CN103898154A - Fc fusion protein-containing yeast expression vector and construction method thereof - Google Patents

Abstract

The invention discloses a Fc fusion protein-containing yeast expression vector and a construction method thereof. The construction method comprises the following steps: preparing a Fc gene fragment; connecting the obtained Fc gene fragment to a pMD18-T (Polarisation Mode Dispersion) vector to obtain a connection product pMD18T-Fc; and performing EcoRI and NotI dual digestion on the obtained pMD18T-Fc and an expression vector pPICZalphaA and connecting by using a T4DNA (Deoxyribose Nucleic Acid) ligase to obtain the Fc fusion protein-containing yeast expression vector pPICZalphaA. According to the construction method, a non-Ig protein and a Fc fragment of an antibody molecule are fused, the pharmacodynamics characteristic can be improved, and a certain biological activity and an antibody biological effect function are combined together; and the Fc fusion protein-containing yeast expression vector is capable of directly constructing a protein gene with biological activity into the Fc end-containing fusion protein efficiently expressed in the expression vector.

Description

Containing Yeast expression carrier and the construction process thereof of Fc fusion rotein

Technical field

The present invention relates to a kind of Yeast expression carrier and construction process thereof, particularly a kind of Yeast expression carrier and construction process thereof containing Fc fusion rotein.

Background technology

The Fc end of antibody is responsible for the effector function of antibody, as activating complement, in conjunction with Fc acceptor, pass through placenta etc.Fc fusion rotein is to be mainly combined in the hinge region of biological activity protein and IgG and CH2, CH3 district.Antibody fusion protein containing Fc section is mainly in order to produce two kinds of effects by some protein and antibody Fc section fusion: the one, increase the transformation period of this protein molecule in blood; The 2nd, by the interaction of this protein molecular and its part, the biological effect of Fc section is directed to specific objective.

In at present conventional expression vector, do not contain the gene of Fc end fusion rotein, in the time expressing this proteinoid, need oneself to build, it is after the gene of biological activity protein and Fc fragment gene are connected by overlapping PCR that prior art scheme is prepared Fc fusion rotein, be building up to again in expression vector, more time-consuming, effort.

Summary of the invention

Based on this, for the gene that does not contain Fc end fusion rotein in prior art expression vector, while building the expression vector that contains Fc, the problem wasting time and energy, the invention provides Yeast expression carrier and construction process thereof containing Fc fusion rotein.

The concrete technical scheme solving the problems of the technologies described above is as follows:

A construction process that contains the Yeast expression carrier of Fc fusion rotein, comprises the steps:

(1) prepare Fc gene fragment, the based composition of described Fc gene fragment is as shown in SEQ ID NO.3;

(2) the Fc gene fragment of step (1) gained is connected in pMD18-T carrier, must connects product pMD18T-Fc;

(3) construction of expression vector: through EcoR I, Not I double digestion, and utilize T4DNA ligase enzyme to connect the connection product pMD18T-Fc of step (2) gained and expression vector pPICZ α A, must be containing the Yeast expression carrier pPICZ α A-Fc of Fc fusion rotein.

Therein in some embodiment, the preparation method of the described preparation of step (1) Fc gene fragment is: taking human IgG1's CH as template, with primer amplification, obtain Fc gene fragment.

In some embodiment, described primer is therein:

Upstream primer: GAATTCGAGCCCAAATCTTGTGACAAAACT,

Downstream primer: GCGGCCGCTCATTTACCCGGAGACAGGGAGAGGCTC.

In some embodiment, what step (2) was described is connected to therein: connect 0.9-1.1h in 21-23 DEG C.

Make a kind of Yeast expression carrier containing Fc fusion rotein according to above-mentioned construction process.

A kind of Yeast expression carrier containing Fc fusion rotein of the present invention and construction process has the following advantages and beneficial effect:

Construction process of the present invention, can express the fusion rotein containing Fc end fast and efficiently; The Yeast expression carrier containing Fc end fusion rotein that utilizes the method to obtain, that the Fc section of non-ig protein and antibody molecule is merged, directly bioactive tool protein gene is building up to this expression vector, the Yeast expression carrier obtaining, the non-ig protein pharmacokinetic properties that can significantly improve, and the biological effector function of some biologic activity and antibody is bound up.

Brief description of the drawings

Fig. 1 IgG1Fc gene PCR amplification schematic diagram of behaving;

Fig. 2 is that prepared carrier pPICZ α A-Fc builds schematic diagram;

Fig. 3 is pPICZ α A-Fc agarose gel electrophoresis figure.

Specific embodiment

The present invention passes through IgG ₁hinge region and CH2, CH3 district be Fc section, be building up in yeast expression pPICZ α A, obtain a kind of Yeast expression carrier and construction process thereof containing Fc fusion rotein, this construction process can be expressed the fusion rotein containing Fc end fast and efficiently.

In order more clearly to understand technology contents of the present invention, be described with reference to the accompanying drawings especially exemplified by following examples.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.In embodiment, various conventional chemical reagent used or test kit, be commercially available prod.

Wherein, plasmid H: professor Deng Ning of Ji'nan University is so kind as to give PMD18T-PLCH;

The formula of used medium is as follows:

LB substratum: peptone 1g, yeast extract 0.5g, NaCl1g, is dissolved in 100mL deionized water autoclaving.

LB Agar Plating containing Amp: peptone 1g, yeast extract 0.5g, NaCl1g, 1.5g agar strip is dissolved in 100mL deionized water, and autoclaving treats after sterilizing completes that it is to add Amp that temperature is reduced to 50 DEG C, and making final concentration is 50 μ g/mL.

LB solid plate substratum containing Zeocin: peptone 1g, yeast extract 0.5g, NaCl1g, 1.5g agar strip is dissolved in 100mL deionized water, and autoclaving treats after sterilizing completes that it is to add Zeocin that temperature is reduced to 50 DEG C, and making final concentration is 25 μ g/mL.

Further set forth the present invention below with reference to specific embodiment.

Embodiment 1

A construction process that contains the Yeast expression carrier of Fc fusion rotein, comprises the steps:

1, preparation Fc gene fragment:

With human IgG ₁cH be template, with primer amplification, obtain Fc gene fragment;

Wherein, described primer is:

SEQ ID NO.1

Upstream primer: GAATTCGAGCCCAAATCTTGTGACAAAACT,

SEQ ID NO.2

Downstream primer: GCGGCCGCTCATTTACCCGGAGACAGGGAGAGGCTC.

(pcr amplification result is referring to Fig. 1, and wherein M is DNA Marker; 1 is Fc gene fragment)

Wherein, the sequence of Fc gene fragment is:

SEQ ID NO.3

GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCA ATGGGCAGCCGGAGA ACA ACTACA AGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA。

Concrete amplification system following (dNTP Mixture used, Taq are all purchased from the Japanese TaKaRa Bio Inc of Takara Bio Inc):

PCR reaction system

PCR reaction system

Pcr amplification program is: 94 DEG C of denaturation 2min, and 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C are extended 40s, and after 30 circulations, 72 DEG C are extended 10min.Getting 5 μ L reaction product 1.5% agarose gel electrophoresis identifies.After qualification is correct, glue reclaims PCR product, obtains Fc gene fragment, and its based composition is as SEQ IDNO.3.

2, obtain and connect product pMD18T-Fc

1. the Fc gene fragment of step (1) gained is connected in pMD18-T carrier, in 22 DEG C of connection 1h, must connects product pMD18T-Fc(pMD18-T carrier purchased from the Japanese TaKaRaBio Inc of Takara Bio Inc);

Ligation system following (Solution I used purchased from purchased from the Japanese TaKaRaBio Inc of Takara Bio Inc):

Linked system

Ligase reaction system

2. connect product pMD18T-Fc and transform DH5 α competent cell:

The connection product pMD18T-Fc of above-mentioned gained is transformed in DH5 α competent cell, and be applied to the LB Agar Plating that contains Amp and cultivate, is defined as correction sequence through order-checking;

Concrete steps are as follows:

1) in 30 μ LDH5 α competent cells, add 2 μ L to connect product pMD18T-Fc, turn, to mix, is placed 30min in ice gently;

2) 42 DEG C of water-bath heat shock 90s;

3) pipe is transferred in ice bath, placed 2min rapidly;

4) every pipe adds 1mL LB substratum, in 37 DEG C, and 160rpm shaking culture 1h;

5) get 100 μ L and be applied on the LB Agar Plating that contains Amp, flat board is placed in to 37 DEG C and places after 1h and be inverted plate, in 37 DEG C of overnight incubation.

6) picking positive colony is in 3mL containing cultivating 12h in the LB liquid nutrient medium of Amp, and cloning vector pMD18T-Fc carries out enzyme after utilizing the little extraction reagent kit of OMEGA plasmid to extract in a small amount and cuts checking, and it is as follows that enzyme is cut system:

PMD18T-Fc carrier enzyme is cut system

pMD18T-Fc digestion system

PMD18T-Fc carrier enzyme is cut system

pMD18T-Fc digestion system

7) 37 DEG C of enzymes are cut and are spent the night, and 1% agarose gel electrophoresis is identified and the positive colony of qualification is delivered to the raw work order-checking in Shanghai.

3, construction of expression vector:

1. by the pMD18T-Fc of step (2) gained and expression vector pPICZ α A through EcoR I, Not I double digestion, and utilize T4DNA ligase enzyme to connect, must connect product pPICZ α A-Fc, containing the Yeast expression carrier pPICZ α A-Fc of Fc fusion rotein, build schematic diagram referring to Fig. 2;

Concrete steps are as follows:

PMD18T-Fc is connected in expression vector pPICZ α A, and 22 DEG C connect 1h, must connect product pPICZ α A-Fc, and ligation system is as follows:

Ligation

Ligase reaction system

2. connect product pPICZ α A-Fc and transform DH5 α competent cell:

The connection product pPICZ α A-Fc of above-mentioned gained is transformed to DH5 α competent cell, and be applied to the LB solid plate substratum that contains Zeocin and cultivate, is defined as correction sequence through order-checking;

Concrete steps are as follows:

1) will connect product pPICZ α A-Fc and transform DH5 α competent cell, coat the LB solid plate substratum containing Zeocin, 37 DEG C of overnight incubation, picking list bacterium colony extracts plasmid after cultivating and enzyme is cut qualification, and it is as follows that enzyme is cut system:

PPICZ α A-Fc carrier enzyme is cut system

The vector of pPICZαA-Fc digestion system

2) 37 ℃ overnight digestion, a 1% agarose gel electrophoresis was identified (see Figure electrophoresis to Figure 3, M is the DNA Marker; 1 of pPICZαA-Fc double digestion) and positive clones were sequenced to identify measured Fc fusion protein containing the yeast expression vector pPICZαA-Fc as the nucleotide sequence of SEQ ID NO.4 ::AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACGATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTGAATTCACGTGGCCCAGCCGGCCGTCTCGGATCGGTACCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAAGCGGCCGCCAGCTTTCTAGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTGTAGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGACCTTCGTTTGTGCGGATCCCCCACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTTCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAATTTTTTTTTTTAGTTTTTTTCTCTTTCAGTGACCTCCATTGATATTTAAGTTAATAAACGGTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGTTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGGGGCGGTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTCCGACGGCGGCCCACGGGTCCCAGGCCTCGGAGATCCGTCCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCTGGAGACCAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAG TATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC TCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCA GCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGG GGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATC.

The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims (5)

1. a construction process that contains the Yeast expression carrier of Fc fusion rotein, is characterized in that, comprises the steps:

(1) prepare Fc gene fragment, the based composition of described Fc gene fragment is as shown in SEQ ID NO.3;

(2) the Fc gene fragment of step (1) gained is connected in pMD18-T carrier, must connects product pMD18T-Fc;

(3) construction of expression vector: through EcoR I, Not I double digestion, and utilize T4DNA ligase enzyme to connect the connection product pMD18T-Fc of step (2) gained and expression vector pPICZ α A, must be containing the Yeast expression carrier pPICZ α A-Fc of Fc fusion rotein.

2. construction process according to claim 1, is characterized in that, the preparation method of the described preparation Fc gene fragment of step (1) is: with human IgG ₁cH be template, with primer amplification, obtain Fc gene fragment.

3. construction process according to claim 2, is characterized in that, described primer is:

Upstream primer: GAATTCGAGCCCAAATCTTGTGACAAAACT,

Downstream primer: GCGGCCGCTCATTTACCCGGAGACAGGGAGAGGCTC.

4. construction process according to claim 1, is characterized in that, what step (2) was described is connected to: connect 0.9-1.1h in 21-23 DEG C.

5. make a kind of Yeast expression carrier containing Fc fusion rotein according to the construction process described in claim 1-4 any one.

Images