CN103882145B - A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation - Google Patents
A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation Download PDFInfo
- Publication number
- CN103882145B CN103882145B CN201410151509.6A CN201410151509A CN103882145B CN 103882145 B CN103882145 B CN 103882145B CN 201410151509 A CN201410151509 A CN 201410151509A CN 103882145 B CN103882145 B CN 103882145B
- Authority
- CN
- China
- Prior art keywords
- qgl3
- rice
- grain length
- grain
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of PCR molecule marking method identifying paddy rice grain length gene <i>qGL3</iGreatT .GreaT.GT allelic variation, belong to agro-biological engineering technical field.According to length, large grain strain TD70 and short, is granule kind Kasalath at grain length gene <i>? difference on qGL3</i> nucleotide base sequence, the different paddy DNAs of design and synthesis four specific molecular marker primer pairs carry out pcr amplification, amplified production carries out electrophoresis detection on the sepharose of 2.0%, after the colour developing of DuRed nucleic acid, namely the DNA band of different size represents the different allelotype of <i>qGL3</iGreatT .GreaT.GT.By molecule marking method of the present invention, can not only grain length gene <i> in Rice Germplasm Resources or breeding population be identified fast and accurately? the different allelic differences of qGL3</i>, and can significantly improve long grain homozygous genotype <i>qGL3-
tqGL3-
t?the efficiency of selection of </i>, is conducive to the improved coordination of paddy rice exterior quality and yield traits.
Description
One, technical field
The invention discloses a kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation, belong to agro-biological engineering technical field, be exclusively used in containing qGL3-
tqGL3-
tthe screening of the long grain high-quality of genotype, high-yield rice resource, qualification and breed breeding.
Two, background technology
Paddy rice is the important food crop of China, long-term cultivated area about 3,000 ten thousand hectares, account for 30% of national cereal cultivated area, paddy ultimate production, more than 20,000 ten thousand tons, accounts for more than 40% of national total grain output, therefore, Rice Production, to guarantee China grain security, is promoted national economic development and is had very important status (Lu Jingbo, Chinese rice, 2002,6:17-20).
In recent years, along with the raising of population growth and living standards of the people, the demand of domestic market to fine quality rice constantly increases.Rice breeding, while concern variety yield improves, focuses on the lifting (Luo Yukun etc., rice in China science, 2004,18 (2): 135-139) of rice quality more.The important indicator of paddy morphological specificity weighed by grain type, by grain length, grain, wide and thick three fundamentals of grain form for it, wherein the relation of grain length proterties and rice yield and exterior quality is the closest, the thus concern of extremely breeding man always in yield and quality of rice improvement.Under the wide constant prerequisite of guarantee grain, suitably increase grain length, the thousand seed weight of rice, output increase, chalky grain rate reduction, exterior quality become excellent.Genetic research shows, grain length is a complicated quantitative character, under different genetic group or envrionment conditions, show as different modes of inheritance, and it both may be subject to the effect of 1 or several major gene, also may be subject to multiple polygenic control, show the hereditary feature of normal distribution.Due to the additivity, dominant with epistatic analysis of grain length gene complexity, be difficult to carry out character improvement to it by the method for traditional breeding method, therefore only have utilize with grain length gene close linkage or be divided into from molecule marker carry out assistant breeding and could carry out accurate and effective selection to grain length proterties (poplar is loved and respect one's elder brother rich etc., Molecular Plant Breeding, 2010,8 (1): 59-66).
It is the prerequisite of carrying out marker assisted selection that the heredity of grain length gene is resolved, in recent years along with the structure of paddy rice dense genetic map spectrum and completing of gene order-checking, (the QuantitativeTraitLoci of grain length quantitative trait locus, QTL) positioning work achieves impressive progress (Wang Zhonghua etc., life science, 2009,21 (3): 444-451).According to the statistics of Gramene website, navigated to QTL76 that controls grain length proterties altogether by more than 20 dissimilar genetic groups by the end of in March, 2014, they are distributed widely on paddy rice 12 karyomit(e)s, wherein the QTL number that detects of the 3rd karyomit(e) at most and effect is relatively stable, thus (high will is strong to be considered to the hot spot region of paddy rice grain length gene distribution, heredity, 2011,33 (4): 314-321).
At present, the grain length gene of having cloned in paddy rice has GS3 and qGL3, and their positions are respectively at the 3rd chromosomal different zones.Wherein, the grain length major gene GS3 be positioned near kinetochore not only affects the length of seed, also affects the thousand seed weight of paddy simultaneously.Compared with short, granule paddy rice; a single nucleotide variations is there is in long, large grain kind GS3 gene on exon 2; the TGC codon mutation of original encoding aminothiopropionic acid is caused to become terminator codon TGA; make protein translation premature termination; the sequence of 4 conservative regions such as class PEBP structural domain is caused to lose; and then forfeiture gene function; seed length and weight are increased; this illustrates that the albumen of GS3 genes encoding has the effect (FanCC of negative regulation; etal.; TheoreticalandAppliedGenetics, 2006,112 (6): 1164-1171; MaoHL, etal., ProcNatlAcadSciUSA, 2010,107 (45): 19579-19584).Different from GS3, grain length gene qGL3 is positioned in the middle part of paddy rice the 3rd chromosome long arm, and its coding is containing the serine/threonine Phosphoric acid esterase of Kelch structural domain.Compared with 9311, there is C to an A mononucleotide nucleotide variation in long, large grain strain N411, cause the 364th amino acid to replace with L-glutamic acid by aspartic acid, cause clever hülle cell longitudinal splitting to accelerate in exon10, so cause that seed is elongated, change greatly.By finding the not homoallelic genetic effect analysis of qGL3; qGL3 is 0.33 ~ 1.17mm to the additive effect of grain length; 19.20% ~ 70.70% of soluble phenotypic variation; be 2.49 ~ 5.43g to the additive effect of thousand seed weight; 23.09% ~ 58.50%(ZhangXJ of soluble phenotypic variation, etal., ProcNatlAcadSciUSA; 2012,109 (52): 21534-21539; HuZetal., JournalofIntegrativePlantBiology, 2012,54 (12): 979-990).As can be seen here, as the new gene that grain length effect in paddy rice is larger, qGL3 is with a wide range of applications in yield of brown rice and quality breeding.
The order-checking research of gene shows; the distribution of grain length synergy genotype in common rice of qGL3 is very rare; only exist in some special long grain germ plasm resources as N411, DT108 and CW23 etc.; lacking allelic variation is the principal element (ZhangXJ that qGL3 is not yet utilized effectively in breeding; etal.; ProcNatlAcadSciUSA, 2012,109 (52): 21534-21539; HuZetal., JournalofIntegrativePlantBiology, 2012,54 (12): 979-990).Meanwhile, due to the allelic hereditary effect of qGL3 grain length synergy and GS3 gene very similar, be difficult to by effectively distinguishing these two kinds different genes to grain measurement of length.Therefore obtain can identify the molecule marker of qGL3 different genotype to the qualification of long grain Rice Germplasm Resources and breeding utilization significant.But, the linked marker that can be used for qGL3 genotype screening reported all comes from larger Xian, Jing Jiao target group of hereditary difference, not only polymorphism is lacked in breeding selection, and difficulty has ensured the accuracy (ZhangXJ to offspring's individual plant genotype identification, etal., ProcNatlAcadSciUSA, 2012,109 (52): 21534-21539).Therefore, the molecule marking method setting up a kind of PCR-based technology distinguishes the different allelotrope of qGL3 fast and accurately, will contribute to length, the screening of Large grain rice kind matter new resources, qualification and breeding utilization.
Three, summary of the invention
Technical problem: the present invention is directed to that existing linked marker is difficult to fast, the situation of the different allelotype of precise Identification grain length gene qGL3, according to length, large grain kind and short, that granule kind exists C to A in qGL3 exon10 mononucleotide base difference, design Gene specific PCR primers increases to paddy DNA, the not isoallele of qGL3 is identified fast and accurately, to improve long grain homozygous genotype qGL3-by agarose gel electrophoresis and the colour developing of DuRed nucleic acid
tqGL3-
tefficiency of selection, accelerate long grain high-quality, the screening of high-yield rice resource, qualification and breed breeding.
Technical scheme:
The present invention's " a kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation ", is characterized in that: utilize qGL3 gene-specific primer
Forward outer primer qGL3-O-F sequence: 5'-GGCCACTCATGCACCATAACTACACTTG-3'
Reverse outer primer qGL3-O-R sequence: 5'-CAGGTTTTCTTACCTCCTCGTAGACCTCCA-3'
Forward inner primer qGL3-I-F sequence: 5'-TGCACGATTCTATCTGGTTCAGTGCTAAAC-3'
Reverse inner primer qGL3-I-R sequence: 5'-TGTCGCACCAGACTCCAGCAGCTATT-3'
Fast, the PCR molecule marking method accurately distinguishing the different allelic variation of paddy rice grain length gene qGL3 is:
(1) extraction (SDS method) of rice plant genomic dna, with reference to DellaportaSL, etal., PlantMolBiolRep, 1983,1 (1): 19221;
(2) above-mentioned specific molecular marker primer qGL3-O-F, qGL3-O-R, qGL3-I-F and qGL3-I-R are added same PCR reaction system, and the DNA of Rice Germplasm Resources or breeding population plant is increased; 20 μ LPCR reaction systems comprise: the primer 2 .0 μ L of the DNA2.0 μ L of 20ng/ μ L, 4nmol/L, wherein each 0.5 μ L of primer qGL3-O-F, qGL3-O-R, qGL3-I-F and qGL3-I-R, containing 25mmol/LMgCl
210 × PCRBuffer2.0 μ L, Taq0.5 μ L and ddH of the dNTP0.4 μ L of 2.5mmol/L, 2U/ μ L
2o13.1 μ L;
PCR response procedures comprises: 94 DEG C of denaturation 5min; Then 94 DEG C of sex change 30s, 55 DEG C of renaturation 30s, 72 DEG C of extension 1min, circulate 33 times; Then, after 72 DEG C of extension 10min, amplified production is added sample-loading buffer termination reaction.
(3) reaction product is 100V electrophoresis 50min on the sepharose of 2.0% in quality than concentration, observes, to record through DuRed nucleic acid staining under gel imaging system.If simultaneously containing 448bp and 288bp two characteristic bands, then for containing grain length genotype qGL3-
tqGL3-
thomozygote; If simultaneously containing 448bp and 216bp two characteristic bands, then for containing grain length genotype qGL3-
kqGL3-
khomozygote, if there are three characteristic bands of 448bp, 288bp and 216bp simultaneously, then for containing grain length genotype qGL3-
tqGL3-
kheterozygote.
Beneficial effect
" a kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation " provided by the invention, has the following advantages:
(1) molecule marker provided by the invention is the functional indicia according to the allelic difference design of qGL3, its nucleotide variation directly can reflect the phenotype of plant, the heredity do not existed between mark and gene exchanges and causes genotypic mistake qualification, efficiently solves in Molecular Detection process and marks the not high drawback of polymorphism difference, accuracy;
(2) molecule marking method provided by the invention can by the Rapid identification of simple pcr amplification realization to qGL3 different genotype rice germplasm.Because paddy rice grain length proterties is by the quantitative character of controlled by multiple genes, and the hereditary effect of qGL3 gene and GS3 closely similar, only be difficult to determine whether there is its target gene type, then can overcome this defect by molecule marking method of the present invention in paddy rice according to its grain length phenotype;
(3) molecule marking method provided by the invention can be effective to long grain high-quality, high-yield rice varietal labeling assistant breeding.Because traditional breeding method mainly relies on visual inspection and linear measure to the selection of grain length proterties, such selection is not only by the impact in vine growth and development stage, and consuming time, effort.Utilize molecule marking method of the present invention, in seedling stage just by the specific band of primer amplification, judge the allelic differences that qGL3 is different, the phenotype of Grain Length in Rice is predicted with this, something which increases the efficiency of selection of rice varieties, shorten breeding cycle and reduce breeding cost, accelerating the improvement process of paddy rice exterior quality and output.
Four, accompanying drawing explanation
Long, the large grain strain TD70 of Fig. 1 compares with short, granule kind Kasalath seed length
(A: containing qGL3-
tqGL3-
thomozygous genotype is long, Large grain rice strain-TD70; B: containing qGL3-
kqGL--
khomozygous genotype is short, granule rice varieties-Kasalath)
Fig. 2 utilizes TD70/Kasalath recombinant inbred lines to locate grain length QTL-qGL3
Fig. 3 is for detecting the PCR molecule marker layout strategy of grain length gene qGL3 allelic variation
(note: in gene comparision figure, square frame represents the base difference site of qGL3 gene growing, in large grain strain TD70 and short, granule kind Kasalath; Arrow represents primer location and length, and qGL3-O-F represents forward outer primer, and qGL3-O-R represents reverse outer primer, and qGL3-I-F represents forward inner primer, and qGL3-I-R represents reverse inner primer)
Fig. 4 specific PCR molecule marker is to the allelic detection of different rice varieties qGL3
(M:DNA molecular weight standard, 100-2,000bp; 1:TD70; 2:Kasalath; 3 ~ 17: military round-grained rice 13, fine, the Suyunuo of Japan, osmanthus towards glutinous, southern round-grained rice 44, military fortune round-grained rice 23,9311, bright extensive 63, precious Shan 97, osmanthus towards No. 2, extensive 158, the China in extensive 527, the another name for Sichuan Province in Long Tefu, another name for Sichuan Province accounts for and Nanjing 11)
Fig. 5 specific PCR molecule marker is to the allelic detection of the different strain qGL3 of TD70/Kasalath recombinant inbred lines (M:DNA molecular weight standard, 100-2,000bp; 1:TD70; 2:Kasalath; 3:TD70/KasalathF
1; 4 ~ 7: part RIL plant)
Fig. 6 molecule marking method of the present invention is used for the improved, process of rice varieties Kasalath grain length proterties
Fig. 7 Kasalath and Kasalath-qGL3
-Tthe comparison of Improved lines grain length proterties
(A: containing qGL3
-KqGL3
-Khomozygous genotype is short, granule paddy rice Kasalath; B: containing qGL3
-TqGL3
-Thomozygous genotype is long, Large grain rice Kasalath-qGL3
-T)
Five, embodiment
By carrying out a qualification for type proterties, analysis to more than 3000 part Rice Germplasm Resources of agricultural germ plasm resource storehouse in mid-term, Jiangsu Province cryopreservation, therefrom screening 1 part of length, greatly grain japonica rice deriving from Swan Valley ///9520//(72-496/ drives glutinous) filial generation and stablizing strain TD70.TD70 and short, granule India rice variety Kasalath is utilized to hybridize, the recombinant inbred lines containing 240 strains is constructed through single seed descent, by drafting and the 2010-2011 QTL positioning analysis of continuous 2 years of Molecular Markers Linkage Map, rice chromosome navigates to multiple QTL relevant to grain type, wherein on the 3rd karyomit(e), navigates to 1 grain length QTL-qGL3-2.By the sequencing analysis to TD70 and KasalathDNA, determining qGL3-2 is exactly the qGL3 gene reported, one is positioned at paddy rice the 3rd chromosome long arm and controls the new main effect QTL (Fig. 2) of grain length proterties.Compared with short, granule rice varieties Kasalath, the variation of a single base C-A is there is in long, large grain strain TD70 at this gene exon10 1092 Nucleotide places, the 364th amino acid is caused to replace with L-glutamic acid by aspartic acid, cause clever hülle cell longitudinal splitting to accelerate, so cause seed elongated, become large phenotype.Devise specific PCR molecule marker according to this mononucleotide difference, utilize the method effectively can identify the not isoallele of grain length gene qGL3 in Rice Germplasm Resources or breeding population, improve grain length synergy genotype qGL3
-TqGL3
-Tefficiency of selection, shorten breeding cycle, reduce breeding cost, accelerate long grain high-quality, the screening of high-yield rice resource, qualification and breed breeding.
For fully openly the present invention's " a kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation ", be illustrated below in conjunction with method validation and embodiment.Its concrete implementation step is as follows:
(1) test materials
Derive from Swan Valley ///9520//(72-496/ drives glutinous) filial generation, long, large grain japonica rice strain TD70(grain length 13.70 ± 0.10mm, thousand seed weight 80.75 ± 2.35g); Short, granule India rice variety Kasalath, grain length 8.09 ± 0.06mm, thousand seed weight 20.25 ± 0.12g) and derive from TD70/Kasalath240 strain (F
8the recombinant inbred lines formed from generation to generation).
6 conventional japonica rice kinds: Wujin, military round-grained rice 13(changzhou rice wheat breeding station), Japan fine (agriculture examination hall, Aichi, Japan), Suyunuo (TAI HU AREA, Jiangsu farm variety), osmanthus is towards glutinous (Agricultural College Affiliated to Yangzhou Univ.), Nan Jing 44(Cereal Crops Research Inst., Jiangsu Agricultural Science Academy) and militaryly transport Wujin, round-grained rice 23(changzhou rice research institute);
9 indica conventional rice materials: raise rice No. 6 (Inst. of Agricultural Science, Lixiahe Prefecture, Jiangsu Prov.), bright extensive 63(Sanming, Fujian Province Institute of agricultural sciences), precious Shan 97(Wenzhou District of Zhejiang Province Institute of agricultural sciences), osmanthus is towards No. 2 (Guangxi Academy of Agricultural Sciences), Long Tefu (Zhangzhou, Fujian Institute of agricultural sciences), Shu Hui 527(Inst. of Paddy Rice, Sichuan Agriculture Univ.), Shu Hui 158(Inst. of Paddy Rice, Sichuan Agriculture Univ.), China accounts for (rice in China institute) and Nanjing 11(Cereal Crops Research Inst., Jiangsu Agricultural Science Academy).
Above material is public material, and agricultural germ plasm resource storehouse in mid-term, Jiangsu Province can provide free.Concrete reference is: Zhang Yadong etc., rice in China science, 2013,27 (2): 122-128; Money Jin Ao etc., Jiangsu's agriculture science, 2005,4:305; Jiang Yunhong etc., Shandong agricultural sciences, 1981,2:28-29; Wu Jinglun etc., Jiangsu's agriculture science, 1992,3:6-8; Wang Feihua, Yangzhou University's Master's thesis, 2009,23; Wang Cailin etc., Chinese rice, 2007,13 (2): 33-34; Wang Zhiming etc., China seed industry, 2011,5:75; Wear positive element etc., Jiangsu's agriculture science, 1997,4:13-14; Wu Fangxi etc., Fujian Journal of Agricultural Sciench, 2011,26 (6): 1101-1112; Chen Jianming etc., seed, 2002,3:50-51; Lin Shicheng, Min Shaokai, rice in China kind and pedigree thereof. Shanghai: Shanghai science tech publishing house .1991:312; Height is bright, hybrid rice, 2001,16 (2): 5-6; Wang Yu equality, hybrid rice, 2004,19 (4): 12-14; Wu Xianjun etc., China seed industry, 2007,10:70; Yu Shengmiao etc., hybrid rice, 2009,24 (6): 42-44; Lin Shicheng, Min Shaokai, rice in China kind and pedigree thereof. Shanghai: Shanghai science tech publishing house .1991:318.
(2) exploitation of grain length gene qGL3 molecule marker
(1) screening of length, Large grain rice germ plasm resource
By carrying out a qualification for type proterties, analysis to more than 3000 part Rice Germplasm Resources of agricultural germ plasm resource storehouse in mid-term, Jiangsu Province cryopreservation, therefrom screen 1 part and derive from Swan Valley ///9520//(72-496/ drives glutinous) filial generation, long, large grain japonica rice stablizes strain TD70.By grain type phenotype test for years, TD70 grain length 13.70 ± 0.10mm, thousand seed weight 80.75 ± 2.35g, short, granule India rice variety Kasalath grain length 8.09 ± 0.06mm, thousand seed weight 20.25 ± 0.12g, both difference highly significants (Fig. 1).
(2) the QTL Position Research of TD70/Kasalath RIL grain length gene
Utilize long, Large grain rice strain TD70 and short, granule rice variety Kasalath is hybridized, the recombinant inbred lines containing 240 strains is constructed through single seed descent, the microsatellite marker utilizing 141 to there is polymorphic differences between parent depicts the Molecular Markers Linkage Map of this colony, be former data with grain length measured value, utilize QTLIciMapping3.1 software, using LOD value 2.5 as threshold value, complete Interval Mapping is adopted to scan within the scope of full-length genome, detect grain length proterties QTL site, paddy rice the 3rd chromosome long arm navigates to 1 main effect grain length QTL-qGL3-2.Analyze the qGL3-2 gene order of TD70 and Kasalath, find between them, to there is many places base difference.Wherein there is C to A mononucleotide nucleotide variation at this gene exon10 1092 Nucleotide places in TD70, the 364th amino acids is caused to replace with L-glutamic acid by aspartic acid, the speed of clever hülle cell longitudinal splitting is caused to be accelerated, and then cause seed elongated, become large phenotype, therefore determine that qGL3-2 is exactly the grain length gene qGL3 reported.
(3) design of primers marked
There is single nucleotide variation of C to A at qGL3 site exon10 1092 Nucleotide places according to TD70 and Kasalath, the qGL3 genomic BAC clones sequence (sequence number is: AK288069) announced is downloaded from NCBI website, devise specific PCR molecule marker (Fig. 3), its primer sequence is:
Forward outer primer qGL3-O-F sequence: 5'-GGCCACTCATGCACCATAACTACACTTG-3'
Reverse outer primer qGL3-O-R sequence: 5'-CAGGTTTTCTTACCTCCTCGTAGACCTCCA-3'
Forward inner primer qGL3-I-F sequence: 5'-TGCACGATTCTATCTGGTTCAGTGCTAAAC-3'
Reverse inner primer qGL3-I-R sequence: 5'-TGTCGCACCAGACTCCAGCAGCTATT-3'
(3) molecular marker analysis
(1) extraction of rice varieties genomic dna
The extraction (SDS method) of rice varieties genomic dna, with reference to DellaportaSL, etal., PlantMolBiolRep, 1983,1 (1): 19221.Concrete steps are: get rice seedling blade, in the mortar of-20 DEG C of precoolings, load 1.5mL centrifuge tube by liquid nitrogen grinding; Add 600uL extracting solution (20%SDS, 1MTris-HCl, 0.5MEDTA, 5MNaCl, 65 DEG C of preheatings), shake up, 65 DEG C of temperature bath 30min, middle vibration 3 ~ 4 times; Add 1/4 volume 5MKAC, shake up rearmounted 30min on ice; Add chloroform-isoamyl alcohol (24:1) 300 ~ 400uL, shaking table fully vibrates, 120rpm, 30min; Centrifugal 15 minutes of 8000 ~ 10000rpm, liquid level layering, lower floor's color is comparatively dark, and the micro-band yellow-green colour in upper strata, gets supernatant (about 400uL) to another centrifuge tube; Add equal-volume chloroform-isoamyl alcohol (24:1), shaking table fully vibrates, 80 ~ 90rpm, 30min; Centrifugal 15 minutes of 8000rpm, transfer supernatant (about 400uL) is to new centrifuge tube; Add the dehydrated alcohol of 2 times of volumes-20 DEG C of precoolings, shake up until there is floss to produce gently, the centrifugal 6min of 12000rpm; Abandon dehydrated alcohol, add 4 DEG C of 70% ethanol, place 10min, abandon supernatant, air-dry 1h on Bechtop; Add 100 ~ 200uLTE ,-20 DEG C of preservations.
(2) amplification of molecule marker and electrophoresis detection
QGL3 gene specific molecular marker primer sequence is:
Forward outer primer qGL3-O-F sequence: 5'-GGCCACTCATGCACCATAACTACACTTG-3'
Reverse outer primer qGL3-O-R sequence: 5'-CAGGTTTTCTTACCTCCTCGTAGACCTCCA-3'
Forward inner primer qGL3-I-F sequence: 5'-TGCACGATTCTATCTGGTTCAGTGCTAAAC-3'
Reverse inner primer qGL3-I-R sequence: 5'-TGTCGCACCAGACTCCAGCAGCTATT-3'
Described molecule marker primer qGL3-O-F, qGL3-O-R, qGL3-I-F and qGL3-I-R are added same PCR reaction system, pcr amplification is carried out to the DNA of different rice varieties and each strain of TD70/Kasalath recombinant inbred lines;
20 μ LPCR reaction systems comprise: the primer 2 .0 μ L of the DNA2.0 μ L of 20ng/ μ L, 4nmol/L, wherein each 0.5 μ L of primer qGL3-O-F, qGL3-O-R, qGL3-I-F and qGL3-I-R, containing 25mmol/LMgCl
210 × PCRBuffer2.0 μ L, Taq0.5 μ L and ddH of the dNTP0.4 μ L of 2.5mmol/L, 2U/ μ L
2o13.1 μ L;
PCR response procedures comprises: 94 DEG C of denaturation 5min; Then 94 DEG C of sex change 30s, 55 DEG C of renaturation 30s, 72 DEG C of extension 1min, circulate 33 times; Then, after 72 DEG C of extension 10min, amplified production is added sample-loading buffer termination reaction; Reaction product is 100V electrophoresis 50min on the sepharose of 2.0% in quality than concentration, observes, to record through DuRed nucleic acid staining under gel imaging system.
(4) specific PCR molecule marker of the present invention is to the allelic detection of different rice varieties qGL3
With length, large grain strain TD70 and short, granule kind Kasalath for contrast, Suyunuo fine to the military round-grained rice 13 of 6 japonica rice varieties, Japan, osmanthus towards glutinous, southern round-grained rice 44, military fortune round-grained rice 23 and 9 rice varieties 9311, bright extensive 63, precious Shan 97, osmanthus towards No. 2, extensive 527, the another name for Sichuan Province in Long Tefu, another name for Sichuan Province is extensive 158, China accounts for, the DNA in Nanjing 11 carries out the genotypic detection of qGL3.Pcr amplification product can show the band of two types through the agarose gel electrophoresis of 2.0%.Wherein all occurred in each DNA sample by the band of the 448bp of forward and reverse outer primer qGL3-O-F and qGL3-O-R amplification, can it not only play positive control (detecting DNA effectively be increased), also effectively can reduce the amplification of non-specific PCR primer and the formation of primer dimer simultaneously.Except the total band of 448bp, only there is long, large grain strain TD70 can amplify the characteristic bands of a treaty 288bp, this band is increased by forward outer primer qGL3-O-F and reverse inner primer qGL3-I-R and produces, loci (i.e. long, large grain strain TD70 genotype, the qGL3 of to be qGL3 site exon10 1092 Nucleotide the be A of its amplification
-TqGL3
-T); And other all Xian, japonica rice variety all can only amplify the characteristic bands of the treaty 216bp except 448bp, this band is increased by forward inner primer qGL3-I-F and reverse outer primer qGL3-O-R and produces, loci (i.e. short, granule kind Kasalath genotype, the qGL3 of to be qGL3 site exon10 1092 Nucleotide the be C of its amplification
-KqGL3
-K) (Fig. 4).This demonstrates the grain length synergy gene qGL3 of qGL3
-TqGL3
-Tdistribution in common rice is really very rare, exists only in the special long grain germ plasm resource of only a few.By to having qGL3
-KqGL3
-K15 Xian of homologous genes type, japonica rice variety carry out the analysis of grain length proterties, and result shows that the reason causing these kinds to there is grain length difference is only that they have different GS3 allelotypes (table 1).
Table 1 Xian, japonica rice variety GS3 and qGL3 different genotype and grain length phenotypic number
(5) specific PCR molecule marker of the present invention is to the different detection of allelotype of TD70/Kasalath recombinant inbred lines qGL3 and the comparison of grain length phenotypic number
With the exceptional function mark of qGL3 gene, allelotype detection is carried out to 240 strains deriving from TD70 and Kasalath recombinant inbred lines.Result shows, only has in 131 strains of grain length gene qGL3 allelomorphism difference, the strain (qGL3 identical with TD70 banding pattern
-TqGL3
-T) there are 17, the strain (qGL3 identical with Kasalath banding pattern
-KqGL3
-K) have 114 (Fig. 5).By finding, containing qGL3 the analysis of two kinds of Genotype Strains grain length variation situations
-TqGL3
-Tgenotype Strains grain length mean value is 10.19mm, containing qGL3
-KqGL3
-Kgenotype Strains grain length mean value is 8.72mm, and both exist pole significant difference (table 2).This illustrates that the grain length of different strain in qGL3 gene pairs TD70/Kasalath recombinant inbred lines has considerable influence, is the important main effect site of grain length proterties.
Table 2 has the comparison of grain length gene qGL3 two kinds of different genotype strain grain length mean values
(6) analysis of GS3 and qGL3 gene genetic effect in TD70/Kasalath recombinant inbred lines
RIL 240 strains can be divided into four kinds of genotype combination: GS3 by the banding pattern according to qGL3 and GS3 gene specific PCR molecule marker
-TqGL3
-T, qGL3
-KgS3
-T, qGL3
-TgS3
-Kand qGL3
-KgS3
-K.By finding, containing qGL3 the comparative analysis of different genotype combination strain grain length mean value
-TgS3
-Tthe grain length mean value of Genotype Strains is 11.10mm, and pole is significantly higher than other three kinds of genotype combination; Containing qGL3
-Kand GS3
-Tthe grain length mean value of Genotype Strains is 9.98mm, a little less than containing qGL3
-TgS3
-Kthe grain length mean value of Genotype Strains is 10.19mm, but does not have significant difference between the two; And containing qGL3
-TgS3
-Tthe grain length mean value of Genotype Strains is minimum is 8.72mm, they qGL3 is expressed as to the large I of the hereditary effect of grain length
-TgS3
-T>qGL3
-KgS3
-T≌ qGL3
-TgS3
-K>qGL3
-KgS3
-K(table 3).As can be seen from the above analysis, single grain length synergy gene qGL3
-Tand GS3
-Twhen independently existing, their effect does not have significant difference, and when a synergy genetically deficient, another synergy gene just shows self hereditary effect; GS3
-Tand qGL3
-Twhen two synergy genes exist, although the phenotypic number of grain length is maximum simultaneously, do not show the additive effect of gene completely; And when two synergy genes do not exist, grain length phenotypic number is minimum.As can be seen here, the mechanism of action of qGL3 and GS3 gene pairs grain length is also incomplete same, and qGL3 gene has the value of equal importance with GS3 in breeding.Moreover, by the polymerization of qGL3 and GS3 synergy gene, length and the thousand seed weight of rice grain can also be improved further, and then promote the quality and yield of rice varieties.
The comparison of table 3qGL3 and GS3 tetra-kinds of genotype combination strain grain length mean values
(7) molecule marking method of the present invention is used for the improvement of rice varieties Kasalath grain length proterties
Long, large grain strain TD70 is selected to be grain length gene qGL3
-Tdonor, short, granule kind Kasalath is acceptor, adopts the strategy of back cross breeding, the grain length proterties of orderly improvement Kasalath.In the process of continuous backcross and selfing, utilize qGL3 of the present invention
-Tthe specific PCR molecule marker of gene carries out tracing detection, and in conjunction with the Systematic selection of economical character, to BC
3f
3it is qGL3 that generation obtains grain length genotype
-TqGL3
-T, other economical character and the basically identical grain length of original Kasalath improve strain-Kasalath-qGL3
-T, its concrete Breeding Process refers to Fig. 6.By to Kasalath-qGL3
-Tfind, containing qGL3 with the grain length of original variety Kasalath and the comparative analysis of thousand seed weight
-TqGL3
-Tthe Improved lines grain length of homozygous genotype is 10.07 ± 0.08mm, and thousand seed weight is 25.5 ± 0.09g, containing qGL3
-KqGL3
-Kthe Kasalath grain length of homozygous genotype is 8.09 ± 0.06mm, and thousand seed weight 20.25 ± 0.12g exists pole significant difference (Fig. 7) between the two.This shows that molecule marking method of the present invention can be selected the genotype of grain length gene qGL3, and then realizes improveing fast and accurately grain length proterties.
SEQUENCELISTING
<110> Jiangsu Province Agriculture Science Institute
<120> mono-kind identifies the PCR molecule marking method of paddy rice grain length gene qGL3 allelic variation
<130>0
<160>4
<170>PatentInversion3.1
<210>1
<211>28
<212>DNA
<213>1
<220>
<221>qGL3-O-F
<222>(1)..(28)
<223>
<400>1
ggccactcatgcaccataactacacttg28
<210>2
<211>30
<212>DNA
<213> is artificial
<220>
<221>qGL3-O-R
<222>(1)..(30)
<223>
<400>2
caggttttcttacctcctcgtagacctcca30
<210>3
<211>30
<212>DNA
<213> is artificial
<220>
<221>qGL3-I-F
<222>(1)..(30)
<223>
<400>3
tgcacgattctatctggttcagtgctaaac30
<210>4
<211>26
<212>DNA
<213>
<220>
<221>qGL3-I-R
<222>(1)..(26)
<223>
<400>4
tgtcgcaccagactccagcagctatt26
Claims (2)
1. a qualification paddy rice grain length gene
qGL3the PCR molecule marking method of allelic variation, is characterized in that:
With
qGL3gene-specific primer
Forward outer primer
qGL3-o-F sequence: 5'-GGCCACTCATGCACCATAACTACACTTG-3'
Reverse outer primer
qGL3-o-R sequence: 5'-CAGGTTTTCTTACCTCCTCGTAGACCTCCA-3'
Forward inner primer
qGL3-i-F sequence: 5'-TGCACGATTCTATCTGGTTCAGTGCTAAAC-3'
Reverse inner primer
qGL3-i-R sequence: 5'-TGTCGCACCAGACTCCAGCAGCTATT-3'
The genomic dna of amplifying rice kind, if simultaneously containing 448bp and 288bp two characteristic bands, then for containing grain length genotype
qGL3- t qGL3- t homozygote; If simultaneously containing 448bp and 216bp two characteristic bands, then for containing grain length genotype
qGL3- k qGL3- k homozygote, if there are three characteristic bands of 448bp, 288bp and 216bp simultaneously, then for containing grain length genotype
qGL3- t qGL3- k heterozygote.
2. method according to claim 1, is characterized in that:
(1) extraction of rice plant genomic dna;
(2) by molecule marker primer according to claim 1
qGL3-O-F,
qGL3-O-R,
qGL3-I-F and
qGL3-I-R adds same PCR reaction system, and increases to the DNA of Rice Germplasm Resources or breeding population plant; 20 μ LPCR reaction systems comprise: the primer 2 .0 μ L of the DNA2.0 μ L of 20ng/ μ L, 4nmol/L, wherein primer
qGL3-O-F,
qGL3-O-R,
qGL3-I-F and
qGL3the each 0.5 μ L of-I-R, containing 25mmol/LMgCl
210 × PCRBuffer2.0 μ L, the dNTP0.4 μ L of 2.5mmol/L, 2U/ μ L's
taq0.5 μ L and ddH
2o13.1 μ L;
PCR response procedures comprises: 94 DEG C of denaturation 5min; Then 94 DEG C of sex change 30s, 55 DEG C of renaturation 30s, 72 DEG C of extension 1min, circulate 33 times; Then, after 72 DEG C of extension 10min, amplified production is added sample-loading buffer termination reaction;
(3) reaction product is 100V electrophoresis 50min on the sepharose of 2.0% in quality than concentration, observes, to record through DuRed nucleic acid staining under gel imaging system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410151509.6A CN103882145B (en) | 2014-04-15 | 2014-04-15 | A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410151509.6A CN103882145B (en) | 2014-04-15 | 2014-04-15 | A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103882145A CN103882145A (en) | 2014-06-25 |
| CN103882145B true CN103882145B (en) | 2016-03-02 |
Family
ID=50951262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410151509.6A Active CN103882145B (en) | 2014-04-15 | 2014-04-15 | A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882145B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104928286B (en) * | 2014-12-24 | 2018-04-10 | 中国水稻研究所 | A kind of molecular labeling of the dominant grain length gene of rice |
| CN104694625B (en) * | 2015-01-22 | 2017-08-11 | 中国水稻研究所 | A kind of method of utilization molecular marking supplementary breeding length grain type paddy rice |
| CN104694626B (en) * | 2015-01-22 | 2017-08-11 | 中国水稻研究所 | A kind of method of short grain type paddy rice in utilization molecular marking supplementary breeding |
| CN108239673A (en) * | 2016-12-26 | 2018-07-03 | 中国科学院植物研究所 | A kind of method for cultivating high-yield crop and its special specific gene pack section and special primer pair |
| CN106755434B (en) * | 2016-12-28 | 2018-03-09 | 海南波莲水稻基因科技有限公司 | The molecular labeling of rice grain length gene qGL3 a kind of and its application |
| CN112210616B (en) * | 2019-07-12 | 2022-03-01 | 南京农业大学 | InDel molecular marker primer related to length traits of rice grains and application thereof |
| CN110684858B (en) * | 2019-11-04 | 2023-09-26 | 广东省农业科学院水稻研究所 | Molecular marker of rice slender grain type gene and application thereof |
| CN113151574B (en) * | 2021-06-04 | 2022-04-22 | 中国水稻研究所 | InDel molecular marker GS9-InDel of rice grain shape major QTL and detection primer and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154471A (en) * | 2011-01-17 | 2011-08-17 | 南京农业大学 | Molecular marking method for major quantitative trait loci(QTL) for rice grain length |
| CN102352367A (en) * | 2011-10-24 | 2012-02-15 | 南京农业大学 | Clone and application of semi-dominant gene qGL3 capable of controlling grain length and grain weight of rice kernel |
-
2014
- 2014-04-15 CN CN201410151509.6A patent/CN103882145B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154471A (en) * | 2011-01-17 | 2011-08-17 | 南京农业大学 | Molecular marking method for major quantitative trait loci(QTL) for rice grain length |
| CN102352367A (en) * | 2011-10-24 | 2012-02-15 | 南京农业大学 | Clone and application of semi-dominant gene qGL3 capable of controlling grain length and grain weight of rice kernel |
Non-Patent Citations (1)
| Title |
|---|
| 一种SNP检测新方法：四引物扩增受阻突变体系PCR技术;管峰等;《生命的化学》;20141231;第24卷(第6期);对比文件2摘要以及图1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103882145A (en) | 2014-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103882145B (en) | A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation | |
| CN103882146B (en) | Four-primer molecular marking method for identifying different genotypes of rice grain length gene GS3 | |
| CN104073487B (en) | The molecule marker of rice blast resistant gene Pi2 and application thereof | |
| CN102154470B (en) | Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy | |
| CN106755561B (en) | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root dry weight and application | |
| CN112626260B (en) | Molecular marker linked with peanut kernel weight major QTL (quantitative trait locus) and application thereof | |
| Wang et al. | Development of a new japonica rice variety Nan-jing 46 with good eating quality by marker assisted selection | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN110684858B (en) | Molecular marker of rice slender grain type gene and application thereof | |
| CN107099588B (en) | Development and application of SSR (simple sequence repeat) marker for identifying earliness of upland cotton | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN103160584B (en) | Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN112391488B (en) | SNP marker for identifying broccoli variety Zhe Qing 80 | |
| CN105821153B (en) | The relevant molecular labeling of rape cracking resistance angle character main effect QTL and application | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN104711254A (en) | InDel molecular marker in low-phosphorus response gene ZmARF31 of corn and application thereof | |
| CN106434948B (en) | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application | |
| CN106636358B (en) | The functional molecular marker of rice blast resistance gene Pi2 a kind of and its application | |
| CN112029886B (en) | Single primer molecule identification method of rice low amylose content regulatory gene | |
| CN106480066B (en) | The new gene Wbph9 (t) and its molecule labelling method of a kind of Rice Resistance white backed planthopper and application | |
| CN117683938B (en) | KASP molecular marker closely linked with tomato fruit width and application thereof | |
| CN116356073B (en) | Molecular marker linked with loose cauliflower short stem gene and application thereof | |
| CN116144820B (en) | Indel mark with cucumber root re-regulating and controlling gene linkage and application thereof | |
| CN106834485B (en) | Molecular marker of rice blast resistance gene Pi9 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |