CN103898233A - Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof - Google Patents
Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof Download PDFInfo
- Publication number
- CN103898233A CN103898233A CN201410159391.1A CN201410159391A CN103898233A CN 103898233 A CN103898233 A CN 103898233A CN 201410159391 A CN201410159391 A CN 201410159391A CN 103898233 A CN103898233 A CN 103898233A
- Authority
- CN
- China
- Prior art keywords
- primer
- gene
- apoa5
- heart disease
- coronary heart
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a detection kit for auxiliary diagnosis of coronary heart disease. The detection kit comprises an APOE gene primer for detecting rs7259620 single nucleotide polymorphism of an APOE gene and an APOA5 gene primer for detecting rs662799 single nucleotide polymorphism of an APOA5 gene. The detection method comprises the steps: PCR amplification is carried out on a sample DNA through the APOE gene primer and the APOA5 gene of the detection kit; a melting curve of the PCR amplification product is analyzed by using a fluorescent quantization PCR apparatus; the melting curve is compared with the standard melting curve to compare the Tm value of the PRC amplification product so as to obtain a corresponding genotyping result. The detection kit can detect the coronary heart disease of a subject, and the detection method is simple, high in detection efficiency, and strong in pertinence, so as to facilitate early prevention of the coronary heart disease and provide reference for medication.
Description
Technical field
The present invention relates to the auxiliary diagnosis technical field of coronary heart disease, particularly a kind of detection kit of auxiliary diagnosis coronary heart disease and detection method thereof.
Background technology
Coronary heart disease is also called ischemic heart disease (coronary heart disease, CHD), relate to supply myocardial blood artery occur atherosis, be that coronary atherosclerosis causes that lumen of vessels is narrow or Mottling formation even breaks, stops up completely, limit or interrupted myocardium blood supply completely, causing a series of serious myocardial ischemia illnesss such as stenocardia, myocardial infarction clinically.Coronary heart disease is to threaten now one of disease that human health is the most serious, the main killer of human health.Along with rapid economic development, there is obvious variation in worldwide spectrum of disease, and cardiovascular disorder becomes principal disease gradually.Probably there were 1,730 ten thousand people to die from cardiovascular diseases in 2008, account for 30% of global death toll.Wherein, that dies from coronary heart disease approximately has 7,300,000, has accounted for nearly 42% of sum.Have epidemiological study to show, to the year two thousand twenty, will have every year 2500 ten thousand people to die from cardiovascular disorder, and cardiovascular disorder is estimated to become whole world death and disabled major cause by exceeding communicable disease.Although according to the MONICA of World Health Organization statistics, China's sickness rate is low compared with western countries, China's Incidence of CHD is ascendant trend gradually.Coronary heart disease be the complex process that many factors participate in, be the coefficient result of environmental factors and inherited genetic factors.As everyone knows, the morbidity of coronary heart disease and smoking, drink, obesity, and hypertension, diabetes, hyperlipemias etc. are relevant.But inherited genetic factors has play a part unique, particularly Family genetic factors is an important independent hazard factor of coronary heart disease.Gene test can be made huge contribution to coronary heart disease control, and development medical diagnosis on disease and treatment new tool, have very large prospect.
Research is found, hyperlipemia and coronary heart disease have a very large relation, low-density lipoprotein (LDL-C) in patients with coronary heart disease serum according to statistics, triglyceride level (TG), total cholesterol (TC) is apparently higher than non-patients with coronary heart disease, and high-density lipoprotein (HDL) (HDL-C) is starkly lower than non-patients with coronary heart disease.And found SNPrs7259620 and rs662799 and TC both at home and abroad, and TG, LDL-C, there is dependency in HDL-C etc.And hyperlipemia is also relevant with other a lot of diseases, as metabolism syndrome, cerebral apoplexy, apoplexy, renal failure, alzheimer's disease etc.Still may be by detecting the dependency of SNPrs7259620 and rs662799 and other relative diseases, auxiliary judgment, accomplishes prevention ahead of time and medication reference etc.
The variations such as single nucleotide polymorphism (SNP) refers in genomic dna and changes on a certain specific nucleotide position, transversion, insertion or disappearance are third generation molecule markers.According to estimates, nearly 1,000,000,000 SNP molecule markers will be used to gene function and the association study with the dependency of disease.There is part to have the research about rs7259620 and rs662799 and correlation with coronary heart disease both at home and abroad.APOE is apo E, has polymorphism, and it is closely related that polymorphism determines that development occurs for individual blood lipid level and atherosclerosis, is the major cause of individual difference in the early stage and evolution of atherosclerosis, increases coronary heart disease risk.For rs662799, foreign study finds that APOA5 promoter region polymorphism is the pathogenetic independent hazard factor of coronary disease, has strong correlation with it.But the correlative study report of any test kit for detection of APOE gene rs7259620 and APOA5 gene rs662799 single nucleotide polymorphism (SNP) and coronary heart disease degree of correlation is not also disclosed at present, both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is the present situation for prior art, the detection kit of a kind of auxiliary diagnosis coronary heart disease that provide easy to detect, Detection accuracy is high; By gene primer, sample DNA is carried out to pcr amplification, and set up melting curve and compare and reach a conclusion with standard melting curve, its detection method is simple, efficient.
The present invention solves the problems of the technologies described above adopted technical scheme:
A detection kit for auxiliary diagnosis coronary heart disease, described detection kit comprises for detection of the APOE gene primer of APOE gene rs7259620 single nucleotide polymorphism with for detection of the APOA5 gene primer of APOA5 gene rs662799 single nucleotide polymorphism;
Described APOE gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 ';
Described APOA5 gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
For optimizing technique scheme, the concrete measure of taking also comprises:
Described APOE gene primer is:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 '.
Described APOA5 gene primer is:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
A kind of detection method of detection kit of auxiliary diagnosis coronary heart disease: comprise the following steps:
Step 1: standard model is carried out to pcr amplification Criterion melting curve;
Step 2: carry out pcr amplification with APOE gene primer and the APOA5 gene pairs sample DNA of detection kit;
Step 3: the pcr amplification product in step 2 is analyzed to melting curve with quantitative real time PCR Instrument, and with step 1 in the standard melting curve set up compare, the Tm value of contrast pcr amplification product, obtains corresponding gene type result.
The pcr amplification program of the APOE gene primer in described step 2 is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
In described step 3, the analytical procedure of the pcr amplification product melting curve of APOE gene primer is: the pcr amplification product of APOE gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
In described step 3 in the pcr amplification product melting curve of APOE gene primer, 77 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 82 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 77 ± 0.5 ℃ of melting temperature (Tm)s and 82 ± 0.5 ℃ be AG type.
The pcr amplification program of the APOA5 gene primer in described step 2 is: the amplification program of described pcr amplification is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 59 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
In described step 3, the analytical procedure of the pcr amplification product melting curve of APOA5 gene primer is: the pcr amplification product of APOA5 gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
In described step 3 in the pcr amplification product melting curve of APOA5 gene primer, 81 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 86 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 81 ± 0.5 ℃ of melting temperature (Tm)s and 86 ± 0.5 ℃ be AG type.
Compared with prior art, the detection kit of a kind of auxiliary diagnosis coronary heart disease of the present invention, described detection kit comprises for detection of the APOE gene primer of APOE gene rs7259620 single nucleotide polymorphism with for detection of the APOA5 gene primer of APOA5 gene rs662799 single nucleotide polymorphism, because APOE gene rs7259620 and APOA5 gene rs662799 single nucleotide polymorphism (SNP) have strong correlation with coronary heart disease;
Therefore by detecting APOE gene rs7259620 and APOA5 gene rs662799 site G allelotrope, can predict experimenter's coronary heart disease, detection efficiency is high, with strong points, thereby can promote the early prevention of coronary heart disease and treat reference is provided for medication.
This detection method adopts Melting Temperature shift (Tm-shift) method of SYBR Green I to detect case group and control group genotype.Tm-shift is a kind of new methods of genotyping, main by add the GC sequence of different lengths at two Auele Specific Primers 5 ' end, after PCR amplification, completes somatotype according to the difference of product Tm value in melting curve.SYBR Green I is a kind of extensive and ripe double-stranded DNA (dsDNA) dyestuff that uses in Real-time PCR.It is non-specifically embedded in the ditch in double-stranded DNA double-spiral structure, is not generally combined with single stranded DNA, and the fluorescence intensity of bonding state increases thousands of times than the fluorescence of unbound state.Under the effect of exciting light, send fluorescent signal.Fluorescence intensity varies with temperature, when two DNA molecular renaturation in conjunction with time fluorescence the strongest, reduce and occur a more constant gradient with temperature rise fluorescence intensity.When DNA fragmentation reaches melting temperature (Tm) in heat-processed, while reaching Tm value, separately double-stranded, SYBR Green I discharges from DNA, causes fluorescent signal to weaken.Can obtain melting curve figure through software analysis, the temperature at its crest place represents the Tm value of double chain DNA molecule.The size of Tm value depends on G/C content in the length of DNA molecular and sequence thereof.After melting curve completes, according to the design of Auele Specific Primer, can obtain corresponding gene type result.When interpretation somatotype result, using HH homozygote and 3 ℃ of foundations as somatotype judgement of LL homozygote peak value lowest difference distance.In order to guarantee the accuracy of experiment, choose the sample of 3 kinds of known different genotype of genotype, in each piece 96 orifice plate, put into standard substance as positive control, to distinguish 3 kinds of genotypic melting peaks.
Tm-shift method method is simple, consuming time only about 2 hours, can detect 96 samples at every turn simultaneously, easy and simple to handle, is a kind ofly can meet the method that middle small throughput research needs again can high performance-price ratio complete gene type.Due to the omnidistance stopped pipe operation of experiment, avoid the pollution of pcr amplification product, reduce false positive results, accuracy is high.The primer of a certain type is only combined pcr amplification reaction is just occurred with the template of phase homotype, thereby has guaranteed the specificity detecting.
The advantage of Tm-shift method is easy and simple to handle, and accuracy is high, reproducible, with low cost, is after amplification finishes, and pcr amplification product is carried out to the end point analysis method of melting curve analysis, without carry out real-time fluorescence detection always.
Accompanying drawing explanation
Fig. 1 is that APOE gene rs7259620 Tm-shift method detects genotypic melting temperature (Tm) curve;
Fig. 2 is that APOA5 gene rs662799 Tm-shift method detects genotypic melting temperature (Tm) curve.
Embodiment
Below in conjunction with accompanying drawing, embodiment is described in further detail the present invention.
A detection kit for auxiliary diagnosis coronary heart disease, described detection kit comprises for detection of the APOE gene primer of APOE gene rs7259620 single nucleotide polymorphism with for detection of the APOA5 gene primer of APOA5 gene rs662799 single nucleotide polymorphism;
Described APOE gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 ';
Described APOA5 gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
Described APOE gene primer is:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 '.
Described APOA5 gene primer is:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
A kind of detection method of detection kit of auxiliary diagnosis coronary heart disease: comprise the following steps:
Step 1: standard model is carried out to pcr amplification Criterion melting curve;
Step 2: carry out pcr amplification with APOE gene primer and the APOA5 gene pairs sample DNA of detection kit;
Step 3: the pcr amplification product in step 2 is analyzed to melting curve with quantitative real time PCR Instrument, and with step 1 in the standard melting curve set up compare, the Tm value of contrast pcr amplification product, obtains corresponding gene type result.
The pcr amplification program of the APOE gene primer in described step 2 is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
In described step 3, the analytical procedure of the pcr amplification product melting curve of APOE gene primer is: the pcr amplification product of APOE gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
In described step 3 in the pcr amplification product melting curve of APOE gene primer, 77 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 82 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 77 ± 0.5 ℃ of melting temperature (Tm)s and 82 ± 0.5 ℃ be AG type.
The pcr amplification program of the APOA5 gene primer in described step 2 is: the amplification program of described pcr amplification is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 59 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
In described step 3, the analytical procedure of the pcr amplification product melting curve of APOA5 gene primer is: the pcr amplification product of APOA5 gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
In described step 3 in the pcr amplification product melting curve of APOA5 gene primer, 81 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 86 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 81 ± 0.5 ℃ of melting temperature (Tm)s and 86 ± 0.5 ℃ be AG type.
APOE gene rs7259620 and APOA5 gene rs662799 single nucleotide polymorphism (SNP) have experimental results show that of strong correlation with coronary heart disease:
The collection of research object: from Ningbo Li Huili hospital, Yin Zhou the People's Hospital, Ningbo, Zhejiang Hangzhou the second In-patient, collect patients with coronary heart disease, totally 1521 examples, wherein 783 male sex, 738 women, the mean age is upper and lower at 62 years old; In these inpatients, collect every coronary stricture simultaneously and be less than 50% patient as a control group, totally 738 examples, wherein 421 male sex, 327 women, the mean age is upper and lower at 58 years old.All participants do not have myocardial infarction, Congenital Heart disease, liver or kidney disease.
1. the extraction of serum DNA
Application Lab-Aid 820 Full automatic instrument for extracting nucleic acids (Chinese Xiamen Zeesan Biotech Co., Ltd., 500ul system) extract the Whole Blood Genomic DNA of sample, then detect the concentration of gained DNA by nucleic acid-protein determinator.
2. near design of primers: sequence target SNP rs7259620, the rs1800686 downloading according to NCBI dbSNP website and rs662799, design Auele Specific Primer, and add respectively at specificity upstream primer 5 ' end the sequence that is rich in GC---the long sequence (5 '-GCGGGCAGGGCGGC-3 ') of 14 bp and the short sequence (5 '-GCGGGC-3 ') of 6bp, and join the allelic variation body pairing of base and SNP at 3 ' end, the gap that has expanded artificially PCR product Tm value, more easily distinguishes the Tm value of product.
APOE gene rs7259620 primer sequence is as follows:
Tm-shift APOE gene specific upstream primer one, as SEQ ID No.1, for detection of g allelotrope:
5’- gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg -3’；
Tm-shift APOE gene specific upstream primer two, as SEQ ID No.2, for detection of a allelotrope:
5’- gcgggcTCACTGTGTGGTTTTGCCATTCa -3’；
Tm-shift APOE gene reverse sequencing primer, as SEQ ID No.3:
5’- AACCCGTGGTTCAGCAGCAAGA -3’。
APOA5 gene rs662799 primer sequence is as follows:
Tm-shift APOA5 gene specific upstream primer one, as SEQ ID No.7, for detection of g allelotrope:
5’- gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg -3’；
Tm-shift APOA5 gene specific upstream primer two, as SEQ ID No.8, for detection of a allelotrope:
5’- gcgggcCCAGGAACTGGAGCGAAAGTa -3’；
Tm-shift APOA5 gene reverse sequencing primer, as SEQ ID No.9:
5’- CCCTGCGAGTGGAGTTAGCTT -3’。
3. pcr amplification and melting curve analysis
(1) set up APOE gene rs7259620 PCR reaction system: total reaction system is 12 μ L, article two, specificity upstream primer and an each 0.25 μ L of reverse primer (in system, primer content is respectively 0.1 μ mol/L), the genomic dna (20ng) of 2 μ L, LightCycler
480 SYBR Green I Master (comprise FastStart Taq archaeal dna polymerase, reaction buffer, dNTP mixture, SYBR Green I dyestuff, MgCl
2) 6 μ L, add high purity water and complement to 12 μ L.
Set up APOA5 gene rs662799 PCR reaction system: total reaction system is 12 μ L, article two, specificity upstream primer and an each 0.25 μ L of reverse primer (in system, primer content is respectively 0.1 μ mol/L), the genomic dna (20ng) of 2 μ L, LightCycler
480 SYBR Green I Master (comprise FastStart Taq archaeal dna polymerase, reaction buffer, dNTP mixture, SYBR Green I dyestuff, MgCl
2) 6 μ L, add high purity water and complement to 12 μ L.
(2) carry out pcr amplification, APOE gene rs7259620 amplification program: 95 ℃ of initial sex change stage 30s; Then 95 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min, 4 ℃ of preservations.
APOA5 gene rs662799 amplification program: 95 ℃ of initial sex change stage 30s; Then 95 ℃ of sex change 30s, 59 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min, 4 ℃ of preservations.
(3) melting curve analysis: PCR product is put into Roche Light Cycler 480 quantitative real time PCR Instruments.APOE gene rs7259620 and APOA5 gene rs662799 melting curve program: 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, then with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain.The Airborne Software that melting curve data are provided by Roche carries out cluster analysis acquisition according to fluorescence intensity automatically.After melting curve completes, contrast Tm value, can obtain corresponding gene type result.In order to ensure the accuracy of somatotype, we put into standard substance as positive control in each piece 96 orifice plate, to distinguish 3 kinds of genotypic melting peaks.In our experiment, the repeatability of standard control has reached 100%.
