CN103911291B - A kind of method for improveing algae character - Google Patents
A kind of method for improveing algae character Download PDFInfo
- Publication number
- CN103911291B CN103911291B CN201210594376.0A CN201210594376A CN103911291B CN 103911291 B CN103911291 B CN 103911291B CN 201210594376 A CN201210594376 A CN 201210594376A CN 103911291 B CN103911291 B CN 103911291B
- Authority
- CN
- China
- Prior art keywords
- algae
- albumen
- seq
- light
- psbc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to a kind of method for improveing algae character, a kind of new method of the improvement algae for the purpose of improving algae optical energy utilization efficiency is disclosed first, methods described in algae by expressing light energy absorption and transferrin (Light EnergyAbsorption and Transduction protein, LEAT albumen), the spectral region utilized to solar energy is expanded, algae light utilization ratio is improved.
Description
Technical field
The invention belongs to biological technical field；More particularly it relates to a kind of method for improveing algae character.
Background technology
Photosynthesis is most important chemical reaction on the earth, and photosynthetic organism converts light into be people by photosynthesis
The chemical energy form for the stabilization that class is directly utilized, and there is provided the oxygen and food needed for human survival.In current population in the world
Under increase, crisis in food, the background of energy crisis, it is found that the new way for improving the light utilization ratio of photosynthetic organism has important
Meaning.
For many years, people attempt various means and improve photosynthetic organism photosynthetic efficiency, and main strategy includes reduction light
Breathing loss, increase Rubisco carboxylations and oxidation reaction ratio, transformation C3 plant turn into C4 plants etc..These strategies are all
Concentrate on some aspect of improvement influence photosynthetic efficiency.A kind of approach there is no to effectively improve luminous energy profit by complete confirmation at present
Use efficiency.In view of Photosynthetic operation mode is guarded very much between various plants, once a kind of way for improving optical energy utilization efficiency
Fully verified that it has great potential to be applied in different photosynthetic organisms in footpath.
Microalgae can utilize solar energy to be biomass energy by water and carbon dioxide conversion, and many microalgaes are rich in grease, and
And can be biodiesel by current existing technical transform.The oil content of some microalgaes can exceed the 80% of its dry weight, and micro-
Algae forms control, and the oil productivity of oil crops such as soybean and palm is below 5%, in addition, edible oil needs and oil is mixed
It can be used as biodiesel, so oil can not be replaced completely.About 300 kinds algae, it is considered to be adapted to biodiesel
Production, it is meant that the source of grease production biodiesel need not be cultivated by land plant again.Therefore, microalgae oil will be a kind of complete
The biodiesel of oil can be substituted, is had broad application prospects and with huge economic and social benefit
However, the biomass energy from microalgae far can not meet the demand of the real energy at present, subject matter is biological
The production efficiency of matter is still very low, and reason is that photosynthetic efficiency is low.Although under general condition needed for sunlight and photosynthesis
The raw water and carbon dioxide wanted simultaneously have no lack of, and can be due to a variety of internal and external causes, photosynthetic organism using solar energy efficiency very
It is low, it is estimated that it is about the whole radiation energies of the sun that photosynthetic organism photosynthetic conversion ratio in Temperate Region in China is calculated by average of the whole year
0.5%-2.5%, the average conversion in whole biosphere is up to 3%-5%.It is photosynthetic in the case where providing preferable environment and condition
Peak efficiency is up to 8~15%.Therefore, how to improve the efficiency of light energy utilization is the great of following further raising energy-source plant yield
Breach.
Therefore, this area is in the urgent need to the new side of the research and development raising photosynthetic organism particularly light utilization ratio of algae
Method, to cultivate the photosynthetic organism that optical energy utilization efficiency is high.
The content of the invention
It is an object of the invention to provide a kind of method for improveing algae character.
In the first aspect of the present invention there is provided a kind of method for improveing algae character, comprise the following steps：1) by a kind of or
The polynucleotides conversion of a variety of coding light energy absorptions and transferrin (LEAT albumen) enters algae；2) from the algae after conversion
Select character for comparing control algae and obtain the algae improved；Above-mentioned light energy absorption and transferrin are can to utilize luminous energy
The cracking of catalytic water and the albumen of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone.
In a preference, described coding light energy absorption and the polynucleotides of transferrin are selected from the group：(a) encode
Fluorescin or its through one or more (such as 1-30；Preferably 1-20；More preferably 1-10；More preferably 1-5) amino
Fluorescence is strong and weak after sour site mutation or fluorescence emission spectrum changes, but still can using luminous energy catalytic water cracking and
The polynucleotides of the mutant protein of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone；Or (b) coding non-fluorescence chromophoric protein
(non-fluorescent chromoprotein) or its through one or more (such as 1-30；Preferably 1-20；More preferably
1-10；More preferably 1-5) after amino acid sites mutation but cracking that still can be using luminous energy catalytic water and 2,3,5- front threes
The polynucleotides of the mutant protein of the reduction of base -1,4- 1,4-benzoquinone.
In another preference, described encoding fluorescent protein or its through one or more (such as 1-30；Preferably 1-20
It is individual；More preferably 1-10；More preferably 1-5) fluorescence is strong and weak after amino acid sites mutation or fluorescence emission spectrum changes,
But still can be many with the mutant protein of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone using cracking for luminous energy catalytic water
Nucleotides is selected from the group：
(a) coding SEQ ID NO:The polynucleotides of the albumen of amino acid sequence shown in 4；
(b) coding SEQ ID NO:The polynucleotides of the albumen of amino acid sequence shown in 10；
(c) coding SEQ ID NO:The polynucleotides of the albumen (efasCFP) of amino acid sequence shown in 36；
(d) coding SEQ ID NO:The polynucleotides of the albumen of amino acid sequence shown in 6；
(e) coding SEQ ID NO:The polynucleotides of the albumen of amino acid sequence shown in 28；
(f) coding SEQ ID NO:The polynucleotides of the albumen (scubGFP) of amino acid sequence shown in 40；
(g) coding SEQ ID NO:The polynucleotides of the albumen (rmueGFP) of amino acid sequence shown in 44；
(h) coding SEQ ID NO:The polynucleotides of the albumen (cpGFP) of amino acid sequence shown in 52；
(i) coding SEQ ID NO:The polynucleotides of the albumen (YFP) of amino acid sequence shown in 8；
(j) coding SEQ ID NO:The polynucleotides of the albumen (YFPmu2) of amino acid sequence shown in 12；
(k) coding SEQ ID NO:The polynucleotides of the albumen (YFPmu4) of amino acid sequence shown in 14；
(l) coding SEQ ID NO:The polynucleotides of the albumen (YFPmu7) of amino acid sequence shown in 16；
(m) coding SEQ ID NO:Albumen (the YFP of amino acid sequence shown in 18L232H) polynucleotides；
(n) coding SEQ ID NO:Albumen (the YFP of amino acid sequence shown in 20L232Q) polynucleotides；
(o) coding SEQ ID NO:The polynucleotides of the albumen (phiYFP) of amino acid sequence shown in 50；
(p) coding SEQ ID NO:The polynucleotides of the albumen (mCherry) of amino acid sequence shown in 2；
(q) coding SEQ ID NO:The polynucleotides of the albumen (mCherrymu3) of amino acid sequence shown in 22；
(r) coding SEQ ID NO:The polynucleotides of the albumen (mCherrymu4) of amino acid sequence shown in 24；
(s) coding SEQ ID NO:The polynucleotides of the albumen (mCherrymu5) of amino acid sequence shown in 26；
(t) coding SEQ ID NO:The polynucleotides of the albumen (eqFP611) of amino acid sequence shown in 30；
(u) coding SEQ ID NO:The polynucleotides of the albumen (eforCP/RFP) of amino acid sequence shown in 34；
(v) coding SEQ ID NO:The polynucleotides of the albumen (rfloRFP) of amino acid sequence shown in 42；
(w) coding SEQ ID NO:The polynucleotides of the albumen (ceriantRFP) of amino acid sequence shown in 46；
(x) coding SEQ ID NO:The polynucleotides of the albumen (hcriCP) of amino acid sequence shown in 32；
(y) coding SEQ ID NO:The polynucleotides of the albumen (anm2CP) of amino acid sequence shown in 48；
(z) coding SEQ ID NO:Albumen (the YFP of amino acid sequence shown in 561-231) polynucleotides；
(aa) coding SEQ ID NO:Albumen (the GFP of amino acid sequence shown in 581-231) polynucleotides；
(ab) any shown amino acid sequence of coding (a) to (aa) is by one or more (such as 1-30；Preferably 1-20
It is individual；More preferably 1-10；More preferably 1-5) amino acid residue substitution, missing or addition formed by, and light can be utilized
The polynucleotides of the albumen of the cracking of energy catalytic water and the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone；
(ac) sequence homology of coding and the albumen of (a) to (aa) any amino acid sequence (is more preferably higher than higher than 70%
80%；More preferably it is higher than 90%；More preferably it is higher than 95%；More preferably it is higher than 98%；More preferably it is higher than 99%), and can be urged using luminous energy
Change the polynucleotides of the albumen of the cracking of water and the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone；Or
(ad) polynucleotides complementary with any polynucleotides of above-mentioned (a)-(ac).
In another preference, described encoding fluorescent protein or its through one or more (such as 1-30；Preferably 1-20
It is individual；More preferably 1-10；More preferably 1-5) fluorescence is strong and weak after amino acid sites mutation or fluorescence emission spectrum changes,
But still can be many with the mutant protein of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone using cracking for luminous energy catalytic water
Nucleotides is selected from the group：
(a) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 3；
(b) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 9；
(c) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 35；
(d) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 5；
(e) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 27；
(f) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 39；
(g) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 43；
(h) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 51；
(i) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 7；
(j) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 11；
(k) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 13；
(l) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 15；
(m) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 17；
(n) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 19；
(o) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 49；
(p) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 1；
(q) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 21；
(r) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 23；
(s) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 25；
(t) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 29；
(u) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 33；
(v) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 41；
(w) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 45；
(x) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 31；
(y) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 47；
(z) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 55；
(aa) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 57；Or
(ab) polynucleotides complementary with any described polynucleotides of (a)-(aa).
In another preference, described coding non-fluorescence chromophoric protein or its through one or more (such as 1-30；Preferably
Ground 1-20；More preferably 1-10；More preferably 1-5) still being capable of splitting using luminous energy catalytic water after amino acid sites mutation
The polynucleotides selection the following group of the mutant protein of the reduction of solution and 2,3,5- trimethyl -1,4- 1,4-benzoquinone：
(a)SEQ ID NO:The albumen (spisCP) of amino acid sequence shown in 38；
(b) by amino acid sequence shown in (a) by one or more (such as 1-30；Preferably 1-20；More preferably 1-10
It is individual；More preferably 1-5) amino acid residue substitution, missing or addition formed by, and the cracking of luminous energy catalytic water can be utilized
With the albumen of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone；
(c) it is higher than 70% (more preferably higher than 80% with the sequence homology of the albumen of amino acid sequence shown in (a)；More preferably
Higher than 90%；More preferably it is higher than 95%；More preferably it is higher than 98%；More preferably it is higher than 99%), and the cracking of luminous energy catalytic water can be utilized
With the albumen of the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone；Or
(d) polynucleotides complementary with any polynucleotides of (a)-(c).
In another preference, described coding non-fluorescence chromophoric protein or its through one or more (such as 1-30；Preferably
Ground 1-20；More preferably 1-10；More preferably 1-5) still being capable of splitting using luminous energy catalytic water after amino acid sites mutation
The polynucleotides of the mutant protein of the reduction of solution and 2,3,5- trimethyl -1,4- 1,4-benzoquinone are selected from the group：
(a) such as SEQ ID NO:The polynucleotides of nucleotide sequence shown in 37；Or
(b) with the polynucleotides of the polynucleotides complementation described in (a).
In another preference, described coding light energy absorption and the polynucleotides of transferrin are further selected from：Coding is selected from
The polynucleotides of the albumen of following GenBank accession number：AF168421、AY646070、AY646072、AY646071、
AF168424、AF168420、AY182022、AY182023、DQ206381、DQ206392、DQ206382、AY181556、
AY679113、EU498721、AY182017、AY646069、AY646066、AY151052、EU498722、AY647156、
AY508123、AY508124、AY508125、AF435432、AY646067、AY485334、AY485335、AY646068、
AF545827、AF545830、AY037776、AB180726、DQ206383、DQ206395、DQ206396、DQ206385、
EU498723、AB193294、AY182020、AY182021、AB107915、DQ206389、P42212、AY268073、
AY181553、AY181554、AY181555、DQ206393、AY155344、AY037766、AY679112、AF401282、
EU498724、AY268076、AY268074、AY268075、AY268071、AY268072、DQ206391、AY015995、
AY182014、AF372525、EU498725、DQ206390、AF168422、AY646073、AY296063、AF272711、
AB128820、DQ206379、DQ206380、AF168419、AY059642、EF186664、AF420591、DQ206387、
AY182019、AY765217、AB085641、AY181552、DQ206386、AY182013、AY646064、AY485333、
AF168423、AY646077、AY646076、AY646075、EF587182、AF363775、AF383155、DQ206394、
DQ206376、AF38315、AF363776、AY461714、AB209967、DQ206377、DQ206378；Or above-mentioned albumen is through one
Fluorescence power or fluorescence emission spectrum change after individual or multiple amino acid sites mutation, but can still be urged using luminous energy
Change the mutant protein of the cracking of water and the reduction of 2,3,5- trimethyl -1,4- 1,4-benzoquinone.
It is described polynucleotides are transformed into algae method to include in another preference：Will containing coding light energy absorption and
The expression cassette of the polynucleotides of transferrin is transferred in algae, so as to express above-mentioned polynucleotides in algae.It is preferred that described
Expression cassette include：The polynucleotides of at least one (can be one or more) coding light energy absorption and transferrin；It is described
Coding light energy absorption and the polynucleotides of transferrin be connected with expression regulation element operability.
In another preference, described light energy absorption and the polynucleotides of transferrin are turned by way of homologous recombination
Change enters algae；More preferably so that the polynucleotides of light energy absorption and transferrin are incorporated on plant thylakoids film.
In another preference, described improvement algae character is selected from following one or more：Improve the biomass of algae；
Promote algal grown；Improve the light utilization ratio of algae；Increase algae PSI or PSII Photochemical Efficiency；Increase algae photosynthetic
Electron transmission efficiency；Algae is improved to CO2Assimilative capacicy；Improve the Net photosynthesis rate of algae；Improve the photosynthetic organs of algae
Light protective capability；Improve the content of biliproteins (including carotenoid) in algae；Or improve the photosynthetic oxygen evolution of algae
Speed.
In another preference, described algae is Eukaryotic Algae or protokaryon algae.
Described algae contains Photosynthetic or contains chlorophyll.
In another preference, described algae is microalgae；More preferably, described microalgae is selected from：Cyanophyta, Chlorophyta,
Chrysophyta, Rhodophyta, Euglenophyta, Pyrrhophyta, Cryptophyta, golden Xanthophyta, Phaeophyta or charophyta.
In another aspect of this invention there is provided light energy absorption and transferrin or coding light energy absorption and transferrin it is many
The purposes of nucleotides, for improveing algae character.
In a preference, described light energy absorption and transferrin is selected from：Fluorescin or non-fluorescence chromophoric protein.
In another aspect of this invention there is provided a kind of algae of improvement, its genome includes light energy absorption and transmission egg
White expression cassette.It is preferred that the algae of described improvement is transgenosis algae, it is prepared by foregoing any method.
In another aspect of this invention there is provided a kind of algae, the one or more containing external source in the cell of the algae
Encode the polynucleotides of light energy absorption and transferrin.
In another preference, described algae is the algae of non-plant.
The other side of the present invention, due to this disclosure, is apparent to those skilled in the art
's.
Brief description of the drawings
Fig. 1, illumination reduce NAD to YFP+Or NADP+Influence.Exist shown in figure for the front and rear NADH and NADPH that opens the light
The change of absorption value at 340nm.
2 are catalyzed under Fig. 2, YFP, CFP, BFP and GFP light, the reduction vigor of 3,5- trimethyls-Isosorbide-5-Nitrae -1,4-benzoquinone (TMBQ)
Compare.50mM phosphate buffer (pH6.5), TMBQ, 400 μM, fluorescent protein concentration is 25nM.Rate of reduction is in 1-2 μm of ol
m-2s-1Determined under respective exciting light.
The Intensity response curve of oxygen is put in YFP and GFP catalysis water-splitting under Fig. 3, TMBQ existence condition.TMBQ：2,3,5- tri-
Methyl isophthalic acid, 4- 1,4-benzoquinone；Reaction rate is represented with the molecular number of each protein molecular conversion per minute.Reaction system is：50mM
Phosphate buffer (pH6.5), YFP, 10nM (final concentration, similarly hereinafter)；GFP, 1 μM；TMBQ, 400 μM,；Light intensity：0.6-1μmol
m-2s-1。
The Intensity response curve that oxygen vigor is put in water-splitting is catalyzed under Fig. 4, TMBQ existence condition under mCherry and GFP light.
TMBQ：2,3,5- trimethyl -1,4- 1,4-benzoquinone；Reaction system is：50mM phosphate buffer (pH6.5), mCherry, 10nM；
GFP, 1 μM；TMBQ, 400 μM；Light intensity：0.6-1μmol m-2s-1。
Fig. 5, fluorescin GFP, YFP, CFP and BFP put the TMBQ concentration-response curves of oxygen vigor.50mM phosphoric acid buffer
Liquid (pH6.5), GFP, 1 μM；Other fluorescins, 10nM, TMBQ, 400 μM；Light intensity：0.6-1μmol m-2s-1。
The comparison of oxygen vigor is put in catalysis water-splitting under YFP (A) and mCherry (B) light under Fig. 6, different quinone existence conditions.
BQ：1,4- 1,4-benzoquinone；MBQ：Methyl isophthalic acid, 4- 1,4-benzoquinone；DMBQ1：2,5- dimethyl -1,4- 1,4-benzoquinone；DMBQ2：2,6- diformazans
Base -1,4- 1,4-benzoquinone；TMBQ：2,3,5- trimethyl -1,4- 1,4-benzoquinone；DQ：Duroquinone or tetramethyl -1,4- 1,4-benzoquinone；UQ：2,3-
Methoxyl group -5- methyl isophthalic acids, 4- 1,4-benzoquinone.Reaction system is：50mM phosphate buffers, pH6.5；YFP, 10nM；MCherry,
5nM；Light intensity：0.6-1μmol m-2s-1。
Fig. 7, YFP (A, B) and mCherry (E, F) and its mutant absorption spectrum, (B) be A figures in YFPmu4 and
The amplification of YFPmu7 parts；(F) it is the amplification of mCherrymu4 and mCherrymu7 parts in E figures.YFP (C) and mCherry
(G) and its mutant fluorescence spectrum；YFP (D) and mCherry (H) and its mutant splitting water under light put oxygen vigor.
(A,B,C,E,F,G)：Light absorbs and fluorescence intensity are compared under same protein concentration, with the YFP or mCherry before mutation
The intensity of absorption peak be 1, the intensity of fluorescent emission peak value is 100.
The different fluorescent protein sequences of Fig. 8, GFP series compare.
The mutain light decentralization oxygen that end is removed after Fig. 9, the amino acids point mutation of (A) YFP protein 23s 2 and 231 is lived
The comparison of power.(B) GFP albumen with its 231 after end remove point mutation light transfer oxygen vigor comparison.YFP L232H and
GFP protein concentrations are 1 μM, and other protein concentrations are 10nM, and TMBQ concentration is 400 μM, in 1-2 μm of ol m-2s-1Surveyed under exciting light
It is fixed.
Figure 10, (A) cytochromes f (Cytf) and matter blue (PC) concentration dependant, plastoquinone analog 2,3,5- trimethyls
(PQ) YFP of mediation under Cytf and PC light to reducing.Under conditions of no addition PQ, YFP can not be catalyzed under light no matter
It is the reduction of cytochromes f or plastocyanin；(B) the cytochromes f of PQ mediations is catalyzed under YFP light and the light of plastocyanin reduction rings
Answer curve.
The cytochromes f (A and B) of PQ mediations is catalyzed under Figure 11, CFP, GFP, mCherry, YFP and YFP point mutation body light
With the comparison of plastocyanin (C and D) reducing activity.
Figure 12,110 kinds of cnidarias (Cnidarian) and arthropods (Arthropoda) source fluorescin and non-glimmering
Photoproduction chromoprotein chadogram (selects from Alieva et al., 2008).Stain represents fluorescence egg selected in the present invention in figure
In vain.These fluorescins are belonging respectively to A on chadogram, B, C, the different branch such as D.
The systematic evolution tree of all LEAT albumen used in Figure 13, (A) present invention.(B) all LEAT used in the present invention
The sequence homology of albumen compares, wherein 1 corresponding eqFP611,2 corresponding hcriCP, the like.
Figure 14, (A) PsbC- fluorescin fusions blue-green algae conversion plasmid construction schematic diagram.YFP fragments are inserted into PsbC
The C-terminal of gene, constructs the pPsbC-YFP plasmids for converting blue-green algae.It is the restriction enzyme site used that arrow, which show clone,.
Sp (Streptomycin) represents streptomycin resistance marker.(B) PsbC-YFP fusions integration.Utilize Natural Transformation side
Method is converted pPsbC-YFP plasmid pair Cells of Blue-green Algae, and then the setting-out on the agar plate containing corresponding antibiotic, puts
Cultivated in the incubator of blue-green algae, after the clone for obtaining conversion, enter performing PCR identification, in the culture containing 100 μ g/ml streptomysins
The culture more than three generations is carried out in base, so as to which the background of wild type is removed, finally cell is transferred to containing 20 μ g/ml streptomysins
Middle culture.Figure is the PCR identifications of PsbC-YFP transgenic blue algaes.2.7kb fragments shown in upper arrow are the purpose base of insertion
Because (psbC-YFP) adds the fragment of resistant gene, the 1.0kb fragments shown in the arrow of lower section are PsbC genes.
Cell after the far-red light closing of the time dependent green glow induction of Figure 15, transgenic blue algae PsbC-YFP thylakoid membranes
The dynamics of oxidation reduction change of pigment f and plastocyanin.Black line is wild type；Red line is PsbC-YFP.(A) green glow is induced
Far-red light close after cytochromes f dynamics of oxidation reduction change (with 554.5nm light absorbs become turn to index), i.e.,
The increase of 554.5nm light absorbs represents the reduction of cytochromes；(B) oxidation of the plastocyanin after the far-red light of green glow induction is closed is also
Motive power change (is become with 598nm light absorbs and turns to index), the reduction for being reduced to plastocyanin of 598nm light absorbs.Due to original
The photosynthetic electron transport chain and respiratory electron transport chain of core photosynthetic organism blue-green algae share plastoquinone, and this two approach are interdependence phases
The relation mutually restricted.Under normal operation, the reduction due to the electronics from respiratory substrate to plastoquinone storehouse, cytochromes f and matter
The electronics such as Lan Su pass body and are in reducing condition, it is necessary to excite Photosystem I to aoxidize plastoquinone storehouse using far-red light, after emptying electronics,
Just it is observed that the electronics of photoinduction passs the change of the dynamics of oxidation reduction of body.Compared with wild type, YFP transgenic blue algae
Cytochromes f present and be first oxidized the change that is reduced afterwards, and the change for being first reduced and being oxidized afterwards is then presented in plastocyanin, this
It is due to that the electronics that plastoquinone storehouse is accumulated in after far-red light is closed continues to pass the result of body transmission to the two electronics, in addition, matter is blue
Element is that mobile electronics passs body, and its oxidized cytochrome f reaction is rapid so that the two electronics are passed body and presented conversely
Redox trend.The change of these dynamics of oxidation reduction is by its exciting light --- and 520nm green glow promotes, and illustrates
YFP can photo-reduction plastoquinone, and then to the electronics such as cytochromes f and plastocyanin pass body provide electronics.
Figure 16, green glow induce the photosynthetic oxygen evolution of transgenic blue algae active somatic cell.Due in protokaryon photosynthetic organism blue-green algae, light
Close electron transport chain and respiratory electron transport chain shares plastoquinone, they are the relations that interdependence is mutually restricted.Darkling, come from
Substrate of respiration NAD (P) H electronics reduces oxygen molecule via plastoquinone, shows oxygen uptake reaction, and under light, is accumulated in plastoquinone storehouse
Electronics will pass to Photosystem I, cause Photosystem I I put oxygen reaction.It is wild under conditions of no addition inhibitor
Type and transgenic blue algae cell PsbC-YFP show oxygen uptake respiration in the dark, after green glow to cell irradiation 520nm,
PsbC-YFP oxygen uptake is suppressed, but the oxygen uptake of wild-type cell is not affected；In respiratory electron transport chain NDH suppression
In the presence of agent mercury chloride, the oxygen uptake of respiration is suppressed, and the oxygen of putting that PsbC-YFP shows green glow induction reacts, and wild
Type does not have the traffic order regularity that green glow is induced.This further demonstrates YFP can as a kind of allochlorophyll a antenna beam and
Reaction center pigment, the green energy absorbed is converted into chemical energy, participates in photosynthesis.
Figure 17, the photosynthetic capacity of transgenic blue algae compare.(A) excited energy distribution is the intensity of variation of State Transferring；(B) light
The immunoblotting assay of hop protein changes of contents；(C) blue-green algae Light harvest antenna chromoprotein algocyan (phycoerythrin) and algae
The content of red pigment (phycocyanin)；(D) Photosystem I and Photosystem I I quantum efficiency (Φ PSI, Φ PS II), Yi Jizhi
The redox state parameter (1-1-qL) in quinone storehouse;(E) NADPH Photosynthetic rate；(F) photophosphorylation speed；(G) it is photosynthetic
Carbon assimilation key enzyme Rubisco carboxylation activity.
Figure 18, blue algae growth light quality.Black line is fluorescent lamp spectrum, and red line is incandescent lamp spectrum.
Figure 19, (A) PsbC-YFP transgenic blue algaes are in the case where lacking the fluorescent lamp of blue green light and incandescent lamp rich in green glow
Growth phenotype and growth rate compare.Growth of the PsbC-YFP transgenic blue algaes under first two light quality is fast all than wild type, especially
It is that growth vigor than wild type under incandescent lamp becomes apparent from.(B) PsbC-YFP transgenic blue algaes are put with wild type net photosynthesis
The comparison of oxygen speed.Left figure is under fluorescent lamp, right figure is under incandescent lamp.(C) PsbC-YFP transgenic blue algaes and wild type blue-green algae
The comparison of respiratory rate.Left figure is under fluorescent lamp；Right figure is under incandescent lamp.
Embodiment
The present inventor passes through in-depth study, develops a kind of improvement for the purpose of the optical energy utilization efficiency for improving algae
The new method of algae, methods described passes through the amalgamation and expression external source on thylakoid membrane system II peripheral proteins PsbC in algae
Light energy absorption and transferrin (Light Energy Absorption and Transduction protein, LEAT eggs
In vain), under light catalytic water cracking, while long-living electronics will be cracked and proton transfer gives plastoquinone on algae thylakoid membrane
(plastoquinone) etc., and oxygen is discharged, this process is additionally provided lasting electronics under light for photosynthetic electron transport chain
Source, changes electron transport rate and oxygen also reducing condition in alginite, causes photosynthetic related gene expression in alginite
Change, so as to improve algae optical energy utilization efficiency.
Term
As used herein, described " Ameliorative character " refers to the characteristic of the algae of improvement, includes but are not limited to：Improve algae
Efficiency of light absorption, promote algal grown, improve CO2Utilization rate, enhanced phototranstormation efficiency, enhanced photosynthesis assimilation effect
Rate, enhanced optical protection mechanism, increase biomass and/or yield etc. feature.The importance of the present invention, Ameliorative character
It is to promote algal grown or improve algae bio amount, is included in raising under no environment-stress pressure condition and in environmental pressure bar
Raising under part.Environment-stress pressure condition can include, and such as sunshine is not enough, high light intensity, high ultraviolet radioactive condition, high temperature, height
Biological density." yield " can be influenceed by many features, including biology is to efficiency of light absorption, phototranstormation efficiency, photosynthetic carbon assimilation
Efficiency, the influence of the feature such as the accumulation of biomass.
As used herein, " improvement of algae character ", " character of improvement " " the algae character of improvement ", " character improvement ",
" algae character improvement " etc. can refer to compared with not improveing preceding algae (such as wild type algae), through the present invention change with equivalent substitute
Good algae efficiency of light absorption is improved, phototranstormation efficiency strengthens, photosynthetic carbon assimilatory efficiency strengthens, optical protection mechanism enhancing, organ
Number or size to favourable direction change, construct to favourable direction change, improve economic flow rate, biomass improve and/
Or output increased etc..
As used herein, term " yield " can be related to the nutrition biomass of algae, be related to organ of multiplication and/or be related to numerous
Grow body.
" Correlated Yield Characters " include but is not limited to biomass, yield etc..
As used herein, term " raising ", " improvement " or " enhancing " be can mutually exchange and application implication on
It should mean compared with the control algae being defined herein, at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably
The characters such as at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more increments.
As used herein, the derivative of various types of methyl quinones is widely present in organism, some methyl quinones are metabolism
During intermediate product, some then itself participate in organism in various basic metabolism and the regulation and control of secondary metabolism.Wherein " plastid
Quinone " (plastoquinone, PQ) is exactly a kind of derivative of methylbenzoquinone.2 methyl of the quinone ring first line of a couplet, have a side chain to join not
With the isoprene unit of number.There are several PQ in photosynthetic organism body, their difference is that isoprene unit numbers are different.PQ
It is widely present in chloroplaset and kytoplasm, such as rough surfaced endoplasmic reticulum (RER).Most in chloroplaset is PQ9.In photosynthetic chain, it can both pass
Electronics is passed, proton can be transmitted again, its redox reaction：Oxidation-reduction potential is about ± 0.1 volt.The PQ of oxidized form is from thylakoid
The outer side of film receives electronics, and is combined with proton outside film, and inwardly diffusion, is aoxidized on the inside of film by cytochromes f thereafter, is handed over
Go out electronics, while proton release to film inner chamber.I.e. with PQ oxidations and reduction, proton is crossed film outside film and enter film
Inner chamber.Proton gradient is relevant with photophosphorylation inside and outside film caused by the movement of this kind of proton.
" light " specifically described herein, in addition to referring to wave-length coverage from the electromagnetic wave in 400-760nm visible-range, also
Including wave-length coverage be 300-400nm ultraviolet and 760nm-1000nm near infrared ray electromagnetic wave." luminous energy ", refers to
Above range, i.e. 300-1000nm, electromagnetic wave energy.
As used herein, described " light energy absorption and transferrin (LEAT albumen) " is a class by its own constitutive protein
The chromophore that the amino acid residue of matter sequence is constituted absorbs 300-1000nm electromagnetic wave, and the energy of the electromagnetic wave absorbed
Amount (as described in above-mentioned usage, hereinafter referred to as " luminous energy ") is converted into the albumen of chemical energy.The process for being converted into chemical energy
For, after luminous energy is absorbed, by the cracking of catalytic water will crack the electronics produced and proton transfer to related methyl quinone and its
The albumen of derivative, reduction methyl quinone and its derivative.The methyl quinone and its derivative include, TMBQ (2,3,5- trimethyls-
1,4- 1,4-benzoquinone), DMBQ2 (2,6- dimethyl -1,4- 1,4-benzoquinone), MBQ (methyl isophthalic acid, 4- 1,4-benzoquinone) and DMBQ1 (2,5- diformazans
Base-Isosorbide-5-Nitrae -1,4-benzoquinone), it is preferred that TMBQ (2,3,5- trimethyls-Isosorbide-5-Nitrae -1,4-benzoquinone).
The lower limit wavelength for the electromagnetic wave that LEAT is absorbed is 300nm, preferably, 320nm, 340nm, 350nm, 360nm are more
Good, 370nm, 380nm, 390nm, 400nm, 410nm or 420nm；The upper limit is 1000nm, preferably, 950nm, 900nm,
850nm, 800nm, more preferably, 750nm, 700nm, 680nm, 660nm, 650nm, 640nm, 630nm or 620nm.
The LEAT albumen preferably is selected from：
Fluorescin or its through one or more (such as 1-30；Preferably 1-20；More preferably 1-10；More preferably 1-5
It is individual) fluorescence is strong and weak after amino acid sites mutation or fluorescence emission spectrum changes, but can still utilize luminous energy catalytic water
Cracking completes reduction or its analog of methyl quinone derivative (such as 2,3,5- trimethyls -1,4- 1,4-benzoquinone or plastoquinone) simultaneously
Mutant protein；Or
Non-fluorescence chromophoric protein its through one or more (such as 1-30；Preferably 1-20；More preferably 1-10；More preferably
Ground 1-5) catalysis methyl quinone derivative is (for example while water-splitting can be still catalyzed using luminous energy after amino acid sites mutation
2,3,5- trimethyl -1,4- 1,4-benzoquinone or plastoquinone) reduction or its analog mutant protein.
The fluorescin refers to naturally occurring or synthesized albumen, without additional confactor, can be by certain wavelength
Light excites and launches fluorescence.
The non-fluorescence chromophoric protein refers to naturally occurring or synthesized albumen, without additional confactor, can absorb
The light of certain wavelength, and with the albumen for not launching fluorescence after absorption luminous energy.With any prothetic group or confactor or pass through
Any prothetic group or confactor absorb the chromophoric protein of luminous energy, such as：Hemoglobin, flavoprotein, cytochrome protein etc., not
In the range of non-fluorescence chromophoric protein of the present invention.
Above-mentioned fluorescin and non-fluorescence chromophoric protein all have similar three-dimensional cylinder structure, the big portion of its polypeptide backbone
Divide the β-lamella for being folded into 11 hydrogen bonds links, center is the α spirals comprising chromophore, and it can rely on the ammonia of its own
Base acid sequence can just form chromophore's structure to absorb and launch luminous energy.
Heretofore described fluorescin preferably is selected from：Blue fluorescent protein, cyan fluorescent protein, green fluorescent protein,
Yellow fluorescence protein, red fluorescent protein, far-red light fluorescin, near-infrared fluorescent albumen.
Described " blue fluorescent protein " (Blue Fluorescent Protein, BFP) is that emission peak is located at 440-
470nm fluorescin；Such as SEQ ID NO:Blue fluorescent protein shown in 4.
Described " cyan fluorescent protein " (Cyan Fluorescent Protein, CFP) is that emission peak is located at 470-
500nm fluorescin；Such as SEQ ID NO:10 or SEQ ID NO:Cyan fluorescent protein shown in 36.
Described " green fluorescent protein " (Green Fluorescent Protein, GFP) is that emission peak is located at 500-
525nm fluorescin；Such as SEQ ID NO:6、SEQ ID NO:28、SEQ ID NO:40 or SEQ ID NO:It is green shown in 44
Color fluorescin.
Described " yellow fluorescence protein " (Yellow Fluorescent Protein, YFP) is that emission peak is located at 525-
570nm fluorescin；Such as SEQ ID NO:8 or SEQ ID NO:Yellow fluorescence protein shown in 50.
Described " red fluorescent protein " (Red Fluorescent Protein, RFP) is that emission peak is located at 570-
630nm fluorescin；Such as SEQ ID NO:Red fluorescent protein shown in 2；Such as SEQ ID NO:2、SEQ ID NO:30、
SEQ ID NO:34、SEQ ID NO:42 or SEQ ID NO:Red fluorescent protein shown in 46.
Described " far-red light fluorescin " (Far-red Fluorescent Protein) is that emission peak is located at 630-
760nm fluorescin.
Described " near-infrared fluorescent albumen " (Near Infra-red Fluorescent Protein) is transmitting peak position
In 760-900nm fluorescin；Such as SEQ ID NO:32 or SEQ ID NO:Near-infrared fluorescent albumen shown in 48.
Described " non-fluorescence chromophoric protein " (non-fluorescent chromoprotein) such as SEQ ID NO:38 institutes
The non-fluorescence chromophoric protein shown.
As used herein, " expression " refers to polynucleotides (one or more) or expression cassette containing polynucleotides to mRNA
Transcription, with or without the subsequent translation of the latter to protein.The process includes DNA transcription and adding for the mRNA products obtained
Work.
As used herein, term " introducing " or " conversion " include exogenous polynucleotide being transferred into host cell, do not consider
The method of transfer.
Alien gene, which is transferred into host genome, to be referred to as converting.The conversion of living species is currently a kind of quite conventional
Technology.It can be advantageous to use any to appropriate host cell introducing target gene of some method for transformation.Can profit
Instantaneous or stable conversion is carried out with disclosed method for transformation and by the method for biological tissue or neomorph.Method for transformation bag
Include the chemical substance absorbed using liposome, electroporation, increase dissociative DNA, directly inject DNA, particle gun/particle gun to algae
Bombardment, with virus or pollen transformation and microparticle bombardment.Method can be selected from calcium/polyethylene glycol method for protoplast
(Krens, F.A. etc., (1882) Nature296,72-74；Negrutiu I. etc., (1987) Plant Mol.Biol.8:363-
378)；The electroporation (Shillito R.D. etc., (1985) Rio/Technol3,1099-1102) of protoplast；Plant material
Microinjection (Crossway A. etc., (1986) Mol.Gen Genet202 of material:179-185)；The coated particles of DNA or RNA
Bombard (Klein T.M. etc., (1987) Nature327:70)；With (circles) virus infection, etc..
On " control algae ", the suitable control algae of selection is the customary part of experimental design, can be included corresponding
Wild type algae or the corresponding transgenosis algae without target gene.Control algae be usually identical algae species or even with
Algae identical kind to be assessed.It can also be the individual that transgenosis algae is lost because of separation to compare algae.As used herein
Control algae refer not only to complete algae, also refer to algae part.
Term " increased expression " " overexpression " used herein or " ectopic expression " refer to relative to original wild table
Extra any type of expression outside up to level.
As used herein, " expression cassette " herein refers to recombinant DNA molecules, and it includes expected nucleic acid coding sequence, this
Individual sequential coding light energy absorption and transferrin；This DNA molecular also comprising transcription, compile in vitro or in vivo by exercisable connection
Necessary to code sequence or expected suitable controlling element." controlling element " refers herein to controllable nucleotide sequence expression
Nucleotide sequence.Promoter, transcription terminator or upstream regulation area can be included as the controlling element of model, these regulation and control
Element contributes to duplication, transcription, posttranscriptional modification of nucleic acid etc..In addition, controlling element can also include：Enhancer, interior ribose
Body entry site (IRES), replication orgin, polyadenylation signal etc..
As used herein, described " being operatively connected " or " being operably coupled to " refers to such a situation, i.e. linear DNA
Some parts of sequence can adjust or control the activity of same linear DNA molecule other parts.If for example, promoter is controlled
The transcription of sequence, then it is exactly to be operably coupled to coded sequence.
As used herein, " external source " or " heterologous " gene or albumen refer to not be naturally contained in primary object gene
Gene or albumen in group.Described " encoding gene of foreign protein " is also referred to as " allogeneic dna sequence DNA ", refers to thin in given host
Originally non-existent a kind of DNA molecular, an or DNA molecular group in born of the same parents；Or refer to DNA molecular different from particular host cell.
As used herein, described " containing ", " having " or " comprising " include "comprising", " mainly by ... constitute ",
" substantially by ... constitute " and " by ... constitute "；" mainly by ... constitute ", " substantially by ... constitute " and
" by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising ".
LEAT albumen
Present inventors have surprisingly found that, a series of light energy absorptions and transferrin (LEAT albumen) can be catalyzed under light
The cracking of water and the reduction of plastoquinone analog (such as to 2,3,5 trimethyls-Isosorbide-5-Nitrae -1,4-benzoquinone), while releasing oxygen.Therefore
LEAT albumen is on algae thylakoid membrane after integrant expression, and its electronics that the reaction of catalytic pyrolysis water is sustainably produced under light is used
Plastoquinone in reduction photosynthetic electron transport chain downstream, the plastoquinone of reduced form can provide extra electronics source and participate in photosynthetic electricity
Various redox states in son transmission, regulation and control frond, regulate and control the expression of related gene, promote the growth of algae, improve algae
The character of class.
A variety of light energy absorption and transferrin (LEAT) albumen can be applied to the present invention, as long as it is the energy for absorbing photon
More than the albumen of energy needed for splitting water, or the albumen of 300-1000nm wavelength can be absorbed.It is known in the art that in standard conditions
Under, 1 molecular water, which resolves into oxygen and 2 electronics and 2 protons, needs 1.23 electron-volts of luminous energy, therefore LEAT absorbing proteins photons
As long as energy more than the energy needed for splitting water, that is, 1.23 electron-volts with regard to this reaction, the electronics of releasing can be driven
With mediation of the proton by this kind of naphtoquinone compounds, the oxidation material in Reduction Body.Therefore, there is luminous energy the present invention relates to a series of
The albumen of function is absorbed and transmitted, includes absorbing the transmitting of optical wavelength radiation and does not launch the GFP of fluorescence, it is such as green, yellow
Color, red fluorescent protein and its mutant, they can be used in improving the efficiency of light energy utilization of algae, and pole significantly increases biology
Amount.
As the preferred embodiment of the present invention, described LEAT albumen includes：Blue fluorescent protein, cyan fluorescent protein is green
Color fluorescin, yellow fluorescence protein, red fluorescent protein or far-red light fluorescin or non-fluorescence chromophoric protein.
Fluorescin is the albumen that a class can light under proper condition, and its chromophore is by constituting its protein sequence
Amino acid residue is constituted.It is primarily used to mark eucaryotic cell structure and monitors intracellular process in the prior art, and it is additionally operable to carefully
The tracing in vivo of born of the same parents colony, such as tumour cell.The green fluorescent protein (GFP) occurred earliest is in a kind of scientific name in 1962
Found in Aequorea victoria jellyfish, afterwards the isolated GFP in marine coral worm again.Subsequent research is again
In Anthozoa (Actinozoa) in Coelenterata, a series of different spectral characteristics are found that in such as coral and sea anemone
Fluorescin.All fluorescins all have similar three-dimensional cylinder structure, and its polypeptide backbone is largely folded into 11
β-lamella of bar hydrogen bond link, center is the α spirals comprising chromophore.So far, fluorescin passes through genetic engineering hand
A series of derivative has been developed in the transformation of section, and their emission spectrum has covered whole visible region (400- substantially
760nm) near infrared light area (760-900nm).It is thus preferable to, fluorescin is that tertiary structure is 11 strands of beta sheet compositions
Beta-barrel structure around the alpha-helix comprising chromophore.
The fluorescin refers to naturally occurring or synthesized albumen, without additional confactor, itself amino acid
The chromophore of composition can be excited by the electromagnetic wave of a wavelength range and launch visible ray.On the other hand, the fluorescence
Albumen can be from coelenterate, such as jellyfish, coral polyp or sea anemone, the fluorescin and its derivative of middle separation；On the other hand,
The fluorescin is the green fluorescent protein (Swiss-Prot from Aequorea:P42212) and its derivative, such as SEQ
ID NO:BFP shown in 4；Or the fluorescin also may be from Discosoma sp. red fluorescent protein (DsRed)
(Swiss-Prot:Q9U6Y8) or derivatives thereof, such as mCherry.
Heretofore described non-fluorescence chromophoric protein has similar structure with above-mentioned fluorescin, can absorb certain
The luminous energy of wavelength, but the ability of its wild-type protein transmitting fluorescence is extremely weak.
At present, GFP, RFP, BFP etc. are widely used in Biological imaging research, positioning of the report albumen in tissue and cell
(Shaner NC, Patterson GH, Davidson MW.2007Advances in fluorescent
proteintechnology.J Cell Sci.15;120(Pt24):4247-4260；MCherry Shaner NC,
Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. (2004) Improved
Monomeric red, orange and yellow fluorescent proteins derived from Discosoma
sp.red fluorescentprotein.Nat Biotechnol.22(12):1567-72).But, there is presently no technology
These fluorescins or non-fluorescence chromophoric protein are used to prepare transgenosis algae improve the photosynthetic efficiency of algae by personnel.
As the preferred embodiment of the present invention, described LEAT albumen is：Blue fluorescent protein (Blue
FluorescentProtein, BFP), cyan fluorescent protein (Cyan Fluorescent Protein, CFP), green fluorescence egg
In vain (GreenFluorescent Protein, GFP), yellow fluorescence protein, red fluorescent protein (Red Fluorescent
Protein, RFP), or remote red fluorescent protein or non-fluorescence chromophoric protein.The variant of above-mentioned fluorescin can also be applied to
In the present invention.The variant of above-mentioned fluorescin although larger change occurs for fluorescence intensity, but still can in methyl quinone or
Its derivative utilizes the cracking reaction of luminous energy catalytic water under conditions of existing, discharge oxygen, and lasting generation also proper energy is simultaneously stored
In quinone, therefore they can also apply to the present invention.
As another preferred embodiment of the present invention, described fluorescin is selected from, but not limited to,：Yellow fluorescence protein
(Yellow Fluorescent Protein), red fluorescent protein (Red Fluorescent Protein, RFP), or it is remote red
Light fluorescin (Far-red Fluorescent Protein).It should be understood that the method for the present invention is come by using fluorescin
The wavelength or spectral energy of swing absorption light realize technique effect, so any can be excited and be launched by 495-620nm light
The fluorescin that peak is located between 550-700nm all has the optical characteristics similar with RFP, can convert the low light of algae utilization rate
For the high light of photosystem utilization ratio, so as to applied to the present invention, for example：(excitation peak is 487/504nm to mHoneydew, hair
Peak is penetrated for 537/562nm), mBanana (excitation peak is 540nm, and emission peak is 553nm), mOrange (excitation peak is 548nm,
Emission peak is 562nm), dTomato (excitation peak is 554nm, and emission peak is 581nm), (excitation peak is 554nm to tdTomato, hair
Peak is penetrated for 581nm), mStrawberry (excitation peak is 574nm, and emission peak is 596nm), mCherry (excitation peak is 587nm,
Emission peak is 610nm), mPlum (excitation peak is 590nm, and emission peak is 649nm), (excitation peak is 584nm, emission peak to mRFP1
For 607nm), mTangerine (excitation peak is 568nm, and emission peak is 585nm).
Described " green fluorescent protein ", " cyan fluorescent protein ", " blue fluorescent protein " also include " synergy it is green glimmering
Photoprotein ", " cyan fluorescent protein of synergy ", " blue fluorescent protein of synergy ".
Described " cyan fluorescent protein " can for example have the amino acid sequence shown in GenBank accession number AAQ96626
Or it is substantially the same with its；Or by the amino acid sequence by the substitution of one or more amino acid residues, missing or addition
Formed, and the albumen of the albumen identical function with the sequence；Or with amino acid sequence shown in GenBank accession number AAQ96626
The sequence homology of the albumen of row is higher than 70%, and with the albumen of improvement algae character function.
Described " yellow fluorescence protein " can for example have the amino acid sequence shown in GenBank accession number ADR00308
Or it is substantially the same with its；Or by the amino acid sequence by the substitution of one or more amino acid residues, missing or addition
Formed, and the albumen of the albumen identical function with the sequence；Or with amino acid sequence shown in GenBank accession number ADR00308
The sequence homology of the albumen of row is higher than 70%, and with the albumen of improvement algae character function.
Described " far-red light fluorescin " can for example have the amino acid sequence shown in GenBank accession number ACH06541
Row are substantially the same with its；Or by the amino acid sequence is by the substitution of one or more amino acid residues, missing or adds
Formed by, and the albumen of the albumen identical function with the sequence；Or with amino acid shown in GenBank accession number ACH06541
The sequence homology of the albumen of sequence is higher than 70%, and the albumen of the albumen identical function with the sequence.
Described " non-fluorescence chromophoric protein " can for example have GenBank accession number DQ206394 (gfasCP),
AF363776 (hcriCP), AY485336 (anm2CP) etc..
In the present invention, LEAT albumen used can be naturally occurring, such as it can be separated or be purified from low
Biology, such as Coelenterata.In addition, described LEAT albumen can also be prepared manually, such as can be according to conventional base
The LEAT albumen produced by engineering recombinant technique.It is preferred that, the present invention can be using the LEAT albumen recombinated.It is any suitable
LEAT albumen is used equally for the present invention.Described LEAT albumen includes the LEAT albumen or its bioactive fragment of total length.By open country
The amino acid sequence of raw type LEAT albumen is by one or more (such as 1-30；Preferably 1-20；More preferably 1-10；More
Good ground 1-5) amino acid residue substitution, missing or addition formed by, and the egg of the albumen identical function with the sequence
In vain；Or it is higher than 70%, and the egg with wild-type protein identical function with the sequence homology of the albumen of wild-type amino acid sequence
In vain.LEAT albumen or its bioactive fragment include the alternative sequence of a part of conserved amino acid, described through amino acid substitution
Sequence has no effect on its light energy absorption and transmission characteristic.Appropriate amino acid of replacing is technology well known in the art, and the technology can
To be easily carried out and ensure the bioactivity for not changing gained molecule.These technologies recognize those skilled in the art,
In general, bioactivity will not substantially be changed by changing single amino acids in a kind of unwanted regions of polypeptide；See Watson
Deng Molecular Biology of The Gene, fourth edition, 1987, The Benjamin/Cummings
Pub.Co.P224.The bioactive fragment of any LEAT albumen can be applied in the present invention.Herein, LEAT eggs
The implication of white bioactive fragment refers to that as a kind of polypeptide it still can keep all or part of the LEAT albumen of total length
Function.Under normal circumstances, described bioactive fragment at least keeps the activity of 50% total length LEAT albumen.Preferred
Under the conditions of, the active fragment can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% work of total length LEAT albumen
Property.The present invention can also use the LEAT albumen through modifying or improveing, such as, can use to promote its half-life period, validity, generation
Thank, and/or albumen effect and the LEAT albumen being modified or improved.That is, any do not influence the light of LEAT albumen
The version that can be absorbed and transmit can be used in the present invention.
Fluorescin of the present invention can also be used to improve algae universality energy, including：Improve the luminous energy of algae
Utilization ratio；Increase algae PSI or PSII Photochemical Efficiency；Increase algae photosynthetic electron transfer efficiency；Algae is improved to CO2
Assimilative capacicy；Improve the Net photosynthesis rate of algae；Improve the optical protection mechanism of the photosynthetic organs of algae；Promote algal grown；
Improve the biomass of algae；Increase the total protein concentration of algae；Improve algae yield.Above-mentioned algae Character change is for algae species
Improvement be highly profitable.
The method for improveing algae character
The invention provides a kind of method for improveing algae character, methods described includes：In algae thylakoid membrane system II
The LEAT albumen of amalgamation and expression external source on peripheral protein PsbC.The LEAT albumen of external source and the plastoquinone in alginite and its similar
Thing together, spontaneously forms a new artificial photoreaction system, by the cracking of catalytic water, the luminous energy of absorption is converted into reduction
It can be stored in quinone molecule, and release oxygen, and the quinone molecule of reproducibility is originated as extra electronics, can participate in algae
Photosynthetic electron transfer, regulation and control in vivo a series of redox reaction, while also using some LEAT absorbing proteins some to algae
The harmful ray of class, such as ultraviolet or high intensity blue light protects the Photosynthetic under strong light to escape injury.And and then improve
The photosynthesis of algae, promotion growth improve Biomass and yield.Described LEAT albumen can be：Blue fluorescent protein,
Cyan fluorescent protein, green fluorescent protein, yellow fluorescence protein, red fluorescent protein or far-red light fluorescin or their change
Allosome.
So that the method for algae expression foreign protein is well known in the art.Generally, LEAT albumen can be carried by being transferred to
The expression cassette of encoding gene makes plant express fluorescin.
Therefore, present invention also offers a kind of expression cassette for being used to express LEAT albumen in alginite.Described expression
Box includes the coded sequence for the controlling element and LEAT albumen being operatively connected, so that when it is transferred to intracellular or is incorporated into
After in genome, LEAT albumen can be recombinantly expressed.Described expression cassette includes being operatively connected with LEAT albumen coded sequences
Promoter.Described promoter can be any promoter for instructing LEAT albumen coded sequences to be expressed in algae, for example
It is the tissue specificity or induction type of composing type (such as CaMV35S promoters).Under promoter driving, LEAT
The expression of albumen can improve utilization ratio of the algae to light.
In the present invention, the expression cassette of LEAT albumen can be plugged into recombinant expression carrier.Term " recombinant expression carrier " refers to
Bacterial plasmid well known in the art, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.
In a word, as long as can be replicated in host and stably, any plasmid and carrier can be used.
In addition, expression vector preferably includes one or more selected markers, it is used to select conversion to provide
Dihyrofolate reductase, the neomycin resistance of the phenotypic character of host cell, such as eukaryotic culture, or for Escherichia coli
Kanamycins or amicillin resistance.
Those skilled in the art understand, and the photosynthetic mechanism of algae is that closely, crucial participant is interior
The chloroplaset in portion, the luminous energy that can be absorbed is converted to reducing power, and passing body to Photosynthetic Electron provides electronics, changes their oxygen
Change reducing condition.It will be understood, therefore, that technical scheme, which goes for a variety of algae bios, is not limited solely to blue-green algae.
The major advantage of technical scheme is：
The method of the present invention can expand utilization of the algae to luminous energy, improve photosynthetic efficiency and yield.The present invention is by LEAT
Albumen is gone in algae, expands the spectral region that algae utilizes to solar energy, and extra electronics is provided by the cracking of catalytic water,
Photosynthetic electron transport chain is participated in, and changes redox state to regulate and control the expression of Photosynthetic, so as to reach raising to the sun
Optical energy utilization efficiency.Method is simple, and cost is low, and effect is good, achieves noticeable achievement.The present invention is for expanding the light utilized to solar energy
Spectral limit, improves utilization ratio of the algae to sunshine, reduces the wound of harmful radiation (ultraviolet (UV) B) and high light intensity to algae
Evil, so as to improve algae photosynthesis efficiency, final raising biomass and economic flow rate are significant.Therefore the present invention can
In terms of applied to agricultural, Biological Energy Industry.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as J. Pehanorm Brookers etc. are write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or
According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and number are calculated by weight.
I. material and method
LEAT protein sequences used and gene order
The LEAT albumen that the present invention is used includes fluorescin and not fluorescent mutant, all with similar three-dimensional circle
Column construction, its polypeptide backbone is largely folded into β-lamella of 11 hydrogen bond links, and center is the α spiral shells comprising chromophore
Rotation.Absorption spectrum covers most visible region and some ultra violet rays area (320-630nm).
MCherry gene orders such as SEQ ID NO:1.
MCherry protein sequences such as SEQ ID NO:2 (excitation wavelength 480-620nm).
BFP gene orders such as SEQ ID NO:3.
BFP protein sequences such as SEQ ID NO:4 (excitation wavelength 320-410nm).
GFP gene orders such as SEQ ID NO:5.
GFP protein sequences such as SEQ ID NO:6) (excitation wavelength 400-510nm).
YFP gene orders such as SEQ IDNO:7.
YFP protein sequences such as SEQ ID NO:8 (excitation wavelength 450-530nm).
CFP gene orders such as SEQ ID NO:9).
CFP protein sequences such as SEQ ID NO:10) (excitation wavelength 350-490nm).
Gene and protein sequence after YFP point mutation is as follows：
YFPmu2(YFPH149C Y204A) gene order such as SEQ ID NO:11.
YFPmu2(YFPH149C Y204A) protein sequence such as SEQ ID NO:12.
YFPmu4(YFPH149C F166N I168M Y204A) gene order such as SEQ ID NO:13.
YFPmu4(YFPH149C F166N I168M Y204A) protein sequence (SEQ ID NO:14).
YFPmu7(YFPS148C H149C F166N K167M I168M S203A Y204A) gene order such as SEQ ID NO:15.
YFPmu7(YFPS148C H149C F166N K167M I168M S203A Y204A) protein sequence such as SEQ ID NO:16.
YFPL232HGene order such as SEQ ID NO:17.
YFPL232HProtein sequence such as SEQ ID NO:18.
YFPL232QGene order such as SEQ ID NO:19.
YFPL232QProtein sequence such as SEQ ID NO:20.
Gene and protein sequence after mCherry point mutation is as follows
mCherrymu3(mCheryS151C S152C K167M) gene order such as SEQ ID NO:21.
mCherymu3(mCherryS151C S152C K167M) protein sequence such as SEQ ID NO:22.
mCherrymu4(mCherryS151C S152C K167M I202A) gene order such as SEQ ID NO:23.
mCherymu4(mCherryS151C S152C K167M I202A) protein sequence such as SEQ IDNO:24.
mCherrymu5(mCheryS151C S152C I166N K167M I202A) gene order such as SEQ ID NO:25.
mCherrymu5(mCherryS151C S152C I166N K167M I202A) albumen such as SEQ ID NO:26.
MGFP5 gene orders such as SEQ ID NO:27.
MGFP5 protein sequences such as SEQ ID NO:28.
EqFP611 (AY130757) gene order such as SEQ ID NO:29.
EqFP611 protein sequences such as SEQ ID NO:30.
HcriCP (AF363776) gene order such as SEQ ID NO:31.
HcriCP protein sequences such as SEQ ID NO:32.
EforCP (EU498726) gene order such as SEQ ID NO:33.
EforCP protein sequences such as SEQ ID NO:34.
EfasCFP (DQ206397) gene order such as SEQ ID NO:35.
EfasCFP protein sequences such as SEQ ID NO:36.
SpisCP (DQ206398) gene order such as SEQ ID NO:37.
SpisCP protein sequences such as SEQ ID NO:38.
ScubGFP (AY037767) gene order such as SEQ ID NO:39.
ScubGFP protein sequences such as SEQ ID NO:40.
RfloRFP (AY037773) gene order such as SEQ ID NO:41.
RfloRFP protein sequences such as SEQ ID NO:42.
RmueGFP (AY015996) gene order such as SEQ ID NO:43.
RmueGFP protein sequences such as SEQ ID NO:44.
CeriantRFP (AY296063) gene order such as SEQ ID NO:45.
CeriantRFP protein sequences such as SEQ ID NO:46.
Anm2CP (AY485336) gene order such as SEQ ID NO:47.
Anm2CP protein sequences such as SEQ ID NO:48.
PhiYFP (AY485333) gene order such as SEQ ID NO:49.
PhiYFP protein sequences such as SEQ ID NO:50.
CpGFP (AB185173) gene order such as SEQ ID NO:51.
CpGFP protein sequences such as SEQ ID NO:52.
YFP1-231Gene order such as SEQ ID NO:55
YFP1-231Protein sequence such as SEQ ID NO:56
Gene and protein sequence after GFP mutation is as follows：
GFP1-231Gene order such as SEQ ID NO:57
GFP1-231Protein sequence such as SEQ ID NO:58
The prokaryotic expression of LEAT albumen and its purifying
PCR expands mCherry full-length genes, and PCR primer after BamHI and SalI digestions with accessing pGEX-4T-1
In (GEhealthcare, Uppsala, Sweden) carrier so that GST merges the N-terminal in mCherry genes, then plasmid turns
Change E.coli BL21 (DE3) (Promega, Madison, WI).PCR amplification forward primers are:5’-
CCCGGATCCATGGTGAGCAAGGGCGAGGAG-3’(SEQ ID NO:53), reverse primer is：5’-
CCGGTCGACCTACTTGTACAGCTCGTCCATG-3’(SEQ ID NO:54).Forward and reverse primer sequence underscore part
Respectively BamHI and SalI restriction enzyme sites.
BFP full-length gene fragments are connected to pGEX-4T-1EcoRI/XhoI by pRSET-BFP through EcoRI/XhoI digestions
In point so that GST merges the N-terminal in BFP genes, then plasmid Transformed E .coli BL21 (DE3).
MCherry point mutation body genes (mCherrymu3, mCherrymu4 and mCherrymu5) obtain (gold by synthesizing
This auspicious biotechnology, Nanjing, China), two ends are distinguished during composition sequence and carry BamHI and SacI, mCherrymu3 after synthesis,
MCherrymu4 and mCherrymu5 fragments are connected to pUC57 carrier B amHI/SacI restriction enzyme sites.pUC57-mCherrymu3,
PUC57-mCherrymu4 and pUC57-mCherrymu5 is with after BamHI and SacI digestions, and fragment accesses pET30a (Novagen)
Carrier so that N-terminal of the 6XHis tag fusions in each mutators of mCherry.By plasmid Transformed E .coli BL21 (DE3) bacterial strain
In, induced expression fusion protein.
Respectively with pEYFP, pECFP (Clonetech) and p1301-GFP (Li N, Zhang D-S, Liu H-S et
al.The rice tapetum degeneration retardation gene is required for tapetum
degradation andanther development.The Plant Cell2006;18:2999-3014.) it is template, profit
With iProofHigh-Fidelity archaeal dna polymerases (Bio-rad), YFP, CFP, GFP genes and C-terminal are expanded by PCR
The YFP mutant genes of removal（YFP1-231）With GFP mutant genes（GFP1-231）, by PCR primer KpnI and SacI digestions
After be connected in pET51b carriers (Novagen), YFPmu2, YFPmu4 etc. point mutation passes through primer amplification and introduced.More than
The N-terminal fusion of gene has strep II, will the correct plasmid of sequencing be transformed into BL21-CodonPlus bacterial strains (Promega,
Madison, WI) in, with 20 °C, 0.1mlIPTG overnight inductions.
12 LEAT GFPs obtain (Jin Sirui biotechnologies, Nanjing, China) by synthesizing, and distinguish during composition sequence
Two ends carry BamHI and SacI or EcoRI and SacI restriction enzyme sites, are accessed with after BamHI and SacI or EcoRI and SacI digestions
PET30a (Novagen), N-terminal and 6XHis tag fusions.By in plasmid Transformed E .coli BL21 (DE3) bacterial strain, table is induced
Up to fusion protein.
Product description of the induced expression of above-mentioned fusion protein with reference to production firm.The albumen of purifying after desalination ,-
80 °C are stored in the PBS of the 50mM containing 10% glycerine.
The measure that oxygen speed is put in water-splitting is catalyzed under LEAT opalescences
By 1.85 milliliters of 50mM PBS (pH6.5), in the reaction tank for adding Clark type oxygen electrodes, then darkling first
After add final concentration of 0.1-1 μ g/ml LEAT albumen (GFP protein contents are about 10 μ g/ml) and 400 μM of all kinds to benzene
Quinone.Then (light intensity is about 1-2 μm of ol m under the light of its excitation wavelength-2s-1) determine it and put oxygen speed.
Fluorescin is catalyzed TMBQ reducing power assay method under light
In the quartz cuvette that 2ml50mM PBS (pH6.5) are added to 3ml four sides printing opacity.Then lucifuge is successively added eventually
Concentration is 0.02-1 μ g/ml LEAT albumen (GFP protein contents are about 20 μ g/ml) and 400 μM of -1,4- pairs of 2,3,5- trimethyls
Benzoquinones (TMBQ).Then in the respective light for being adapted to wavelength, (light intensity is about 1-2 μm of ol m-2s-1) under use UV-3000 (Japanese Shimadzus
Company Shimadzu) its OD is determined respectively436Minimizing speed is absorbed, TMBQ rates of reduction are according to its extinction coefficient at 436nm
(41.4M-1cm-1) calculated.
Rubisco enzyme activity determinations
1,5- Ribulose Bisphosphate Carboxylase/Oxygenases (ribulose-1,5-bisphosphate carboxylase/
Oxygenase, Rubisco) the active measure of carboxylation：With cushioning liquid (50mM Tris-HCl pH7.8,1mM EDTA,
50mMNaCl and 2mM β-Mercaptoethanol) the rapid extraction soluble protein from blue-green algae.Will homogenate centrifugation (4 °C, 12,
000g, 6 minutes) gained supernatant be used for analyze Rubisco vigor.With14C isotope methods determine Rubisco carboxylation activity
(Wang ZY, Snyder GW, Esau BD, Portis AR, Ogren WL (1992) Species-dependentvariation
in the interaction of substrate-bound ribulose-1,5-bisphosphate carboxylase/
oxygenase(rubisco)and rubisco activase.Plant Physiology100：1858-1862).
Cells of Blue-green Algae live body puts oxygen measure
The chlorophyll content of the photosynthetic oxygen evolution of condition of living body is every milliliter of 10-20 μ g, and light intensity is 500 μm of ol m-2s-1.It is green
The photosynthetic oxygen evolution that light is relied on is used up as 520nm, and light intensity is about 6 μm of ol m-2s-1。
Blue-green algae chlorophyll fluorescence and the redox measure of P700
Using launching-detect with 101ED-the PAM chlorophyll fluorescences instrument of colorimetric cup device (ED-101US) (Walz,
Effeltrich, Germany) determine cell chlorophyll fluorescence parameters change.Cell opens non-photochemistry after dark adaptation 30 seconds
Modulation light beam (1.6 can Hz), which measures minimum, to be worth, Fo；Cell glistened under far-red light or green glow, with saturation (XMT103,
Walz, Effeltrich, Germany) measure Fm ' fluorescence levels；Under far-red light or green glow, the steady-state level of cell fluorescence is determined
(Fs)；Fo ' values are determined after the far-red light or green glow of time are specified in irradiation；Using up 10 μM of diuron of lower addition
(DCMU) maximum fluorescence (Fm) is determined；With 1-, [(Fm '-Fs)/(Fm '-Fo) x (Fo '-Fs) calculate QA values.With with ED-
The PAM chlorophyll fluorescence instrument of P700DW-E light absorption units, the light absorbs of 810-830 nanometers of detection change to reflect P700 oxygen
Change the change of reducing condition, reduction initial rate (the Klughammer and of P700 in the dark are determined after far-red light is irradiated 40 seconds
Schreiber, 1998, Mi et al.1992).
The measure of cyanophyta cell density
Determine 730nm light absorption values to determine cell with spectrophotometer (UV-2450, Shimadzu) daily after blue-green algae inoculation
Density, takes pictures to the cell of the culture 3 days under different growth light, records growth phenotype.
Photosynthetic Electron passs cytochrome f and the redox of plastocyanin is determined
Cell is determined using spectrophotometer (UV-2450, Shimadzu) rising or falling of determining that 554.5nm absorbs
Pigment f is reduced and oxidation change；Determine 598nm decline and rise the reduction and oxidation for determining plastocyanin.The cell that light is relied on
The redox of pigment f and plastocyanin is to use the spectrophotometer (UV-3000, Shimadzu) with excitation source to detect,
Effect is just obtained white light by different interferometric filters respectively, and detection window is protected with appropriate optical filter.Cell
Pigment f rates of reduction are according to its extinction coefficient (31500M at 554.5nm-1cm-1), the rate of reduction of plastocyanin according to
Extinction coefficient (4700M at 598nm-1cm-1) calculated.
Synechocystis PsbC fusion proteins mutant and growth conditions
By the technology of molecular biology, by technologies of the foreign gene YFP by homologous recombination, energy algae is fused to ---
On the C-terminal of Synechocystis PCC6803 (conventional algae kind, obtained from Kyoto Univ Japan) Photosystem I I PsbC genes.PsbC-
YFP transgenic blue algaes conversion plasmid structure as shown in Figure 14 A, using pEYFP carriers (Clontech Laboratories,
Inc.CA, USA) construct pEYFP-SpRPlasmid, these plasmids with YFP is inserted the C-terminal of PsbC genes, and primer is：
PsbC-SalF, ggggtcgactatttaccatgccctcc；PsbC-BamHR, gggggatccaagtcgaggtcaggcatga；
PsbDn-EcoRF, ggggaattcgttgttcatgcctgac；PsbDn-XbaR, gggtctagaaatttggagtgaggcc, structure
The PsbC-YFP-Sp for converting blue-green algae is builtRPlasmid.
Using Natural Transformation method by PsbC-YFP-SpRConversion plasmid pair Cells of Blue-green Algae is converted, and is containing streptomysin
Setting-out on the agar plate of antibiotic, is placed in the incubator of blue-green algae and cultivates, after the clone for obtaining conversion, enters performing PCR identification (figure
14B), then integrated in containing 100 μ g/ml streptomycin mediums.
The culture of Cells of Blue-green Algae
Wild type Synechocystis 6803, PsbC-YFP transgenic blue algaes are trained with Tris-HCl containing 5mM (pH8.0) BG-11
Base is supported, in 30 DEG C, 2% (v/v) CO2, Continuous irradiation light (40 μm of olm-2s-1) under conditions of ventilate culture, the culture of mutating strain series
Appropriate antibiotic is added in base.
II. embodiment
Embodiment 1, LEAT albumen utilize the cracking of luminous energy catalytic water
1st, LEAT albumen use up lower catalytic water to the analog 2,3,5- trimethyl -1,4- 1,4-benzoquinone of plastoquinone also
It is former.
Have been reported and show, GFP albumen can reduce the micromolecular compound such as NAD of some oxidation state as electron donor+, the potassium ferricyanide and some albumen such as cromoci, albumen (Bogdanov AM etc., 2009, Nature by prothetic group of FAD
Chemical Biology.5:459-461), but this reaction is unsustainable.The present inventor utilizes the Escherichia coli purified
Express recombinant protein.Although the YFP and mCherry of pre- irradiation can be as electron donors, its reaction is unsustainable
(Fig. 1).By monitoring being reduced in the case where 436nm absorbs the light reduced to analyze the quinone molecule of LEAT proteins carries for quinone molecule.
LEAT albumen can made as the class reaction center pigment similar to reaction center chlorophyll a in chloroplaset
, being capable of reduction of the catalytic water to methyl quinone or derivatives thereof, the front three of analog 2,3,5- of such as plastoquinone under the exciting used up
Base-Isosorbide-5-Nitrae -1,4-benzoquinone (Fig. 2).Similar to being reduced under TMBQ light, the water crack liberation oxygen reaction being catalyzed under LEAT opalescences is light
Rely on by force.Although also there is catalysis water-splitting traffic order regularity under GFP light, its expression activitiy is low (Fig. 3 and Fig. 4), remaining
LEAT albumen all has very strong catalysis TMBQ reduction (Fig. 2) and releases the vigor (Fig. 5) of oxygen, and is TMBQ concentration dependants
(Fig. 5).
YFP/mChery, also can be in catalytic water cracking reaction under light, wherein existing in TMBQ in the presence of other methyl quinones
In the case of, splitting water puts oxygen vigor highest, wherein TMBQ under the light of YFP and mCherry protein moleculars>DMBQ2>MBQ>
DMBQ1, and with duroquinone (DuroQuinone, DQ, tetramethyl-Isosorbide-5-Nitrae -1,4-benzoquinone) and ubiquinone analog (2,3- dimethoxy -5-
Methyl isophthalic acid, 4- 1,4-benzoquinone, UQ) substitute TMBQ when, YFP and mCherry albumen then without splitting water under light put oxygen vigor (figure
6).There are various quinones substances in organism, wherein methyl quinone derivative is one of most important class quinone, such as：TMBQ's
Analog plastid quinone content is very high, has widely distributed in cytoplasm and chloroplaset.
TMBQ reduction is catalyzed under 2.LEAT opalescences and power of the oxygen vigor independent of its fluorescence is liberated in water crack
There is many do not light but the light absorbing chromophoric protein of energy in nature.In order to further inquire into the glimmering of LEAT albumen
Light characteristic puts oxygen ability relation with catalysis water-splitting under its light, and related residue around YFP to mCherry chromophores is dashed forward
Become, respectively obtained the point mutation that 3 fluorescence significantly weaken：YFPmu2(YFPH149C Y204A),YFPmu4(YFPH149C F166N I168M Y204A),YFPmu7(YFPS148C H149C F166N K167M I168M S203A Y204A),mCherrymu3(mCherryS151C S152C K167M),mCherrymu4(mCherryS151C S152C K167M I202A),mCherrymu5(mCherryS151C S152C I166N K167M I202A).The present inventor compares the light absorpting ability of these mutant and wild type, fluorescence intensity, TMBQ reduction is catalyzed under light
Oxygen ability is liberated with water crack.Absorb and fluorescence spectrum scanning experimental result found, this 6 mutant can only send out very weak fluorescence or
Substantially do not fluoresce.Wherein YFPmu2 and mCherrymu3 light absorbing ability is reduced to 30% and 40% original (figure respectively
7A, E), but its fluorescence intensity only has original~1 and 4% (Fig. 7 D, H) respectively.Not only fluorescence intensity subtracts other 4 mutant
Morely weak, its light absorbing ability also by being greatly reduced very much.Wherein YFPmu4 and YFPmu7 fluorescence intensity only has respectively
The 0.04% of wild type and 0.07% (Fig. 7 A, B, E, F), and mCherrymu4 and mCherrymu5 fluorescence intensity is only wild respectively
3% and 5% (Fig. 7 C, G) of raw type.
Splitting water is put oxygen vitality test and shown under further light, no matter whether LEAT albumen fluoresces and can be urged under light
The splitting water for changing quinone mediation puts oxygen.Oxygen vigor is put not only not as fluorescence intensity is reduced, and is greatly improved on the contrary.Wherein
YFPmu2 and YFPmu7 are 6 times and 30 times of wild type respectively, and mCherrymu3 is 6 times (Fig. 7 D, H) of wild type.These knots
Fruit shows, it is unrelated whether the LEAT proteins carry water-splitting traffic order regularities of quinone mediation can launch fluorescence with it, and and absorbing proteins
Luminous energy simultaneously transmits relevant with the ability of conversion luminous energy.Because it does not have fluorescence come the luminous energy for the absorption that dissipates, they are catalyzed TMBQ also
The vigor that oxygen is liberated in former and water crack is high all the better.
3rd, YFP mutant YFPL232H, YFPL232Q, YFP1-231And GFP1-231Put oxygen vigor
By the way that to GFP and YFP, CFP, BFP amino acid sequences carry out sequence and find (Fig. 8) more afterwards, the amino acid of 232
May have an impact to putting oxygen vigor.YFPL232HSplitting water traffic order regularity is reduced to less than the 1% of wild type YFP under mutant light, such as
Fig. 9 A.But remove YFP (Fig. 9 A) and GFP (Fig. 9 B) albumen after C-terminal and water-splitting is catalyzed in the presence of TMBQ and puts oxygen
Vigor is very high.Illustrate that GFP vigor is relatively low main reason is that the histidine of 232, also shows the relatively low LEAT of present vigor
Albumen passes through simple genetic modification, such as removes C-terminal, it is possible to its vigor is increased substantially, for improving photosynthetic efficiency.
The comparison that oxygen ability is put in water-splitting is catalyzed under embodiment 2, the LEAT opalescences of separate sources
The fluorescin originated from 110 kinds of cnidarias (Cnidarian) and arthropods (Arthropoda) and non-glimmering
9 fluorescins and 3 non-fluorescence chromophoric proteins (Figure 12) are have selected in photoproduction chromoprotein (table 1).This 12 albumen are being evolved
The different branch such as A, B, C, D (Figure 10) is belonging respectively on tree.This 12 fluorescins and non-fluorescence chromophoric protein add GFP systems
Row and dsRED line fluorescent albumen cover the most fluorescin reported and non-fluorescence at present in evolution and added lustre to egg
(Alieva et al., 2008, Diversity and evolution of coarlfluorescent in vain
proteins.PLoS One3(7):e2680.doi:10.1371/journal.pone.0002680), their molecular evolutions way
The LEAT albumen of the homology of footpath and amino acid and GFP series and dsRED series has very big difference (Figure 13 A and 13B).Profit
With these albumen of Bacillus coli expression, it is found that while that their fluorescence intensity, absorption spectrum, fluorescence spectrum have than larger difference
It is different, but have the vigor (table 2) that oxygen is put in water-splitting that is catalyzed under different degrees of light.This is possible to pass through itself or its mutant
Suitable genetic modification, the function of water-splitting is catalyzed using it so that water, as lasting electron donor is stablized, improves under light
The character of photosynthetic organism.
Table 1,110 kind of cnidaria (Cnidarian) and arthropods (Arthropoda) source fluorescin and non-glimmering
Photoproduction chromoprotein title and gene order number (Alieva et al., 2008)
Note：The albumen of line for the present invention it is selected in expression in escherichia coli, purify and detect catalytic water under its light
Crack the albumen of traffic order regularity.
The power that oxygen vigor is put in water-splitting is catalyzed under table 2, separate sources LEAT protein fluorescences and light
Note：Put in oxygen vitality test, "+" represents to put oxygen vigor with YFP in an order of magnitude, " ++ " represents to put oxygen vigor height
In at least one order of magnitude of YFP, " weak " expression puts oxygen vigor less than YFP an order of magnitude.
Embodiment 3, LEAT albumen are catalyzed in the case where using up via plastoquinone analog 2,3,5- trimethyl -1,4- 1,4-benzoquinone
Photosynthetic Electron passs the continued reduction of cytochrome f and plastocyanin
Cytochromes f (Cytf and plastocyanin (PC) concentration dependant, -1,4- pairs of plastoquinone analog 2,3,5- trimethyls
The YFP of benzoquinones (TMBQ) mediation under Cytf and PC light to reducing, and under conditions of no addition TMBQ, YFP can not be catalyzed nothing
By being reduction, such as Figure 10 A under cytochromes f or plastocyanin light；The cytochromes f and plastocyanin of YFP catalysis TMBQ mediations are also
Former is that light intensity is relied on, photoresponse curve Figure 10 B.Therefore, LEAT albumen is catalyzed water-splitting in the case where using up, and cracking is produced
Electronics, via the analog 2 of plastoquinone, 3,5- trimethyls-Isosorbide-5-Nitrae -1,4-benzoquinone reduction Photosynthetic Electron passs cytochrome f and matter
Lan Su.
This result illustrates that LEAT albumen has the activated cell pigment f and plastocyanin Photoreduction Activity of Isolated for relying on TMBQ, and right
TMBQ photo-reduction is similar, and in addition to GFP activity is relatively low, remaining LEAT albumen all has very high activity (Figure 11 A, B),
Especially fluorescent weakening or not fluorescent mutant (Figure 11 C, D).Due to Cytf and PC be in photosynthetic electron transport chain extremely
2 crucial electron carriers, LEAT albumen has the vigor that they are reduced that is catalyzed under quinone mediation, it is meant that LEAT albumen is not only
It can go in cytoplasm and improve the overall photosynthetic efficiency of photosynthetic organism, but also the thylakoid membrane of photosynthetic organism can be incorporated into
After upper, that photosynthetic organism is improved as artificial antenna catches light efficiency.
The redox state of cytochromes f and plastocyanin is notable by green glow in embodiment 4, PsbC-YFP transgenic blue algaes
Ground is induced
PsbC genes are merged (Figure 14 A) with YfP, and carry out blue-green algae conversion, transformant identification such as Figure 14 B.With wild type
Compare, the change for being first oxidized and being reduced afterwards is presented in the cytochromes f for transgenic blue algae YFP being incorporated on thylakoid membrane,
And the change for being first reduced and being oxidized afterwards is then presented in plastocyanin, this is due to after far-red light is closed, to be accumulated in the electricity in plastoquinone storehouse
Son continues to pass the result of body transmission to the two electronics, in addition, plastocyanin, which is mobile electronics, passs body, its oxidized cytochrome f
Reaction be rapid so that the two electronics pass body and opposite redox trend are presented.These dynamics of oxidation reduction
Change is promoted (Figure 15 A and 15B) by its exciting light -520nm green glow.This is further demonstrated in thylakoid membrane level
The luminous energy of absorption can be converted to reducing power by LEAT albumen by plastoquinone, and passing body to Photosynthetic Electron provides electronics.
Under conditions of no addition inhibitor, wild type and PsbC-YFP transgenic blue algaes cell all show oxygen uptake in the dark
Respiration, after green glow to cell irradiation 520nm, the oxygen uptake of PsbC-YFP Cells of Blue-green Algae is suppressed, but wild-type cell
Oxygen uptake be not affected；In the presence of respiratory electron transport chain NDH inhibitor mercury chloride, breathing oxygen uptake is suppressed,
The oxygen of putting that PsbC-YFP Cells of Blue-green Algae shows green glow induction reacts, and wild type does not have the traffic order regularity (figure that green glow is induced
16).This further demonstrates YFP can as a kind of allochlorophyll a antenna beam and reaction center pigment, absorbed
Green energy be converted into chemical energy, for photosynthesis.
Embodiment 5, PsbC-YFP transgenic blue algae photosynthetic capacities are significantly improved
Experiment in vitro above shows that the electronics that LEAT albumen can reduce photosynthetic electron transport chain passs body, in order to inquire into
LEAT albumen further determines the photosynthetic capacity of transgenic blue algae to photosynthetic influence.
The change of photosynthetic electron transfer body redox state, can influence excitation energy two photosystems reallocation (i.e.
State Transferring), to maintain the balance of two photosystem operatings, so as to improve the optical energy utilization efficiency of photosystem.Because YFP changes
The redox state of photosynthetic electron transfer body, the present inventor have detected the chlorophyll fluorescence kinetics under far-red light driving
The reflected State Transferring (Figure 17 A) of change.Before irradiation far-red light, PsbC-YFP transgenic blue algaes are more in state
2, after far-red light irradiation, promptly steering state 1, after far-red light is closed, is converted back to state 2 again.Either steering state 2 is gone back
It is that steering state 1, fast 3 times or so of switching rate than wild type of PsbC-YFP transgenic blue algaes, and degree of conversion are wild
2 times (Figure 17 A) of raw type.These results illustrate LEAT albumen can by changing photosynthetic electron transfer body redox state and
Promote State Transferring speed so that photosynthetic microorganism more can efficiently utilize luminous energy.
The expression of photosynthesis many genes is, by oxidation regulation and control, when in state 2, to be conducive to Photosystem I I gene
Expression, conversely, in state 1 when, be conducive to the expression of Photosystem I gene.The analysis method of the present inventor's Western blotting
It has detected the expression of related photosynthetic albumen.The photosynthetic protein content (Figure 17 B) of PsbC-YFP transgenic blue algaes, phycobniliprotein
Content (Figure 17 C) all significantly rises.In transgenic blue algae, up-regulation, especially Photosystem I I eggs is all presented in most of albumen
White and phycobilisome protein protomer CpcA.Mainly catching light algae day, linear protein --- the content of phycocyanin and phycoerythrin is all than wild
High by 40% or so (Figure 17 C) of type.Reflection is wilder by the electron transmission of PSI and PSII in PsbC-YFP transgenic blue algaes
High 35-45% of type or so, and reflect low 15% (Figure 17 D) of the 1-qL than wild type of plastoquinone reducing condition.In order to further compare
Activity is transmitted compared with noncyclic electron, using thylakoid membrane, respectively under the driving more than 630nm feux rouges and more than 520m green glows,
Detection is with NADP+For the NADPH of electron acceptor Photosynthetic rate (Figure 17 E), in the drive of green glow (LEAT albumen can be excited)
Under dynamic, NADPH synthesis rate is about 4 times of wild type, shows that YFP can be photosynthetic by luminous energy (520nm) driving of own absorption
Electron transmission.These results show that LEAT albumen can promote photosynthetic electron transfer as electron donor.Due to Photosynthetic Electron
Transmission couples photophosphorylation, and the present inventor compares the photophosphorylation speed of PsbC-YFP transgenic blue algaes and wild type
Rate.Figure 17 F show fast 1 times of ATP synthesis rates than wild type of Psbc-YFP photoinduction, and these results illustrate LEAT albumen
By the way that Light energy transfer will be absorbed to downstream electronic acceptor, the photosynthetic phosphoric acid for being obviously promoted photosynthetic electron transfer speed and its coupling
Change.The key enzyme Rubisco activity of photosynthetic carbon assimilation is also than high by 60% or so (Figure 17 G) of wild type.These results explanation,
YFP has been merged in Photosystem I I can make photosynthesis protein upregulation, improve photosynthetic response and the main metabolites of carbon assimilation
And its activity.
Embodiment 6, the hydrogen photoproduction of PsbC-YFP transgenic blue algaes significantly improve and grown substantially quickening
Photosynthesis is the basis of biological production, and the present inventor have evaluated PsbC-YFP transgenic blue algaes in different light medium
Under growth rate.Further compare in the incandescent lamp rich in green glow and lack the fluorescent lamp PsbC-YFP of blue green light and turn base
Because of the growth rate of blue-green algae (spectrum of two kinds of light sources is as shown in figure 18).As shown in Figure 198, under two light sources, PsbC-YFP
The speed of growth of transgenic blue algae is faster than wild type (Figure 19 A).Under fluorescent light, PsbC-YFP transgenic blue algaes are in growth early stage
(before culture 2 days) does not have difference with wild type, just grows fast than wild type (after culture 2 days) at later stages.From these
As a result as can be seen that green glow is conducive to PsbC-YFP growth.These suitable light quality conditions exactly contain YFP albumen
The wavelength of characteristic absorption light.Meanwhile, PsbC-YFP oxygen speed of putting is considerably higher than than wild type (Figure 19 B), and dark respiration is fast
Rate is then less than than wild type (Figure 19 C), illustrates that transgenic blue algae PsbC-YFP has higher photosynthetic capacity.Further prove
The luminous energy of capture effectively can be converted into reducing power by YFP albumen, change the redox state of photosynthetic electron transport chain,
Promote the expression of photosynthesis albumen and improve the activity of these albumen, so as to improve photosynthesis, promote the growth of cell, carry
High increment of organism.
All documents referred in the present invention are all incorporated as reference in this application, independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can
To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (5)
1. a kind of method for improveing algae character, described improvement algae character is to improve the increment of organism of algae, including with
Lower step：
1) conversion of PsbC- fluorescins fusion is entered into algae；Described PsbC is the light of wild type Synechocystis 6803
System II PsbC；The amino acid sequence of described fluorescin such as SEQ ID NO:Shown in 8；With
2) character for comparing control algae is selected from the algae after conversion and obtains the algae of improvement；
Wherein, described algae is blue-green algae.
2. the method as described in claim 1, it is characterised in that described that the conversion of PsbC- fluorescins fusion is entered into algae
The method of class includes：Expression cassette containing PsbC- fluorescin fusions is transferred in algae, so as to be expressed in algae
PsbC- fluorescin fusions.
3. the method as described in claim 1, it is characterised in that described improvement algae character also include selected from following a kind of or
It is several：
Increase algae PSI or PSII Photochemical Efficiency；
Increase algae photosynthetic electron transfer efficiency；Or
Improve the hydrogen photoproduction of algae.
The purposes of 4.PsbC- fluorescin fusions, for improveing algae character, described improvement algae character is to improve algae
The increment of organism of class；Described PsbC is the Photosystem I I PsbC of wild type Synechocystis 6803；Described fluorescin
Amino acid sequence such as SEQ ID NO:Shown in 8；Wherein, described algae is blue-green algae.
5. a kind of algae, it is characterised in that the PsbC- fluorescin fusions containing external source in the cell of the algae；Institute
The PsbC stated is the Photosystem I I PsbC of wild type Synechocystis 6803；The amino acid sequence of described fluorescin such as SEQ
ID NO:Shown in 8；Wherein, described algae is blue-green algae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210594376.0A CN103911291B (en) | 2012-12-31 | 2012-12-31 | A kind of method for improveing algae character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210594376.0A CN103911291B (en) | 2012-12-31 | 2012-12-31 | A kind of method for improveing algae character |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103911291A CN103911291A (en) | 2014-07-09 |
| CN103911291B true CN103911291B (en) | 2017-07-28 |
Family
ID=51037299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210594376.0A Active CN103911291B (en) | 2012-12-31 | 2012-12-31 | A kind of method for improveing algae character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103911291B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178425A (en) * | 2014-08-05 | 2014-12-03 | 新奥科技发展有限公司 | Micro algae breeding method |
| CN107841495B (en) * | 2017-11-27 | 2020-11-06 | 浙江大学 | Method for rapidly screening nuclear mutagenesis carbon fixing algae strain by utilizing photosynthetic oxygen evolution electronic separation |
| CN113607649A (en) * | 2020-09-18 | 2021-11-05 | 中国科学院植物研究所 | Method for improving algae P700 detection signal |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1203631A (en) * | 1995-12-06 | 1998-12-30 | 金斯敦皇后大学 | Constructs and methods for enhancing protein levels in photosynthetic organisms |
| DE10124057A1 (en) * | 2001-05-16 | 2002-11-21 | Joerg Wiedenmann | Use of autofluorescent proteins for protecting plants against damaging effects of ultra-violet B radiation, also for characterization of transgenic plants |
| WO2010033230A2 (en) * | 2008-09-18 | 2010-03-25 | Shai Einbinder | Use of fluorescent protien in cyanobacteria and algae for improving photosynthesis and preventing cell damage |
-
2012
- 2012-12-31 CN CN201210594376.0A patent/CN103911291B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1203631A (en) * | 1995-12-06 | 1998-12-30 | 金斯敦皇后大学 | Constructs and methods for enhancing protein levels in photosynthetic organisms |
| DE10124057A1 (en) * | 2001-05-16 | 2002-11-21 | Joerg Wiedenmann | Use of autofluorescent proteins for protecting plants against damaging effects of ultra-violet B radiation, also for characterization of transgenic plants |
| WO2010033230A2 (en) * | 2008-09-18 | 2010-03-25 | Shai Einbinder | Use of fluorescent protien in cyanobacteria and algae for improving photosynthesis and preventing cell damage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103911291A (en) | 2014-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shevela | Adventures with cyanobacteria: a personal perspective | |
| Stirbet et al. | Chlorophyll a fluorescence in cyanobacteria: relation to photosynthesis | |
| Joët et al. | Involvement of a plastid terminal oxidase in plastoquinone oxidation as evidenced by expression of the Arabidopsis thaliana enzyme in tobacco | |
| Torzillo et al. | Increased hydrogen photoproduction by means of a sulfur-deprived Chlamydomonas reinhardtii D1 protein mutant | |
| Adamska et al. | Isolation of pigment‐binding early light‐inducible proteins from pea | |
| Sugiura et al. | Highly purified thermo-stable oxygen-evolving photosystem II core complex from the thermophilic cyanobacterium Synechococcus elongatus having His-tagged CP43 | |
| Vogl et al. | Bacteriochlorophyll f: properties of chlorosomes containing the" forbidden chlorophyll" | |
| Suga et al. | Structural variations of photosystem I-antenna supercomplex in response to adaptations to different light environments | |
| US20170037425A1 (en) | Method for improving plant trait | |
| CN103911291B (en) | A kind of method for improveing algae character | |
| Wu et al. | Light-dependent chlorophyll a biosynthesis upon chlL deletion in wild-type and photosystem I-less strains of the cyanobacterium Synechocystis sp. PCC 6803 | |
| Bryant et al. | Far-red light allophycocyanin subunits play a role in chlorophyll d accumulation in far-red light | |
| Islam et al. | slr1923 of Synechocystis sp. PCC6803 is essential for conversion of 3, 8-divinyl (proto) chlorophyll (ide) to 3-monovinyl (proto) chlorophyll (ide) | |
| CN101948871B (en) | Marine microalgae chloroplast expression vector and application thereof | |
| Chen et al. | Advances in whole‐cell photobiological hydrogen production | |
| CN109897093B (en) | Multiple improved orange/red fluorescent proteins | |
| de Vitry et al. | Analysis of the nucleus-encoded and chloroplast-targeted rieske protein by classic and site-directed mutagenesis of Chlamydomonas | |
| Kada et al. | Arrest of chlorophyll synthesis and differential decrease of Photosystems I and II in a cyanobacterial mutant lacking light-independent protochlorophyllide reductase | |
| Desquilbet et al. | In the unicellular red alga Rhodella violacea iron deficiency induces an accumulation of uncoupled LHC | |
| Fowler et al. | The synthesis and assembly of functional high and low light LH2 antenna complexes from Rhodopseudomonas palustris in Rhodobacter sphaeroides | |
| Jaubert et al. | Control of peripheral light-harvesting complex synthesis by a bacteriophytochrome in the aerobic photosynthetic bacterium Bradyrhizobium strain BTAi1 | |
| Wessendorf et al. | Introducing an Arabidopsis thaliana thylakoid thiol/disulfide-modulating protein into synechocystis increases the efficiency of photosystem II photochemistry | |
| WO2013185028A1 (en) | Compositions and methods for enhancing plant photosynthetic activity | |
| Nakamura et al. | Consequences of structural modifications in cytochrome b 559 on the electron acceptor side of Photosystem II | |
| White | Investigating the roles of specific amino acid substitutions found in the D1'and far-red forms of the Photosystem II reaction centre D1 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200609 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |