviously improves, and make new enzyme obtain allos soluble overexpression, form high yield technique.

Technical scheme:

The technical solution used in the present invention is to pass through gene recombination technology, grappling territory in the monomeric enzyme peptide chain of excision cellulase body with reduce redundant component, with 1 short chain by the CBD grafting on scaffolding protein to the molecule of monomeric enzyme, obtain there is different molecular structures, can independent bound substrates, than the high novel independent enzyme of monomeric enzyme activity.The technical program is applied to, is still not limited to the molecule reconstruction of CelD in cellulase body in the present invention.

Monomeric enzyme CelD(cellulase D in cellulase body) be the most well-known the highest cellulase of activity, by gene celDcoding.Use technical scheme pair of the present invention celDgene is reconstructed rear generation novel cellulose enzyme NcelD.The molecular characterization of NcelD peptide chain: without with cellulase body support frame albumen on the grappling territory of adsorbing mutually, adhesion territory, with 1 section of CBD that links small peptide, has grafting; Functional character: be can cellulose-binding independent enzyme, do not need not in conjunction with scaffolding protein yet, cellulolytic specific activity nature monomeric enzyme CelD has improved 66%; Production technology: use the gene efficient expression carrier (U.S. patent of invention US 7,807,460 B2) of autonomous invention, the encoding gene of NcelD intestinal bacteria ( e. coli) in realize soluble overexpression.

Experiment material required for the present invention and source:

Clostridium thermocellum (ATCC 27405) is purchased from U.S.'s Bacterial Strains Managing preservation center, and carries out cell cultures according to ATCC guide.The extraction of DNA of bacteria, pcr amplification and the clone etc. of gene carry out (Sambrook and Russell, 2001, CSHL Press, Cold Spring Harbor, New York) according to the standard method in " molecular cloning handbook " third edition.In this experiment, cloning host bacterium used is e. colidH10B, expressive host bacterium is e. colibL21.From ncbi database, obtain cellulase body upper bracket protein gene sequence (GenBank accession No. L08665.1) and monomeric enzyme celD, celSgene order (GenBank accession No. X04584.1; , and the sequential structure such as signal peptide of these genes of on-line analysis, grappling territory, CBD L06942.1).The expression vector pHsh adopting is referring to U.S. patent of invention US 7,807,460 B2 pertinent literatures, and its gene order is referring to gene pool data (GenBank accession No. FJ571619); Wherein the expression of target gene is subject to sigma 32 type promoter regulations.

Concrete operation step is as follows:

(1) target gene clone: according to Clostridium thermocellum cellulase (CelD) gene order (GenBank accession No. X04584.1 in ncbi database, SEQ ID NO.1) design and synthesize primer, in the primer of upstream and downstream, introduce respectively restriction enzyme enzyme recognition site psti and xhoi; Taking Clostridium thermocellum genomic dna as template, obtain target gene monomeric enzyme by the method amplification of PCR celD, warp psti and xhoafter I double digestion purifying, be connected in the expression vector pHsh cutting through same enzyme; Connection product is transformed into by electric shock e. coliin cell, coat the LB culture medium flat plate that contains penbritin, turn out the transformant with target gene; From transformant, extract plasmid DNA, confirm target gene by gene sequencing celDclone successfully, celSclone use the same method, the expression plasmid of the enzymes such as CelD, CelS is named as pHsh-celD, pHsh-celS etc.

(2) deletion in grappling territory in monomeric enzyme: according to the concrete sequencing sequence of step (1) gained expression plasmid pHsh-celD or pHsh-celS, design primer is to delete monomeric enzyme gene celDor celSthe nucleotide sequence in encoded tail grappling territory.With produce flat end hi-fi archaeal dna polymerase as pyrobest(TaKaRa, Dalian) carries out inverse PCR, amplifies to comprise to remove grappling territory remainder in addition celD-d(SEQ ID NO.2) plasmid fragment, be linear DNA, with T4 DNA ligase to linear DNA carry out head and the tail connect, transform e. coliafter obtain leaving out the monomeric enzyme expression plasmid in grappling territory.

(3) grafting of CBD: design 1 pair of primer, taking Clostridium thermocellum genomic dna as template, with produce flat end hi-fi archaeal dna polymerase as pyrobestencode in the amplification scaffolding protein A DNA fragmentation of CBD cbd(SEQ ID NO.3), and in gene fragment cbdmerge after the link fragment (10-60 the amino acid of encoding is playing link effect between the main body of enzyme and cellulose binding domain) of artificial design upstream, obtains fragment L cbd(SEQ ID NO.5), be inserted into step (2) gained deletion in the expression plasmid pHsh-celD in grappling territory, form novel enzyme gene celD-d+L cbd, we rename into ncelD(SEQ ID NO.6), transforms e. coliidentify the expression plasmid that sequence is correct, called after pHsh-NcelD by screening and sequencing afterwards.Adopt and use the same method, we obtain the new plasmid pHsh-NcelS building.

Monomeric enzyme gene celDor celSafter obtaining CBD gene, be no longer attached to original cellulase body, but novel enzyme independently.

The high efficient expression of novel enzyme gene:

The expression plasmid pHsh-NcelD of novel enzyme and pHsh-NcelS transform e. coliafter carry out after aerated culture 3-6 hour at 30 DEG C, culture temperature is risen to 40 DEG C-42 DEG C gene is carried out to abduction delivering, continue to cultivate centrifugal collecting cell after 3-6 hour, to obtain the crude enzyme liquid of new enzyme after ultrasonic wave or clarifixator smudge cells, carry out SDS-PAGE analysis.

Beneficial effect:

(1) gene reconstruction method of the present invention desirable following beneficial effect:

On the cellulase body that fine clostridium produces, be attached with multiple monomeric enzymes, there is higher activity and stability.Monomeric enzyme all, by genes encoding independently, can pass through the high efficient expression of genetically engineered, but these monomeric enzymes need to be attached to the scaffolding protein of cellulase body, just can give full play to their activity by the cellulose binding domain on scaffolding protein (CBD).Method of the present invention is the redundant sequence of excision on monomeric enzyme, and by CBD grafting to monomeric enzyme, obtain the novel independent enzyme that does not rely on cellulase body, its beneficial effect is: both had high reactivity, facilitated again genetically engineered to produce.

(2) by method of the present invention, cellulase D is carried out to gene reconstruction and obtains following beneficial effect:

Cellulase D(CelD) be the highest active monomeric enzyme in cellulase body.Use method of the present invention to carry out producing novel enzyme NcelD after gene reconstruction to cellulase D, the activity of its hydrolysis soluble cellulose has improved 75%.

(3) beneficial effect of obtaining with the new enzyme of pHsh system expression:

The expression vector of gene efficient expression system pHsh is the exclusive product in this laboratory, obtains U.S.'s patent of invention (US 7,807,460 B2).New enzyme NcelD obtains solubility overexpression in pHsh carrier, for the suitability for industrialized production of enzyme lays the foundation.

brief description of the drawings

The design of the new gene of Fig. 1 and expression plasmid structure iron.

Fig. 2 technical scheme schematic diagram.

The SDS-PAGE of the recombinant fiber element enzyme that Fig. 3 genetic expression produces analyzes collection of illustrative plates.Swimming lane mark: M, protein molecular weight standard; 1, containing soluble protein pattern in the somatic cells of pHsh carrier; 2, containing soluble protein pattern in plasmid pHsh-CelD somatic cells; 3, containing soluble protein pattern in plasmid pHsh-NcelD somatic cells.The band of arrow indication is recombinant fiber element enzyme.

The comparison of the catalytic activity of the new enzyme NcelD of Fig. 4 and original monomer enzyme CelD.

The comparison of the temperature stability of the new enzyme NcelD of Fig. 5 and original monomer enzyme CelD.

embodiment

Below in conjunction with specific embodiment, method of the present invention and product are described further, but do not limit in any form the present invention.

embodiment 1: from Clostridium thermocellum genomic dna amplification target gene

Design of primers: see SEQ ID NO.1 according to the Clostridium thermocellum of reporting in NCBI (ATCC 27405) cellulase (CelD) gene order, remove the signal peptide sequence of this gene, (5 ' end contains respectively to design and synthesize two primer sequences psti and xhoi restriction enzyme site):

celD-1：5’ AAAACTGCAGGCAAAAATAACGGAGAATTATC 3’

celD-2：5’ CCGCTCGAGTTATATTGGTAATTTCTCGATTAC 3’

Genomic PCR amplification condition: cultivate Clostridium thermocellum cell, extract genomic dna and make template.In 50 μ L PCR reaction systems, add 5 × Prime STAR HS DNA polymerase buffer, the ultrapure water of 31.5 μ L and the Prime STAR HS DNA polysaccharase of 0.5 μ L of dNTP, the 10 μ L of 2 μ L (20 ng) template, 2 μ L 10 μ M primers, 4 μ L 2.5 μ M.Press temperature cycle (72 DEG C are extended 2.5min for 98 DEG C of sex change 10s, 60 DEG C of annealing 15s) 30 circulations of amplification, extend 10 minutes at 72 DEG C.Agarose electrophoresis detects, and finds to occur expection specific amplification band near 1.8 kb, illustrates that PCR condition is suitable, and product is single.

embodiment 2: the structure of the expression plasmid of monomeric enzyme gene in Clostridium thermocellum cellulase body

Above-mentioned PCR product rubber tapping is reclaimed, carry out psti and xhoi double digestion, is cloned on prokaryotic expression carrier pHsh plasmid.Be transformed into e. coliin DH10B, and cultivate transformant in the LB substratum that contains penbritin (100 μ g/mL).Extract plasmid from transformant, with psti carries out enzyme and cuts, and checking is inserted gene and carried out sequencing.It is 1827bp that result shows to insert mrna length, and coding contains 609 amino-acid residues, in sequence and database celDsequence is consistent.Expression plasmid called after pHsh-CelD.

embodiment 3: gene celDmolecule reconstruction

Design of primers: according to the grappling domain information in CelD protein peptide chain in NCBI site databases, design and synthesize two inverse PCR primers taking pHsh-CelD as template, pcr amplification is to obtain including removal grappling domain encoding sequence celD-d(SEQ ID NO.2) plasmid fragment, after concatemerization, form new plasmid pHsh-celD-d; According to the encoding gene of the contained CBD of Clostridium thermocellum scaffolding protein CipA in NCBI data cbd(SEQ ID NO.3), meanwhile, design primer will celD-d with cbdconnect together and obtain gene order celD-d+ cbd(SEQ ID NO.4), finally designs and synthesizes the L of 1 pair of PCR primer amplification with 1 link fragment cbd(SEQ ID NO.5), will celD-d and L cbdafter connecting, form novel enzyme gene celD-d+L cbd, we rename into ncelD(SEQ ID NO.6).

dockerin-up: TAACTCGAGCACCACCACC

dockerin-dn: TTGAGGAGAATTATAGTTGACA

cbd-1: AACGTTGGCAATGCAACACC

cbd-2: GCTTATTTCAAGGTAGGTGTC

Taking the plasmid pHsh-CelD that builds as template, taking dockerin-up and dockerin-dn as primer, carry out inverse PCR; PCR product is carried out to agarose gel electrophoresis, and the linear DNA fragment product (4036bp) that has obtained removing celD grappling domain encoding sequence is reclaimed in rubber tapping.Simultaneously taking Clostridium thermocellum genome as template, carry out pcr amplification gene taking cbd-1 and cbd-2 as primer cbdwith link sequence.PCR product is carried out to agarose gel electrophoresis, and the L obtaining with link sequence is reclaimed in rubber tapping cbdfragment (429bp).Glue is reclaimed to product linear DNA fragment and L cbdfragment is carried out phosphorylation ligation, and electric shock is transformed into e. coliin DH10B competent cell, in the LB substratum that contains penbritin (100 μ g/mL), cultivate transformant, extract plasmid, carry out sequencing, length is that the gene order of 2043 bp is consistent with expection.By the expression product called after novel cellulose enzyme D(NcelD of the successful target gene of reconstruction), its expression plasmid called after pHsh-NcelD.

embodiment 4: the expression of cellulase CelD and new enzyme NcelD

Recombinant plasmid pHsh-CelD and pHsh-NcelD are transformed into respectively e. coliin BL21, obtain gene recombination bacterium.Recombinant bacterium is seeded in the LB substratum that contains penbritin (100 μ g/mL), being placed in concussion at 30 DEG C cultivated after 3-6 hour, temperature increase to 40 DEG C-42 DEG C is carried out to abduction delivering to gene, at the temperature improving, continue to cultivate after 3-6 hour, centrifugal collecting cell, makes after lysis centrifugally with ultrasonic wave, supernatant liquor is the crude enzyme liquid of CelD and NcelD, carry out SDS-PAGE analysis, show to have obtained overexpression (Fig. 3).Concrete abduction delivering condition: inoculate single bacterium colony in the LB substratum that contains 100 μ g/mL, be cultured to OD at 30 DEG C ₆₀₀between 0.6-0.8, forward rapidly them to 42 DEG C and cultivate 6 hours, shaking speed is 200 rpm.

the purifying of embodiment 5: recombinant C elD and NcelD

Nutrient solution 5000 rpm, 4 DEG C of centrifugal 10 min collecting cells.With the deionized water wash cell of sterilizing three times, thoroughly remove residual substratum, according to 1:2(weight in wet base: volume) ratio be resuspended in appropriate Potassium Hydrogen Phthalate-imidazoles (50 mM, pH 6.0) in damping fluid, with after high pressure crush method smudge cells, with 16000 rpm, 4 DEG C of centrifugal 15 min remove cell debris, and supernatant liquor is crude enzyme liquid in born of the same parents.The centrifugal crude enzyme liquid obtaining is heat-treated to 30 min in 60 DEG C of water-baths, to remove the foreign protein in intestinal bacteria.After thermal treatment, remove the foreign protein of thermally denatures at 4 DEG C with centrifugal 10 min of 12000 rpm, supernatant liquor is for to obtain partially purified enzyme liquid by thermal treatment.

With following methods, enzyme is further purified if desired: the crude enzyme liquid after thermal treatment is carried out to DEAE-Sephrose ion exchange chromatography.By after 80 mL ion exchange resin dress posts, be first used for preserving the ethanol of filler with the deionized water rinsing of 10 times of volumes, then use 6～8 column volumes of buffer A balance; Partially purified enzyme liquid pump is entered to ion exchange column, and flow velocity is 2 mL/min, washs 2 column volumes unconjugated albumen is thoroughly washed to the greatest extent with damping fluid; The gradient eluting salt that contains 0～0.5 mol/L NaCl with 400 mL, collects containing the elutriant of target protein, with 75% ammonium sulfate precipitation zymoprotein (4 DEG C are spent the night), after 4 DEG C of centrifugal 20 min, abandons supernatant, adds damping fluid soluble protein dialysing gently.The dialysis buffer liquid using is Tris-HCl(25mM, pH7.0), dialyse on ice, within every 2 hours, change a dialysis buffer liquid (changing 3 times) and obtain pure enzyme.

embodiment 6: cellulase activity measuring method

Cellulase activity generally has two kinds of statements: CMC hydrolytic activity, crystalline cellulose hydrolytic activity.The mensuration of enzymic activity is all to use reducing sugar analysis method, uses after enzymic hydrolysis CMC or crystalline cellulose substrate the amount of the reducing sugar increasing in assaying reaction liquid.

The component of reaction solution: damping fluid, 50 μ L 0.5% CMC or the crystalline cellulose (W/V) of 45 μ L 50 mM pH 5.0, the suitably enzyme liquid of dilution of 5 μ L.

Temperature of reaction and time: after 55 DEG C of preheating 10 min, add 5 μ L enzyme liquid, if react 5 min taking CMC as substrate at 55 DEG C; If taking crystalline cellulose as substrate, at 55 DEG C of reaction 30 min.

Reaction terminating and colour developing: add 300 μ L terminator/developer PAHBAH(formulas to be: 0.5 M NaOH of 4 volumes and 5% PAHBAH that is dissolved in 0.5 M HCl of 1 volume mix) termination reaction; Mixture is placed in to boiling water bath and hatches 10 min, put after cooled on ice, the absorption value with spectrophotometric determination at wavelength 410 nm places.The activity unit of enzyme is defined as per minute catalysis and produces the enzyme amount of 1 μ mol reducing sugar.

embodiment 7: protein concn and concentration of reduced sugar quantivative approach

First configure Bradford stock solution, it consists of: 95 % ethanol 10 mL mix with 88 % phosphoric acid 20 mL, add 35 mg Xylene Brilliant Cyanine G G-250, after dissolving, under room temperature, keeps in Dark Place.

Bradford Working solution prescription is: 425 mL H ₂o; 15 mL 95 % ethanol; 30 mL 85 % phosphoric acid; 30 mL Bradford stock solutions.

After preparing, with No. 1 filter paper filtering of Whatman, keep in Dark Place in room temperature, can use several weeks, but will use again filter paper filtering before use.Preparation standard curve: preparation standard protein solution (1 mg/mL bovine serum albumin), select the different protein contents of 2.5 g～20 g, add appropriate water, making cumulative volume is 100 L, then add the Bradford working fluid of 1 mL, vibration mixes up and down, after placement 2 min, measures absorption values at 595 nm places, and measurement should complete in 10 min.After linear regression, obtaining absorbancy-bovine serum albumin amount typical curve is: y=0.0174x+0.0051, R ²=0.995, x represents BSA (g), and y represents absorbance A ₅₉₅.

The same method of sample detection, with suitable dilute sample replacement bovine serum albumin, measures the A of testing sample ₅₉₅, the concentration of definite testing sample from BSA typical curve.

The making of the typical curve of glucose:

The preparation of glucose typical curve: preparation 0.5 mM glucose standardized solution, with glucose and the NaOH/ P-hydroxybenzoic acid hydrazides reagent react of different concns gradient, the absorbance A of assaying reaction liquid ₄₁₀value.After linear regression fit, obtaining absorbancy-glucose content typical curve is: y=189.23x+0.03, R ²=0.999, x represents glucose concn (μ mol), and y represents absorbance A ₄₁₀.

The mensuration of zymologic property:

(1) mensuration of optimal reactive temperature: get the purifying enzyme liquid of appropriate dilution within the scope of 40～80 DEG C, every 5 DEG C, measuring respectively enzyme lives, reaction system is: the enzyme liquid 5 μ l of appropriate dilution, 50 mM Potassium Hydrogen Phthalate-imidazole buffers (pH 5.5), 45 μ l, CMC 50 μ l 0.5%(W/V), the reaction times is 5 min.Taking high enzymatic activity as 100%, calculate relative enzyme and live.

(2) mensuration of temperature stability: get the purifying enzyme liquid of appropriate dilution respectively at 5.5 times insulation 60 min of 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C pH, measuring enzyme at different time samplings lives, taking the enzyme activity that is not incubated (4 DEG C of preservations) as 100%, calculate relative enzyme and live, determine the temperature stability of enzyme.

(3) mensuration of optimal reaction pH: different pH(2.6 ~ 9.6) (pH is 60 DEG C of corrections) damping fluid, wherein pH 2.6,3.8,4.0,4.2,4.6 be 50 mM acetic acid-sodium acetate buffers, pH 4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0 be 50 mM Potassium Hydrogen Phthalate-imidazole buffers, pH 8.0,8.6,9.2,9.6 be 50 mM Tris-glycine buffers.Measure respectively enzyme in 55 DEG C and live, reaction system is: the purifying enzyme liquid of the appropriate dilution of 5 μ l, the damping fluid of the different pH values of 45 μ l, 50 μ l 0.5%(W/V) CMC, reaction 5 min.Be up to 100% with enzyme activity, calculate relative reactivity.

(4) mensuration of pH stability: the purifying enzyme liquid of getting the appropriate dilution of 5 μ l adds respectively in the damping fluid of different pH values, at 60 DEG C, be incubated 30 min, add again 50 μ l 0.5%(W/V) CMC, reaction times 5min measures respectively activity of residual enzyme again, taking the enzyme activity that is not incubated (4 DEG C of preservations) as 100%, calculate relative enzyme and live, relatively the stability of enzyme under condition of different pH.The selection of damping fluid is with the mensuration of optimal reaction pH.React the damping fluid that damping fluid used is pH 2.6 ~ 9.6.

Test-results shows, the activity of novel enzyme NcelD and stability are than nature enzyme CelD be significantly improved (Fig. 4,5).

SEQUENCE LISTING

<110> Jiangsu University

The reconstruction method of <120> cellulase body gene and the novel cellulose enzyme of acquisition

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 1824

<212> DNA

<213> Clostridium thermocellum (Clostridium thermoceUum)

<400> 1

gcaaaaataa cggagaatta tcaatttgat tcacgaatcc gtttaaactc aataggtttt 60

ataccgaacc acagcaaaaa ggcgactata gctgcaaatt gttcaacctt ttatgttgtt 120

aaagaagacg gaacaatagt gtataccgga acggcaactt caatgtttga caatgataca 180

aaagaaactg tttatattgc tgatttttca tctgttaatg aagaaggaac gtactatctt 240

gccgtgccgg gagtaggaaa aagcgtaaac tttaaaattg caatgaatgt atatgaggat 300

gcttttaaaa cagcaatgct gggaatgtat ttgctgcgct gcggcaccag tgtgtcggcc 360

acatacaacg gaatacacta ttcccatgga ccgtgccata ctaatgatgc atatcttgat 420

tatataaacg gacagcatac taaaaaagac agtacaaaag gctggcatga tgcgggcgac 480

tacaacaaat atgtggtaaa cgccggcata accgttggtt caatgttcct ggcgtgggag 540

cattttaaag accagttgga gcctgtggca ttggagattc ccgaaaagaa caattcaata 600

ccggattttc ttgatgaatt aaaatatgag atagactgga ttcttaccat gcaataccct 660

gacgggagcg gaagggtggc tcataaagtt tcgacaagga actttggcgg ctttatcatg 720

cctgagaacg aacacgacga aagatttttc gtgccctgga gcagtgccgc aacggcagac 780

tttgttgcca tgacggccat ggctgcaaga atattcaggc cttatgatcc tcaatatgct 840

gaaaaatgta taaatgcggc aaaagtaagc tatgagtttt tgaagaacaa tcctgcgaat 900

gtttttgcaa accagagtgg attctcaaca ggagaatatg ccactgtcag tgatgcagat 960

gacagattgt gggcggcggc tgaaatgtgg gagaccctgg gagatgaaga ataccttaga 1020

gattttgaaa acagggcggc gcaattctcg aaaaaaatag aagccgattt tgactgggat 1080

aatgttgcaa acttaggtat gtttacatat cttttgtcag aaagaccggg caagaatcct 1140

gctttggtgc agtcaataaa ggatagtctc ctttccactg cggattcaat tgtgaggacc 1200

agccaaaacc atggctatgg cagaaccctt ggtacaacat attactgggg atgcaacggc 1260

acggttgtaa gacagactat gatacttcag gttgcgaaca agatttcacc caacaatgat 1320

tatgtaaatg ctgctctcga tgcgatttca catgtatttg gaagaaacta ttacaacagg 1380

tcttatgtaa caggccttgg tataaatcct cctatgaatc ctcatgacag acgttcaggg 1440

gctgacggaa tatgggagcc gtggcccggt taccttgtag gaggaggatg gcccggaccg 1500

aaggattggg tggatattca ggacagttat cagaccaatg aaattgctat aaactggaat 1560

gcggcattga tttatgccct tgccggattt gtcaactata attctcctca aaatgaagta 1620

ctgtacggag atgtgaatga tgacggaaaa gtaaactcca ctgacttgac tttgttaaaa 1680

agatatgttc ttaaagccgt ctcaactctc ccttcttcca aagctgaaaa gaacgcagat 1740

gtaaatcgtg acggaagagt taattccagt gatgtcacaa tactttcaag atatttgata 1800

agggtaatcg agaaattacc aata 1824

<210> 2

<211> 1611

<212> DNA

<213> Clostridium thermocellum (Clostridium thermoceUum)

<400> 2

gcaaaaataa cggagaatta tcaatttgat tcacgaatcc gtttaaactc aataggtttt 60

ataccgaacc acagcaaaaa ggcgactata gctgcaaatt gttcaacctt ttatgttgtt 120

aaagaagacg gaacaatagt gtataccgga acggcaactt caatgtttga caatgataca 180

aaagaaactg tttatattgc tgatttttca tctgttaatg aagaaggaac gtactatctt 240

gccgtgccgg gagtaggaaa aagcgtaaac tttaaaattg caatgaatgt atatgaggat 300

gcttttaaaa cagcaatgct gggaatgtat ttgctgcgct gcggcaccag tgtgtcggcc 360

acatacaacg gaatacacta ttcccatgga ccgtgccata ctaatgatgc atatcttgat 420

tatataaacg gacagcatac taaaaaagac agtacaaaag gctggcatga tgcgggcgac 480

tacaacaaat atgtggtaaa cgccggcata accgttggtt caatgttcct ggcgtgggag 540

cattttaaag accagttgga gcctgtggca ttggagattc ccgaaaagaa caattcaata 600

ccggattttc ttgatgaatt aaaatatgag atagactgga ttcttaccat gcaataccct 660

gacgggagcg gaagggtggc tcataaagtt tcgacaagga actttggcgg ctttatcatg 720

cctgagaacg aacacgacga aagatttttc gtgccctgga gcagtgccgc aacggcagac 780

tttgttgcca tgacggccat ggctgcaaga atattcaggc cttatgatcc tcaatatgct 840

gaaaaatgta taaatgcggc aaaagtaagc tatgagtttt tgaagaacaa tcctgcgaat 900

gtttttgcaa accagagtgg attctcaaca ggagaatatg ccactgtcag tgatgcagat 960

gacagattgt gggcggcggc tgaaatgtgg gagaccctgg gagatgaaga ataccttaga 1020

gattttgaaa acagggcggc gcaattctcg aaaaaaatag aagccgattt tgactgggat 1080

aatgttgcaa acttaggtat gtttacatat cttttgtcag aaagaccggg caagaatcct 1140

gctttggtgc agtcaataaa ggatagtctc ctttccactg cggattcaat tgtgaggacc 1200

agccaaaacc atggctatgg cagaaccctt ggtacaacat attactgggg atgcaacggc 1260

acggttgtaa gacagactat gatacttcag gttgcgaaca agatttcacc caacaatgat 1320

tatgtaaatg ctgctctcga tgcgatttca catgtatttg gaagaaacta ttacaacagg 1380

tcttatgtaa caggccttgg tataaatcct cctatgaatc ctcatgacag acgttcaggg 1440

gctgacggaa tatgggagcc gtggcccggt taccttgtag gaggaggatg gcccggaccg 1500

aaggattggg tggatattca ggacagttat cagaccaatg aaattgctat aaactggaat 1560

gcggcattga tttatgccct tgccggattt gtcaactata attctcctca a 1611

<210> 3

<211> 276

<212> DNA

<213> Clostridium thermocellum (Clostridium thermoceUum)

<400> 3

gttgaattct acaacagcaa tccttcagat actactaact caatcaatcc tcagttcaag 60

gttactaata ccggaagcag tgcaattgat ttgtccaaac tcacattgag atattattat 120

acagtagacg gacagaaaga tcagaccttc tggtgtgacc atgctgcaat aatcggcagt 180

aacggcagct acaacggaat tacttcaaat gtaaaaggaa catttgtaaa aatgagttcc 240

tcaacaaata acgcagacac ctaccttgaa ataagc 276

<210> 4

<211> 1887

<212> DNA

<213> artificial sequence

<400> 4

gcaaaaataa cggagaatta tcaatttgat tcacgaatcc gtttaaactc aataggtttt 60

ataccgaacc acagcaaaaa ggcgactata gctgcaaatt gttcaacctt ttatgttgtt 120

aaagaagacg gaacaatagt gtataccgga acggcaactt caatgtttga caatgataca 180

aaagaaactg tttatattgc tgatttttca tctgttaatg aagaaggaac gtactatctt 240

gccgtgccgg gagtaggaaa aagcgtaaac tttaaaattg caatgaatgt atatgaggat 300

gcttttaaaa cagcaatgct gggaatgtat ttgctgcgct gcggcaccag tgtgtcggcc 360

acatacaacg gaatacacta ttcccatgga ccgtgccata ctaatgatgc atatcttgat 420

tatataaacg gacagcatac taaaaaagac agtacaaaag gctggcatga tgcgggcgac 480

tacaacaaat atgtggtaaa cgccggcata accgttggtt caatgttcct ggcgtgggag 540

cattttaaag accagttgga gcctgtggca ttggagattc ccgaaaagaa caattcaata 600

ccggattttc ttgatgaatt aaaatatgag atagactgga ttcttaccat gcaataccct 660

gacgggagcg gaagggtggc tcataaagtt tcgacaagga actttggcgg ctttatcatg 720

cctgagaacg aacacgacga aagatttttc gtgccctgga gcagtgccgc aacggcagac 780

tttgttgcca tgacggccat ggctgcaaga atattcaggc cttatgatcc tcaatatgct 840

gaaaaatgta taaatgcggc aaaagtaagc tatgagtttt tgaagaacaa tcctgcgaat 900

gtttttgcaa accagagtgg attctcaaca ggagaatatg ccactgtcag tgatgcagat 960

gacagattgt gggcggcggc tgaaatgtgg gagaccctgg gagatgaaga ataccttaga 1020

gattttgaaa acagggcggc gcaattctcg aaaaaaatag aagccgattt tgactgggat 1080

aatgttgcaa acttaggtat gtttacatat cttttgtcag aaagaccggg caagaatcct 1140

gctttggtgc agtcaataaa ggatagtctc ctttccactg cggattcaat tgtgaggacc 1200

agccaaaacc atggctatgg cagaaccctt ggtacaacat attactgggg atgcaacggc 1260

acggttgtaa gacagactat gatacttcag gttgcgaaca agatttcacc caacaatgat 1320

tatgtaaatg ctgctctcga tgcgatttca catgtatttg gaagaaacta ttacaacagg 1380

tcttatgtaa caggccttgg tataaatcct cctatgaatc ctcatgacag acgttcaggg 1440

gctgacggaa tatgggagcc gtggcccggt taccttgtag gaggaggatg gcccggaccg 1500

aaggattggg tggatattca ggacagttat cagaccaatg aaattgctat aaactggaat 1560

gcggcattga tttatgccct tgccggattt gtcaactata attctcctca agttgaattc 1620

tacaacagca atccttcaga tactactaac tcaatcaatc ctcagttcaa ggttactaat 1680

accggaagca gtgcaattga tttgtccaaa ctcacattga gatattatta tacagtagac 1740

ggacagaaag atcagacctt ctggtgtgac catgctgcaa taatcggcag taacggcagc 1800

tacaacggaa ttacttcaaa tgtaaaagga acatttgtaa aaatgagttc ctcaacaaat 1860

aacgcagaca cctaccttga aataagc 1887

<210> 5

<211> 429

<212> DNA

<213> Clostridium thermocellum (Clostridium thermoceUum)

<400> 5

aacgttggca atgcaacacc gaccaaggga gcaacaccaa caaatacagc tacgccgaca 60

aaatcagcta cggctacgcc caccaggcca tcggtaccga caaacacacc gacaaacaca 120

ccggcaaata caccggtatc aggcaatttg aaggttgaat tctacaacag caatccttca 180

gatactacta actcaatcaa tcctcagttc aaggttacta ataccggaag cagtgcaatt 240

gatttgtcca aactcacatt gagatattat tatacagtag acggacagaa agatcagacc 300

ttctggtgtg accatgctgc aataatcggc agtaacggca gctacaacgg aattacttca 360

aatgtaaaag gaacatttgt aaaaatgagt tcctcaacaa ataacgcaga cacctacctt 420

gaaataagc 429

<210> 6

<211> 2043

<212> DNA

<213> artificial sequence

<400> 6

gcaaaaataa cggagaatta tcaatttgat tcacgaatcc gtttaaactc aataggtttt 60

ataccgaacc acagcaaaaa ggcgactata gctgcaaatt gttcaacctt ttatgttgtt 120

aaagaagacg gaacaatagt gtataccgga acggcaactt caatgtttga caatgataca 180

aaagaaactg tttatattgc tgatttttca tctgttaatg aagaaggaac gtactatctt 240

gccgtgccgg gagtaggaaa aagcgtaaac tttaaaattg caatgaatgt atatgaggat 300

gcttttaaaa cagcaatgct gggaatgtat ttgctgcgct gcggcaccag tgtgtcggcc 360

acatacaacg gaatacacta ttcccatgga ccgtgccata ctaatgatgc atatcttgat 420

tatataaacg gacagcatac taaaaaagac agtacaaaag gctggcatga tgcgggcgac 480

tacaacaaat atgtggtaaa cgccggcata accgttggtt caatgttcct ggcgtgggag 540

cattttaaag accagttgga gcctgtggca ttggagattc ccgaaaagaa caattcaata 600

ccggattttc ttgatgaatt aaaatatgag atagactgga ttcttaccat gcaataccct 660

gacgggagcg gaagggtggc tcataaagtt tcgacaagga actttggcgg ctttatcatg 720

cctgagaacg aacacgacga aagatttttc gtgccctgga gcagtgccgc aacggcagac 780

tttgttgcca tgacggccat ggctgcaaga atattcaggc cttatgatcc tcaatatgct 840

gaaaaatgta taaatgcggc aaaagtaagc tatgagtttt tgaagaacaa tcctgcgaat 900

gtttttgcaa accagagtgg attctcaaca ggagaatatg ccactgtcag tgatgcagat 960

gacagattgt gggcggcggc tgaaatgtgg gagaccctgg gagatgaaga ataccttaga 1020

gattttgaaa acagggcggc gcaattctcg aaaaaaatag aagccgattt tgactgggat 1080

aatgttgcaa acttaggtat gtttacatat cttttgtcag aaagaccggg caagaatcct 1140

gctttggtgc agtcaataaa ggatagtctc ctttccactg cggattcaat tgtgaggacc 1200

agccaaaacc atggctatgg cagaaccctt ggtacaacat attactgggg atgcaacggc 1260

acggttgtaa gacagactat gatacttcag gttgcgaaca agatttcacc caacaatgat 1320

tatgtaaatg ctgctctcga tgcgatttca catgtatttg gaagaaacta ttacaacagg 1380

tcttatgtaa caggccttgg tataaatcct cctatgaatc ctcatgacag acgttcaggg 1440

gctgacggaa tatgggagcc gtggcccggt taccttgtag gaggaggatg gcccggaccg 1500

aaggattggg tggatattca ggacagttat cagaccaatg aaattgctat aaactggaat 1560

gcggcattga tttatgccct tgccggattt gtcaactata attctcctca aaacgttggc 1620

aatgcaacac cgaccaaggg agcaacacca acaaatacag ctacgccgac aaaatcagct 1680

acggctacgc ccaccaggcc atcggtaccg acaaacacac cgacaaacac accggcaaat 1740

acaccggtat caggcaattt gaaggttgaa ttctacaaca gcaatccttc agatactact 1800

aactcaatca atcctcagtt caaggttact aataccggaa gcagtgcaat tgatttgtcc 1860

aaactcacat tgagatatta ttatacagta gacggacaga aagatcagac cttctggtgt 1920

gaccatgctg caataatcgg cagtaacggc agctacaacg gaattacttc aaatgtaaaa 1980

ggaacatttg taaaaatgag ttcctcaaca aataacgcag acacctacct tgaaataagc 2040

taa 2043

Claims (8)

1. a reconstruction method for cellulase body gene, is characterized in that, described method comprises cloned target gene, deletes redundant sequence, grafting cellulose binding domain step on monomeric enzyme.

2. the reconstruction method of a kind of cellulase body gene according to claim 1, it is characterized in that, described cloned target gene step is: taking the encoding gene of the scaffolding protein of cellulase body as template, by the gene fragment of pcr amplification coding cellulose binding domain wherein cbd.

3. the reconstruction method of a kind of cellulase body gene according to claim 1, is characterized in that, the redundant sequence step on described deletion monomeric enzyme is: delete celDthe base sequence in middle coding grappling territory, obtains gene fragment celD-d.

4. the reconstruction method of a kind of cellulase body gene according to claim 1, is characterized in that, described grafting cellulose binding domain step is by gene fragment cbdbe fused to celDthe afterbody of-d, obtains gene celD-d+ cbd.

5. the reconstruction method of a kind of cellulase body gene according to claim 2, is characterized in that, described gene fragment cbdupstream with 1 link fragment, 10-60 the amino acid of encode plays link effect between the main body of enzyme and cellulose binding domain, fusion has this link fragment cbdsequence is referred to as lcbd.

6. reconstruct by gene a novel cellulose enzyme NcelD who obtains, it is characterized in that, described novel cellulose enzyme NcelD is by gene celD-d+ lcbdcoding, its peptide chain without with cellulase body support frame albumen on the clay module grappling territory of adsorbing mutually, with 1 section of cellulose binding domain fragment that links small peptide, there is grafting.

7. a kind of novel cellulose enzyme NcelD obtaining that reconstructs by gene according to claim 6, it is characterized in that, described novel cellulose enzyme NcelD be can cellulose-binding independent enzyme, do not need not in conjunction with scaffolding protein yet, cellulolytic specific activity nature monomeric enzyme CelD is high.

8. an overexpression method of novel cellulose enzyme NcelD, is characterized in that, taking the plasmid of escherichia expression system pHsh as expression vector, and expression plasmid called after pHsh-NcelD.