4. data analysis
This research adopts Arlequin software (v3.5), CLUMP22 software, and online software (http://faculty.vassar.edu/lowry/odds2x2.html), R software carries out finishing analysis to data.
For the accuracy of checking aforesaid method, randomly draw the evaluation of check order of 80 samples, result demonstration, above-mentioned Tm-shift detected result is consistent with sequencing result.
Experimental result:
1. gene type result:
The present invention judges genotype according to Tm value,
APOE gene rs7259620:LL homozygote, AA:Tm is 77 ± 0.5 ℃; HH homozygote, GG:Tm is 82 ± 0.5 ℃; LH heterozygote is AG, and Tm is 77 ± 0.5 ℃ and 82 ± 0.5 ℃.
Application Tm-shift method detects genotype, and in 1521 routine patients, GG has accounted for 49.90% (759/1521); AG has accounted for 41.42% (630/1521); AA has accounted for 8.68% (132/1521).
APOA5 gene rs662799:LL homozygote, AA:Tm is 81 ± 0.5 ℃; HH homozygote, GG:Tm is 86 ± 0.5 ℃; LH heterozygote is AG, and Tm is 81 ± 0.5 ℃ and 86 ± 0.5 ℃.
Application Tm-shift method detects genotype, and in 1521 routine patients, GG has accounted for 9.20% (140/1521); AG has accounted for 39.71% (604/1521); AA has accounted for 51.08% (777/1521).
2. the dependency of APOE gene rs7259620 and APOA5 gene rs662799 and coronary heart disease (P < 0.05 exists dependency)
The dependency (P < 0.05 exists dependency) of APOE gene rs7259620 and coronary heart disease
By contrast patient and control group, we find: as shown in table 1, the dangerous gene G gene of the APOE gene rs7259620 of case group is apparently higher than control group, and its mode of inheritance is dominant inheritance.
Table 1 rs7259620 genotype and allele distributions result
Gene test result under the aobvious implicit mode of table 2 rs7259620
Table 3 rs7259620 carries out genotype and allelic comparative result between case-control according to age stratification
And total crowd and male sex colony genotype and allelotrope all with coronary heart disease significant correlation (table 1).We carry out age stratification to sample again and find that the crowd's who is greater than 55 one full year of life (comprising for 55 one full year of life) genotype and allelotrope all exist remarkable relation (table 3) with coronary heart disease, this and reality meet, and the elderly is the group of people at high risk of coronary heart disease.
The dependency (P < 0.05 exists dependency) of APOA5 gene rs662799 and coronary heart disease
By contrast patient and control group, we find: as shown in table 4, the dangerous Gene A gene of the APOA5 gene rs662799 of case group is apparently higher than control group, and its mode of inheritance is stealthy heredity.
Table 4 rs662799 genotype and allele distributions result
Gene test result under the aobvious implicit mode of table 5 rs662799
Table 6 rs662799 carries out genotype and allelic comparative result between case-control according to age stratification
And total crowd and male sex colony genotype and allelotrope all with coronary heart disease significant correlation (table 4).We carry out age stratification to sample again and find that the crowd's who is greater than 55 one full year of life (comprising for 55 one full year of life) genotype and allelotrope all exist remarkable relation (table 6) with coronary heart disease, this and reality meet, and the elderly is the group of people at high risk of coronary heart disease.For further analysis, we proceed age stratification, find genotype and allelotrope and the coronary heart disease strong correlation of 55-65 one full year of life colony.
Most preferred embodiment of the present invention is illustrated, and the various variations of being made by those of ordinary skills or remodeling can not depart from the scope of the present invention.
SEQUENCE LISTING
<110> University Of Ningbo
Detection kit and the detection method thereof of a <120> auxiliary diagnosis coronary heart disease
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 37
<212> DNA
<213> artificial sequence
<400> 1
gcgggcaggg cggctcactg tgtggttttg ccattcg
<210> 2
<211> 29
<212> DNA
<213> artificial sequence
<400> 2
gcgggctcac tgtgtggttt tgccattca
<210> 3
<211> 22
<212> DNA
<213> artificial sequence
<400> 3
aacccgtggt tcagcagcaa ga
<210> 4
<211> 35
<212> DNA
<213> artificial sequence
<400> 4
gcgggcaggg cggcccagga actggagcga aagtg
<210> 5
<211> 27
<212> DNA
<213> artificial sequence
<400> 5
gcgggcccag gaactggagc gaaagta
<210> 6
<211> 21
<212> DNA
<213> artificial sequence
<400> 6
ccctgcgagt ggagttagct t
Claims (10)
1. a detection kit for auxiliary diagnosis coronary heart disease, is characterized in that: described detection kit comprises for detection of the APOE gene primer of APOE gene rs7259620 single nucleotide polymorphism with for detection of the APOA5 gene primer of APOA5 gene rs662799 single nucleotide polymorphism;
Described APOE gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 ';
Described APOA5 gene primer is the nucleotide fragments that comprises following sequence:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
2. the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 1, is characterized in that: described APOE gene primer is:
One: 5 '-gcgggcagggcggcTCACTGTGTGGTTTTGCCATTCg-3 ' of APOE gene specific upstream primer;
Two: 5 '-gcgggcTCACTGTGTGGTTTTGCCATTCa-3 ' of APOE gene specific upstream primer;
APOE gene reverse sequencing primer: 5 '-AACCCGTGGTTCAGCAGCAAGA-3 '.
3. the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 1, is characterized in that: described APOA5 gene primer is:
One: 5 '-gcgggcagggcggcCCAGGAACTGGAGCGAAAGTg-3 ' of APOA5 gene specific upstream primer;
Two: 5 '-gcgggcCCAGGAACTGGAGCGAAAGTa-3 ' of APOA5 gene specific upstream primer;
APOA5 gene reverse sequencing primer: 5 '-CCCTGCGAGTGGAGTTAGCTT-3 '.
4. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 1: it is characterized in that: comprise the following steps:
Step 1: standard model is carried out to pcr amplification Criterion melting curve;
Step 2: carry out pcr amplification with APOE gene primer and the APOA5 gene pairs sample DNA of detection kit;
Step 3: the pcr amplification product in step 2 is analyzed to melting curve with quantitative real time PCR Instrument, and with step 1 in the standard melting curve set up compare, the Tm value of contrast pcr amplification product, obtains corresponding gene type result.
5. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 4: it is characterized in that: the pcr amplification program of the APOE gene primer in described step 2 is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
6. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 5: it is characterized in that: in described step 3, the analytical procedure of the pcr amplification product melting curve of APOE gene primer is: the pcr amplification product of APOE gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
7. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 6: it is characterized in that: in described step 3 in the pcr amplification product melting curve of APOE gene primer, 77 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 82 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 77 ± 0.5 ℃ of melting temperature (Tm)s and 82 ± 0.5 ℃ be AG type.
8. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 4: it is characterized in that: the pcr amplification program of the APOA5 gene primer in described step 2 is: the amplification program of described pcr amplification is: 95 ℃ of initial sex change stage 30s; Then loop 95 ℃ of sex change 30s, 59 ℃ of renaturation 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 72 ℃ are extended 5min.
9. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 8: it is characterized in that: in described step 3, the analytical procedure of the pcr amplification product melting curve of APOA5 gene primer is: the pcr amplification product of APOA5 gene primer is placed in to quantitative real time PCR Instrument, 95 ℃ of sex change 15s, 60 ℃ of renaturation 30s, again with the speed rising to 95 ℃ of 0.11 ℃/s, continuous acquisition fluorescent signal during this time, 40 ℃ maintain; Carry out cluster analysis according to fluorescence intensity and obtain melting curve data.
10. the detection method of the detection kit of a kind of auxiliary diagnosis coronary heart disease according to claim 9: it is characterized in that: in described step 3 in the pcr amplification product melting curve of APOA5 gene primer, 81 ± 0.5 ℃ of melting temperature (Tm)s be AA type, 86 ± 0.5 ℃ of melting temperature (Tm)s be GG type, 81 ± 0.5 ℃ of melting temperature (Tm)s and 86 ± 0.5 ℃ be AG type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410159391.1A CN103898233A (en) | 2014-04-18 | 2014-04-18 | Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410159391.1A CN103898233A (en) | 2014-04-18 | 2014-04-18 | Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103898233A true CN103898233A (en) | 2014-07-02 |
Family
ID=50989798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410159391.1A Pending CN103898233A (en) | 2014-04-18 | 2014-04-18 | Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898233A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107287304A (en) * | 2017-06-30 | 2017-10-24 | 北京美莱博医学科技有限公司 | A kind of application for the Primer composition that gene pleiomorphism is detected based on HRM |
| CN109182490A (en) * | 2018-08-31 | 2019-01-11 | 南京金域医学检验所有限公司 | LRSAM1 gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030150003A1 (en) * | 2001-08-27 | 2003-08-07 | Edward Rubin | Novel apolipoprotein gene involved in lipid metabolism |
| WO2012096680A1 (en) * | 2011-01-10 | 2012-07-19 | Zinfandel Pharmaceuticals, Inc. | Disease risk factors and methods of use |
-
2014
- 2014-04-18 CN CN201410159391.1A patent/CN103898233A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030150003A1 (en) * | 2001-08-27 | 2003-08-07 | Edward Rubin | Novel apolipoprotein gene involved in lipid metabolism |
| WO2012096680A1 (en) * | 2011-01-10 | 2012-07-19 | Zinfandel Pharmaceuticals, Inc. | Disease risk factors and methods of use |
Non-Patent Citations (1)
| Title |
|---|
| 袁芳: ""Tm-shift 基因分型方法在遗传学中的应用"", 《遗传》, 30 November 2012 (2012-11-30), pages 1484 - 1490 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107287304A (en) * | 2017-06-30 | 2017-10-24 | 北京美莱博医学科技有限公司 | A kind of application for the Primer composition that gene pleiomorphism is detected based on HRM |
| CN109182490A (en) * | 2018-08-31 | 2019-01-11 | 南京金域医学检验所有限公司 | LRSAM1 gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
| CN109182490B (en) * | 2018-08-31 | 2022-08-19 | 南京金域医学检验所有限公司 | LRSAM1 gene SNP mutation site typing primer and application thereof in coronary heart disease prediction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7358434B2 (en) | Urine Biomarker Cohorts, Gene Expression Characteristics, and Methods of Their Use | |
| CN103789435B (en) | A kind of miRNA fluorescence detection reagent kit based on cascade constant-temperature amplification and method | |
| CN113286883A (en) | Methods for detecting disease using RNA analysis | |
| WO2009133915A1 (en) | Cancer marker, method for evaluation of cancer by using the cancer marker, and evaluation reagent | |
| CN102433376B (en) | Fluorescence quenching-based genetic variation detection method and probe | |
| Søes et al. | Identification of accurate reference genes for RT-qPCR analysis of formalin-fixed paraffin-embedded tissue from primary non-small cell lung cancers and brain and lymph node metastases | |
| CN104805207A (en) | Kit for detecting kras gene mutation, and detection method of kit | |
| CA3113213A1 (en) | Oligonucleotides and methods for detecting kras mutations | |
| CN105378111A (en) | Methods of performing polymerase chain reaction and related uses thereof | |
| Poláková et al. | High-resolution melt curve analysis: initial screening for mutations in BCR-ABL kinase domain | |
| CN104293920A (en) | Kit for quickly detecting polymorphism of human VKORC1 and CYP2CP genes and using method of kit | |
| KR101220806B1 (en) | Identification of group of hypertension-susceptibility genes | |
| Dekaliuk et al. | Discrimination of the V600E mutation in BRAF by rolling circle amplification and Forster resonance energy transfer | |
| CN106399479A (en) | SNP typing kit used for detecting susceptibility genes of type-II diabetes | |
| CN104073556B (en) | A kind of detection kit of auxiliary diagnosis diabetes | |
| US20110312516A1 (en) | Diagnostic and prognostic use of human bladder cancer-associated micro rnas | |
| CN104293932B (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| EP2794919A1 (en) | Method for detection of kras mutations | |
| CA2865163A1 (en) | Multimodal pcr target detection | |
| CN103898233A (en) | Detection kit for auxiliary diagnosis of coronary heart disease and detection method thereof | |
| CN104673882A (en) | Detection method and kit for BUD13-ZNF259 gene mononucleotide polymorphism and application thereof | |
| CN107012232A (en) | Primer and detection method for detecting the related SNP site of gastric cancer susceptibility | |
| JP2016510982A5 (en) | ||
| CN104178561A (en) | Detection kit for accessorily diagnosing type 2 diabetes and use method thereof | |
| Wei et al. | Detection of BRAFV600E mutation of thyroid cancer in circulating tumor DNA by an electrochemical-enrichment assisted ARMS-qPCR assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140702 |