CN103898119B - The aptamer of a kind of Docetaxel, aptamer derivant and application thereof - Google Patents
The aptamer of a kind of Docetaxel, aptamer derivant and application thereof Download PDFInfo
- Publication number
- CN103898119B CN103898119B CN201410110983.4A CN201410110983A CN103898119B CN 103898119 B CN103898119 B CN 103898119B CN 201410110983 A CN201410110983 A CN 201410110983A CN 103898119 B CN103898119 B CN 103898119B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- docetaxel
- sequence
- derivant
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the aptamer of a kind of Docetaxel, aptamer derivant and application thereof, the nucleic acid aptamer sequence of Docetaxel includes the DNA fragmentation shown in sequence 1 or sequence 2.This aptamer can be the similar sequence that various homology is higher or the derivant obtained by sequence of the present invention.The aptamer of the present invention and derivant thereof can be used as pharmaceutical carrier or for drug design and exploitation, medical separation and purification, prepare medicine and other goods, prepare Docetaxel detection probe or target spot probe etc., have can be combined with Docetaxel high specific and high-affinity, non-immunogenicity, can chemosynthesis, good biocompatibility, molecular weight is little, stable, be prone to the advantages such as preservation.
Description
Technical field
The present invention relates to a kind of aptamer, aptamer derivant and application thereof, being specifically related to one can be purple in conjunction with many west
The aptamer of China fir alcohol, aptamer derivant and application thereof.
Background technology
Docetaxel (Docetaxel) belongs to institute during taxane antitumor medicine, main interference cell mitosis and division
The microtubular network needed, plays antitumous effect, and its untoward reaction mainly shows as anaphylaxis, thrombocytopenia, tachycardia,
Hypotension, neurotoxicity, gastrointestinal reaction and Skin toxicity etc..Taxotere alcohol-soluble and water-soluble is little, marketed drugs
Taxotere uses tween 80 solubilising, ethanol hydrotropy, can cause the side effect such as anaphylaxis, hemolytic reaction, deposit in clinical practice
In potential risk, therefore, how to reduce taxotere side effect, raising clinical efficacy has become problem demanding prompt solution.It addition,
Architectural characteristic due to Docetaxel so that it is molar absorption coefficient is relatively low, it is difficult to use simple low cost optical spectral method to carry out
High-sensitive quantitative microanalysis.
Aptamer (aptamer) is to be screened by the phyletic evolution technology (SELEX) of index concentration part to obtain, energy
The single strain oligonucleotide (ssDNA or ssRNA) of specific bond target substance.Aptamer is similar with antibody function, but
There is compared with antibody more advantage, as having higher affinity and specificity, non-immunogenicity, it is possible to chemosynthesis,
Low cost, can be marked, good stability, it is easy to the advantages such as preservation.The target molecule of aptamer is the most extensive, including gold
Belong to ion, aminoacid, nucleic acid, polypeptide, protein etc., and complete virion and cell etc. can be extended to from single target
Complex target.
But, the most not yet discovery and Docetaxel has the aptamer of high-affinity and low cost.If obtaining one
Docetaxel aptamer, provides the means of a kind of new research Docetaxel by being expected to and expands Docetaxel
Range of application.
Summary of the invention
The technical problem to be solved in the present invention is to overcome the deficiencies in the prior art, it is provided that one can be with Docetaxel high specific
With high-affinity combination, non-immunogenicity, can chemosynthesis, good biocompatibility, molecular weight is little, stable, be prone to preserve
The aptamer of Docetaxel, aptamer derivant and application thereof.
For solving above-mentioned technical problem, the technical solution used in the present invention is the aptamer of a kind of Docetaxel, described core
The nucleotide sequence of acid aptamers includes the DNA fragmentation shown in following sequence 1 or sequence 2:
Sequence 1:
5’-TTCCAAACGTCCACCGCCAAAA-3’；
The sequence 2(i.e. reverse sequence of sequence 1):
5’-AAAACCGCCACCTGCAAACCTT-3’。
In above-mentioned aptamer, a certain position on the nucleotide sequence of described aptamer is phosphorylated, oxygen methylates,
Methylate, amination, sulfhydrylation or isotopologue.
In above-mentioned aptamer, the nucleotide sequence of described aptamer is combined with biotin, digoxin, fluorescence
Matter (such as FITC etc.), nano luminescent material, Polyethylene Glycol, peptide fragment, albumen, enzyme or folic acid labelling (even connect upper radiation
Property and therapeutic substance etc.).
Below whether through part replace or through modification after nucleotide sequence, all have former aptamer essentially identical or
Similar molecular structure, physicochemical property and function, can be used in combination specific with Docetaxel.
As total technology design, the present invention provides the aptamer of a kind of Docetaxel, described aptamer
Nucleotide sequence includes any one in following three kinds of sequences:
(1) (such as can be adaptive by above-mentioned nucleic acid more than 60% with the homology of the nucleotide sequence of above-mentioned listed aptamer
Body sequence is deleted or increases the nucleotide of partial complementarity)；
(2) nucleotide sequence with above-mentioned listed aptamer carries out the sequence hybridized；
(3) RNA sequence that the nucleotide sequence of above-mentioned listed aptamer is transcribed.
As total technology design, the present invention also provides for the aptamer derivant of a kind of Docetaxel, described nucleic acid
Aptamers derivant is the phosphorothioate backbone that the skeleton of the nucleotide sequence of above-mentioned listed aptamer derives, or
Lock nucleic acid or the peptide nucleic acid(PNA) accordingly that above-mentioned listed aptamer is transformed into.
Below other derivants that the aptamer whether derived still derives, all have the basic phase of former aptamer
Same or similar Molecular connectivity and structure properties and function, i.e. can be used in specific binding with Docetaxel.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological in the purposes in pharmaceutical carrier.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological purposes in drug design and exploitation.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological purposes in medical separation with purification.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological purposes in preparing medicine and other goods.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological purposes in preparing Docetaxel detection probe.
As total technology design, the present invention also provides for a kind of above-mentioned aptamer or above-mentioned aptamer spreads out
Biological purposes in preparing Docetaxel target spot probe.
Compared with prior art, it is an advantage of the current invention that:
(1) aptamer of the present invention can with high-affinity, combine Docetaxel with high specificity, have good stability,
Avirulence, it is prone to modify and the advantage, beneficially large-scale industrial production and application such as sequence length is shorter.The core of the present invention
Acid aptamers also has water-wet behavior, after being combined with the medicine Docetaxel being insoluble in water, can improve Docetaxel in water
Dissolubility, be expected in the case of not using other cosolvents (such as ethanol etc.), solubilizing agent (such as tween etc.), reach clinical
The purpose of application for the treatment of.
(2) aptamer of the present invention has and easily modifies characteristic, can be by modifying semiochemicals, by the purple of Docetaxel
Outer absorption signal is converted into other signals (such as fluorescence etc.), thus realizes the highly sensitive detection of Docetaxel.
(3) present invention utilizes the binding characteristic of aptamer and Docetaxel, be expected to improve Docetaxel stability,
Safety and dissolubility, extend drug effect, reduces the combination of Docetaxel and other blood endogenous material.Select the present invention's
Aptamer is that pharmaceutical carrier combines Docetaxel, it is possible to protect a drug from environmental effect, can obtain suitable release speed
Degree, plays a role gentle and lasting drug effect, and it can be avoided that the adverse effect that causes because of tween and ethanol.Meanwhile,
The aptamer of the present invention is marked and is modified with tracing in vivo and the exploitation etc. of novel drugs of beneficially Docetaxel.
Accompanying drawing explanation
Fig. 1 is that the affinity optimizing probe in the embodiment of the present invention investigates result.
Fig. 2 is the mass spectrum that embodiment of the present invention amplifying nucleic acid aptamers is combined with Docetaxel.
Fig. 3 is the circular dichroism spectrogram that embodiment of the present invention amplifying nucleic acid aptamers is combined with Docetaxel.
Detailed description of the invention
Below in conjunction with Figure of description and concrete preferred embodiment, the invention will be further described, but the most therefore limits this
The protection domain of invention.
Embodiment:
The aptamer of the Docetaxel of a kind of present invention, the nucleotide sequence of this aptamer includes shown in following sequence
DNA fragmentation, i.e. can the characteristic sequence of specific binding Docetaxel:
5’-TTCCAAACGTCCACCGCCAAAA-3’
(can also be 5 '-AAAACCGCCACCTGCAAACCTT-3 ').
The nucleotide sequence of above-mentioned aptamer is selected from naturally occurring or the sequence of synthetic, or any other source is same
The sequence of sample.
The nucleic acid aptamer sequence of a kind of Docetaxel, the sequence of this aptamer includes and the nucleoside of features described above sequence
The whole of acid are the same from sequence.
A certain position on the nucleotide sequence of above-mentioned aptamer can be phosphorylated, oxygen methylates, methylate, amination,
Sulfhydrylation or isotopologue.
Biotin-binding on the nucleotide sequence of above-mentioned aptamer, digoxin, fluorescent material, nano luminescent material, poly-
Ethylene glycol, peptide fragment, albumen or enzyme labelling, or the tumor targeted molecular labelling such as folic acid.
Above-mentioned aptamer can derive other aptamer, and the nucleotide sequence of the aptamer derived can be
Any one in three kinds of sequences below:
(1) with the present embodiment listed by the homology of nucleotide sequence of aptamer (such as can be by above-mentioned nucleic acid more than 60%
Aptamers sequence is deleted or increases the nucleotide of partial complementarity)；
(2) with the present embodiment listed by the nucleotide sequence of aptamer carry out the sequence that hybridizes；
(3) RNA sequence that the nucleotide sequence of aptamer listed by above-mentioned the present embodiment is transcribed.
The skeleton of the nucleotide sequence of aptamer listed by above-mentioned the present embodiment also can derive phosphorothioate backbone, above-mentioned core
Acid aptamers also can be transformed into corresponding lock nucleic acid or peptide nucleic acid(PNA).
The aptamer of the Docetaxel of above-mentioned the present embodiment has following purposes: (1) is in the purposes in pharmaceutical carrier；
(2) in drug design and the purposes in exploitation；(3) purposes in medical separation with purification；(4) prepare medicine and other
Purposes in goods；(5) purposes in preparing Docetaxel detection probe；(6) Docetaxel is being prepared as target spot
Purposes in probe.
The above-mentioned Docetaxel of the present embodiment is taxane antitumor medicine, and its chemical name is 5 β, 20-epoxy-1,2 α,
4,7 β, 10 β, 13 α-hexahydroxy taxane-11-alkene-9-ketone-4,10-diacetate esters-2-benzoate-13-[(2 ' R, 3 '
S)-N-benzoyl-3-phenylisoserine ester, No. CAS is 114977-28-5.
The aptamer of the Docetaxel of above-mentioned the present embodiment mainly utilizes micro-fluidic chip to screen, concrete screening process
Comprise the following steps:
A () optimizes nucleic acid library: wherein the structure of DNA library divides quinquepartite: centre is the fixing sequence of one section of 26 base
Row, are used for and fixing probe (BDNA) Complementary hybridization；The both sides of fixed sequence program are two DNA arms, all include 18
The necessary sequence of PCR amplification of the random sequence of base and 19 bases.Fixing probe be one end indicate biotin with literary composition
The DNA that storehouse fixed sequence program is complementary, fixing for library.
Random library RS36:
5’-CCGCTTCGCCGTCTCCTAC-NNNNNNNNNNNNNNNNNN-AAAAGTGGGTAGGGC
GGGTTGGAAAA-NNNNNNNNNNNNNNNNNN-CGCTCGTCACCCTTCTCCT-3 ' (note: N generation
Arbitrary base in Table A, T, G, C)；
5 ' primers: 5 '-FAM-CCGCTTCGCCGTCTCCTAC-3 '；
3 ' primers: 5 '-Biotin-AGGAGAAGGGTGACGAGCG-3 '；
Fixing probe: 5 '-Biotin-TACCGCAAAAAAAAACCAACCCGCCCTACCCAC-3 '；
(b) primary dcreening operation: by the micro-fluidic surface successively bovine serum albumin of modified biological element, Avidin, library.Library is located in advance
Reason method: 1nmol library (about 1014 DNA), 1.5nmol BDNA are dissolved in the hybridization buffer of 20 μ L
In (0.5mmol/L phosphate buffer, 10.5mmol/L NaCl, 15mmol/L MgCl2, pH6.8), 95 DEG C of degeneration 10min,
It is slowly cooled to room temperature, stands more than 3h, make library hybridize with BDNA, add the combination buffer (100mmol/L of 130 μ L
NaCl, 5mmol/L KCl, 2mmol/L MgCl2,1mmo/L CaCl2,20mmol/L Tris-HCl, pH7.6), standby.
Library fixing means: the most biotinylated BSA of 150 μ L, 1mg/mL is passed through syringe pump with 1 μ L/min
Flow velocity by chip, then rinse 10min by the PBS solution of 0.01mol/L with the flow velocity of 5 μ L/min；Again with same
Flow velocity is passed through the Avidin of 60 μ L, 1mg/mL, and the PBS solution of same 0.01mol/L is rinsed with the flow velocity of 5 μ L/min
100min.By the DNA library of 150 pretreated μ L (i.e. DNA library after hybridization) with the flow velocity of 0.5 μ L/min
By the chip of modified, rinse 10min with combining buffer with the flow velocity of 5 μ L/min, then complete library in the chips
Fixing.Then object Taxotere alcoholic solution is passed through, collects the solution flowed out in chip, obtain primary dcreening operation nucleic acid library, its
In complex containing DNA and Docetaxel.
(c) purification: primary dcreening operation nucleic acid library step (b) obtained carries out PCR amplification, and amplified production is (the most biotinylated
Double-stranded DNA) affinity column filled by Streptavidin microballon separated, then unwind by alkaline denaturation, formed after desalination time
One-level nucleic acid library.Wherein, PCR reaction amplification condition is: 94 DEG C of denaturations 10min；94 DEG C of degeneration 45sec, 62 DEG C of annealing
30sec, 72 DEG C extend 30sec, amplification N(optimum wheel number) individual circulation；72 DEG C extend 7min.Use grads PCR, with just
Beginning nucleic acid library optimizes annealing temperature as masterplate, and finally giving annealing temperature is 62 DEG C.And often take turns the optimum amplification of screening product
Wheel number all obtains through third wheel number optimization.After wheel number optimizes, remaining library is expanded at identical conditions.PCR ties
Fruit is all verified by 3% agarose gel electrophoresis, and dyestuff is SYBR Glod.Library after PCR is carried out strand prepare,
For the screening of next round, strand preparation method: take 50 μ L Streptavidin microballons and join in 1.5mL EP pipe, use
0.01mol/L PBS rinses and adds the double-stranded products that PCR amplification obtains after 3 times, and 25 DEG C of concussions are centrifugal after hatching 30min goes
Clearly；Continuation 0.01mol/L PBS adds the NaOH of 500 μ L200mmol/L after rinsing 3 times, 10min is hatched in 25 DEG C of concussions
Carry out single stranded process；Single stranded DNA free in centrifugal collection supernatant；Collect product to be carried out at desalination by high performance liquid chromatography
Reason, is dried after concentrating and is dissolved in a small amount of water, obtain time one-level nucleic acid library, carry out quantitatively with ultraviolet spectrophotometer, in-20 DEG C
Refrigerator preserves.
D () is circulated: with obtained above one-level nucleic acid library substitute initial nucleic acid library and repeat above-mentioned step (b)～
Step (c), every time during circulation should the bovine serum albumin Pseudobulbus Bletillae (Rhizoma Bletillae) Avidin of modified biological element in micro-fluidic chip again, directly
To obtaining including the nucleic acid library of the aptamer being combined with Docetaxel high-affinity and high specific；
(e) screening efficiency evaluation: use the enrichment condition of DNA in fluorescence spectrometry screening efficiency, i.e. screening process.Detection
Signal is the fluorescent value of 5 ' terminal modified fluorescent dye FAM of DNA library.The present embodiment is by pretreated DNA library
Fluorescent value be set to F0, the fluorescent value of the solution (library containing on fixing) flowed out when modifying library is set to F1, competition
In conjunction with time the fluorescent value of solution collected from chip be set to F2, then screening efficiency is calculated as follows formula: screening efficiency=F2/
(F0-F1-F2) × 100%.Monitoring each screening efficiency taken turns according to this formula, screening efficiency is the highest, illustrates that competition is to molten
DNA in liquid is the most, can monitor screening enrichment condition by the mensuration of screening efficiency.When screening reaches plateau, right
Library carries out cloning and sequencing.
Docetaxel is small-molecule drug, tentatively infers that base the most in connection should be less than 30.To sequencing result
Carry out sequence analysis, according to library designs scheme, fixed sequence program and PCR primer sequence be present in all sequences and length relatively
Long, therefore two arms of sequence are split, leave out primer portion sequence, change fixed sequence program, use surface plasma
The combination effect of aptamer with Docetaxel is investigated by resonance method.Investigated by surface plasma body resonant vibration and combine energy
The method of power, thus speculate its core binding sequence, and the optimal sequence optimized is combined the investigation of ability.
Investigation 1:
Optimize probe 1:5 '-TTCCAAACGTCCACCGCCAAAAGTGGGTAGGGCGGGTTGGAAAA-3 '
Fixing probe 1:5 '-Biotin-TACCGCAAAAAAAAACCAACCCGCCCTACCCAC-3 '
Optimize probe 2:5 '-TTCCAAACGTCCACCGCCAAAACCAACCCGCCCTACCCACAAAA-3 '
Fixing probe 2:5 '-Biotin-TACCGCAAAAAAAAAGTGGGTAGGGCGGGTTGG-3 '
Surface plasma body resonant vibration instrument (SPR) is utilized to enter optimizing probe 1 and optimization probe 2 affinity with Docetaxel
Row is investigated, and the fixing probe that 1nM optimizes probe and 1.5nM is dissolved in (0.5mmol/L phosphoric acid in the hybridization buffer of 20 μ L
Buffer, 10.5mmol/L NaCl, 15mmol/L MgCl2, pH6.8), 95 DEG C of degeneration 10min, it is slowly cooled to room temperature,
Standing more than 3h, make library hybridize with BDNA, add the combination buffer of 130 μ L, 4 DEG C save backup (optimization probe
1 hybridizes with fixing probe 1, optimizes probe 2 and hybridizes with fixing probe 2).Specific experiment process is as follows:
(1) cleaning of gold film: first gold film is soaked and rock 3min in acetone, clean with ultrapure water, then use ethanol
Clean 3min, clean with ultrapure water, finally dry up with high pure nitrogen.
(2) assembling of sensing element: prism is clean by alcohol wipe, and pine and cypress oil is dripped in the central authorities at prism, is pacified by gold film
It is contained on prism, then prism, flow cell are installed in surface plasma body resonant vibration instrument (SPR).
(3) gold film modification: first in flow cell inject combine buffer solution (100mmol/L NaCl, 5mmol/L KCl,
2mmol/L MgCl2,1mmo/L CaCl2,20mmol/L Tris-HCl, pH7.6), record its SPR spectroscopy, be subsequently adding
The Biotin-BSA of 1mg/mL, incubated at room 2.5h, repeatedly rinse with combining buffer solution, record SPR angle；Add subsequently
Enter the Avidin of 1mg/mL, repeatedly rinse with combining buffer solution after incubated at room 1h, record SPR angle；It is eventually adding
The DNA of hybridization, modifies and repeatedly rinses with combining buffer solution after 1h, record SPR angle.
(4) mensuration of affinity: by the object Docetaxel of variable concentrations (25nmol/L, 50nmol/L, 100nmol/L,
150nmol/L, 250nmol/L, 500nmol/L) it is separately added in flow cell, hatch 10min with the DNA modified on gold film
After, with combining wash buffer 2min, record SPR angle.As it is shown in figure 1, with the concentration of object as abscissa, with not
The SPR angle caused after being combined with DNA with concentration target thing is changed to vertical coordinate mapping, the dissociation constant of calculation optimization probe
(Kd value), the Kd optimizing probe 1 is 69 ± 4nM, and the Kd optimizing probe 2 is 41 ± 7nM.Optimize probe 1 with excellent
The fixed sequence program changing probe 2 is different, it is seen that fixed sequence program is not the core sequence being combined with Docetaxel, provided by the present invention
Sequence TTCCAAACGTCCACCGCCAAAA be the core sequence being combined with Docetaxel, and this sequence is done into
One step investigation.
Investigate 2: use electrospray ionization mass spectrometry, the sequence that Docetaxel and the present embodiment are provided
The mixed solution of (5 '-TTCCAAACGTCCACCGCCAAAA-3 ') detects.According to atomic chart (IUPAC2007
Standard atomic weights), the aptamer that the present invention provides is 7426.17 with the composite molecular weight of Docetaxel.
The aptamer obtained by electrospray ionization mass spectrometry is 7425.7 with the composite molecular weight of Docetaxel.According to the 3rd
Side's examining report, electrospray ionization mass spectrometry error is 0.03%.Therefore, measurement error, in the range of method allowable error, is demonstrate,proved
The aptamer that bright this patent provides can be combined with high-affinity with Docetaxel, and result is shown in Fig. 2.
Investigate 3: use circular dichroism detector to aptamer (5 '-TTCCAAACGTCCACCGCCAAAA-3 ') structure
And aptamer be combined with Docetaxel after change of configuration characterize.The concentration of fixed nucleic acid aptamers is 10 μMs,
It is separately added into final concentration of 0 μM, 1 μM, 2 μMs, 3 μMs, the Taxotere alcoholic solution of 4 μMs.Buffer solution is
100mmol/L NaCl, 5mmol/L KCl, 2mmol/L MgCl2,1mmo/L CaCl2,20mmol/L Tris-HCl, 0.02%
pH7.6.Result is shown in Fig. 3, and from circular dichroism detector experimental result, the circular dichroism spectrogram of aptamer is at 249nm
Negative peak increases along with the concentration of Docetaxel, and angle signal strengthens, and crest occurs the blue shift of about 3nm.Illustrate that many west are purple
China fir alcohol makes the configuration of aptamer change, and the aptamer provided with the present embodiment in the way of embedding is combined.
The above is only the preferred embodiment of the present invention, and protection scope of the present invention is not limited merely to above-described embodiment.All
The technical scheme belonged under thinking of the present invention belongs to protection scope of the present invention.It is noted that for the art is common
For technical staff, improvements and modifications under the premise without departing from the principles of the invention, these improvements and modifications also should be regarded as this
Bright protection domain.
Claims (5)
1. the aptamer of a Docetaxel, it is characterised in that the nucleotides sequence of described aptamer is classified as the DNA fragmentation shown in following sequence 1:
Sequence 1:
5’-TTCCAAACGTCCACCGCCAAAA-3’。
Aptamer the most according to claim 1, it is characterised in that a certain position on the nucleotide sequence of described aptamer is phosphorylated, oxygen methylates, methylate, amination, sulfhydrylation or isotopologue.
Aptamer the most according to claim 1, it is characterised in that be combined with biotin, digoxin, fluorescent material, nano luminescent material, Polyethylene Glycol or folic acid labelling on the nucleotide sequence of described aptamer.
4. the aptamer derivant of a Docetaxel, it is characterized in that, described aptamer derivant is the phosphorothioate backbone that described in claim 1 or 2 or 3, the skeleton of the nucleotide sequence of aptamer derives, or lock nucleic acid or the peptide nucleic acid(PNA) accordingly that aptamer described in claim 1 or 2 or 3 is transformed into.
5. the aptamer as according to any one of claims 1 to 3 or the aptamer derivant as claimed in claim 4 purposes in preparing Docetaxel detection probe, Docetaxel target spot probe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410110983.4A CN103898119B (en) | 2014-03-24 | 2014-03-24 | The aptamer of a kind of Docetaxel, aptamer derivant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410110983.4A CN103898119B (en) | 2014-03-24 | 2014-03-24 | The aptamer of a kind of Docetaxel, aptamer derivant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898119A CN103898119A (en) | 2014-07-02 |
| CN103898119B true CN103898119B (en) | 2016-08-31 |
Family
ID=50989688
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410110983.4A Active CN103898119B (en) | 2014-03-24 | 2014-03-24 | The aptamer of a kind of Docetaxel, aptamer derivant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898119B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480114B (en) * | 2014-12-31 | 2017-12-05 | 湖南大学 | The method of high performance liquid chromatography screening aptamer and aptamer and application |
| CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
| CN111961108B (en) * | 2019-05-20 | 2022-09-09 | 湖南大学 | Aptamer drug conjugate and preparation method and application thereof |
| CN111172166B (en) * | 2020-02-15 | 2021-10-15 | 江南大学 | Nucleic acid aptamer for specifically recognizing beta-lactoglobulin and application thereof |
| CN117679529A (en) * | 2024-01-30 | 2024-03-12 | 成都中医药大学 | Aptamer-multivalent drug conjugate as well as preparation method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140194320A1 (en) * | 2011-08-12 | 2014-07-10 | Tagcyx Bitoecnologies | Method for preparing nucleic acid aptamer |
-
2014
- 2014-03-24 CN CN201410110983.4A patent/CN103898119B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| How nanotechnology can enhance docetaxel therapy;Li Zhang et al;《International Journal of Nanomedicine》;20131231;第8卷;2927–2941 * |
| Selective Recognition of Co-assembled Thrombin Aptamer and Docetaxel on Mesoporous Silica Nanoparticles against Tumor Cell Proliferation;Liang Gao,et al;《Chem. Eur. J.》;20111231;第17卷;13170－13174 * |
| 多西紫杉醇核酸适配体的高效筛选及其特性的初步考察;朱莹;《中国优秀硕士论文全文数据库 工程科技I辑》;20140915(第9期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898119A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898119B (en) | The aptamer of a kind of Docetaxel, aptamer derivant and application thereof | |
| US9951376B2 (en) | Methods for the selection of aptamers | |
| JP5731016B2 (en) | Nucleic acid molecule for detecting ligand with high sensitivity, method for screening the nucleic acid molecule, and method for optimizing the sensitivity of the nucleic acid molecule | |
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| Xing et al. | Graphene oxide-assisted non-immobilized SELEX of chiral drug ephedrine aptamers and the analytical binding mechanism | |
| CN104480114B (en) | The method of high performance liquid chromatography screening aptamer and aptamer and application | |
| CN104561008A (en) | Homocysteine aptamer HCy1 and preparation method thereof | |
| CN105814206B (en) | Peanut-binding nucleic acid molecules and uses thereof | |
| CN108977448A (en) | For detecting aptamer and its screening technique and the application of clenobuterol hydrochloride | |
| Lee et al. | A biosensor for the detection of single base mismatches in microRNA | |
| CN102732523B (en) | Aptamer for identifying zeatin through specifity, and screening method and application of aptamer | |
| Dickinson et al. | Cell-SELEX: in vitro selection of synthetic small specific ligands | |
| JP2016214086A (en) | Mutation detection method and kit of egfr gene | |
| JP2013099277A (en) | Fluorescent probe for detecting rna with high accuracy | |
| JP2020516232A5 (en) | ||
| CN105063055B (en) | A kind of heteronuclear glycosides or the Tenascin-C aptamer GBI-10 of different nucleoside combinations 2 '-deoxyinosine modification and its preparation method and application | |
| CN113913419A (en) | Preparation method of bivalent circular DNA chain, bivalent circular aptamer and application thereof | |
| CN104561010A (en) | Homocysteine aptamer HCy5 and preparation method thereof | |
| US11326169B2 (en) | Method of producing an aptamer and uses thereof | |
| JP7176739B2 (en) | Nucleic acid probe for target substance detection | |
| CN116410981A (en) | PAC1 nucleic acid aptamer and application thereof | |
| CN106442827A (en) | Method for simultaneously separating and detecting plurality of groups of micro RNAs through hydrodynamic chromatography | |
| CN104561009A (en) | Homocysteine aptamer HCy2 and preparation method thereof | |
| Krejcova et al. | Paramagnetic particles and PNA probe for automated separation and electrochemical detection of influenza | |
| US20210301330A1 (en) | Method and kit for detecting and/or quantifying a target nucleotide sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |