CN103882129A - Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas - Google Patents
Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas Download PDFInfo
- Publication number
- CN103882129A CN103882129A CN201410101603.0A CN201410101603A CN103882129A CN 103882129 A CN103882129 A CN 103882129A CN 201410101603 A CN201410101603 A CN 201410101603A CN 103882129 A CN103882129 A CN 103882129A
- Authority
- CN
- China
- Prior art keywords
- mir
- pcr
- quantitative fluorescent
- human plasma
- reverse transcription
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescent quantitative PCR (polymerase chain reaction) method for detecting miR-9 in human plasmas. The method is characterized by firstly designing a specific stem-loop-shaped reverse transcription primer and specific miR-9 PCR amplification primers, secondly establishing and optimizing a real-time quantitative reaction system and reaction procedures, and finally computing the relative expression quantity of miR-9 according to a deltaCt method. According to the invention, because the specific reverse transcription primer and the PCR primers are utilized, the specificity of fluorescent quantitative PCR is guaranteed. The method has high sensitivity and high specificity and is used for quickly and accurately detecting miR-9. The practical method is provided for diagnosis, monitoring and prognosis of clinical tumors.
Description
Technical field
The detection method and the test kit that the present invention relates to miR-9 quantitative fluorescent PCR in a kind of human plasma, can be used for the detection of miR-9 in tumour patient blood plasma.Belong to biological technical field.
Background technology
MicroRNAs (miRNAs) is a kind of noncoding, endogenic microRNA, the about 20-23 of a length Nucleotide.MiRNAs can be combined with the complementary sequence of the upper 3 ' non-coding region of target gene mRNAs (3 ' UTR) specifically, thereby stops the synthetic of albumen.Each miRNA can have multiple target genes, and several miRNAs also can regulate same gene.The regulating networks of this complexity both can regulate and control by a miRNA expression of multiple genes, also can carry out by the combination of several miRNAs the expression of certain gene of finely regulating.MiRNAs has very strong conservative property, and between different genera and histoorgan, identical miRNAs has similar regulatory function.In addition, miRNAs has again very strong specificity, and in different histocytes, the express spectra of miRNAs is different.MiRNAs is mainly the expression by transcribing rear suppressor gene, thereby plays important regulating and controlling effect in various physiological processs in vivo.The demonstration of research report, miRNAs participates in growth, maturation, propagation, differentiation and the apoptosis of various kinds of cell in vivo.Expression, the function of miRNA play very important effect in the growth of different physiological systems.The unconventionality expression of miRNA can cause the disorder of body normal physiological function, thereby causes the generation of various diseases.Quantity research shows greatly, and the expression of miRNA and function and mankind's various diseases have close contacting, and comprise tumour, metabolic disease, nervous system disease, infection, chronic inflammatory diseases and autoimmune disease etc.Quantity research is pointed out greatly, and the expression of miR-9 and the generation of tumour development have close relationship.But in different tumor types, the expression amount of miR-9 is not quite similar again.Therefore the detection of miR-9 has great significance for diagnosis and the prognosis of different tumours.
At present, detect miRNA and mainly contain three kinds of methods: first, by Northern engram analysis, be by the common method of hybridization check RNA, but due to its trivial operations, length consuming time, can not carry out a large amount of shaker tests, and detect dynamicrange can only reach two orders of magnitude, specificity is not high, therefore just limit the clinical detection of treasuring sample, be also unfavorable for carrying out a large amount of experimental studies.The second, analyze by microarray, be also a kind of method that detects RNA based on Hybridization principle, adopt highdensity fluorescence labeling probe and the hybridization of RNA sample, by fluorescent scanning, related software analysis is carried out quantitatively miRNA.This method can be carried out high-throughout detection analysis to miRNA, but sample demand is also larger, and can not the very little miRNA of distinguishing sequence difference, also causes false positive.The third method is real-time quantitative PCR, and this method first utilizes a kind of stem Loop primer to carry out reverse transcription, then designs PCR specificity amplification primer, then carries out real-time quantitative PCR.The method specificity, sensitivity are all very high, and sample demand is also few, for detection and the scientific research of clinical samples provide extraordinary technology platform.
Summary of the invention:
The present invention adopts Real-Time Fluorescent Quantitative PCR Technique, by the method for design specificity stem ring-type reverse transcriptase primer and specific PCR amplimer, thereby improved the specificity detecting, for clinical provide a kind of can be in real time, accurately, detect detection method and the test kit of miR-9 expression in human plasma.
The technical solution adopted in the present invention is as follows:
The fluorescent quantitative PCR detection method of miR-9 in a kind of human plasma: first design specific stem ring-type reverse transcriptase primer and specific PCR amplimer, then pass through reverse transcription, real-time fluorescence quantitative PCR program, optimizing reaction system, adopts △ Ct method to calculate the relative expression quantity of miR-9.
Hsa-miR-9 specificity reverse transcriptase primer, sequence is as follows:
5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATACA-3'（SEQ?ID?NO.1）
Hsa-miR-9 fluorescence quantification PCR primer, sequence is as follows:
Forward primer: 5'-GGGTCTTTGGTTATCTAGC-3'(SEQ ID NO.2)
Reverse primer: 5'-TGCGTGTCGTGGAGTC-3'(SEQ ID NO.3)
In detection method of the present invention, described quantitative fluorescent PCR 20 μ l reaction systems are made up of following component: 10 μ l SYBR Mix, and 10 μ M forward primers, the each 1 μ l of reverse primer, 1 μ l sample cDNA, supplements aqua sterilisa as for 20 μ l.
In detection method of the present invention, described PCR response procedures is 95 DEG C of 10min, 95 ° of c15sec, 60 DEG C of 15sec, 72 DEG C of 15sec, 40 circulations of increasing.
The detection kit of the quantitative fluorescent PCR of miR-9 in a kind of human plasma: this test kit contains specificity miR-9 reverse transcriptase primer (as shown in SEQ ID NO.1); Specific miR-9PCR amplimer (as shown in SEQ ID NO.2 and 3); Reverse transcription reagent; PCR reagent.
Further, described reverse transcription reagent contains 5 × reverse transcription damping fluid, the dNTP of 2.5mM, 200U/ μ l MMLV reversed transcriptive enzyme, the water of 40U/ μ l RNA enzyme inhibitors and nuclease free.
Further, described PCR reagent is SYBR Mix.
The present invention utilizes fluorescent quantitative PCR technique to provide a kind of can detect the detection method of miR-9 in human plasma real-time, quickly and accurately, thereby has filled up the blank of this miRNA aspect detection method.
The present invention, owing to having utilized specific reverse transcriptase primer and PCR primer, makes the specificity of quantitative fluorescent PCR obtain guarantee, is a kind of highly sensitive, high specific, detects quickly and accurately the method for miR-9.
Brief description of the drawings
Fig. 1 is the melt curve analysis of quantitative fluorescent PCR sample amplification
In figure, X-coordinate represents melting temperature(Tm)
In figure, ordinate zou represents relative intensity of fluorescence.
Fig. 2 is the fluorescent signal figure of quantitative fluorescent PCR sample amplification
In figure, X-coordinate represents cycle number
In figure, ordinate zou represents relative intensity of fluorescence
The straight line that is parallel to X-coordinate in figure represents cycle threshold.
Embodiment
Further set forth the present invention below in conjunction with specific embodiment, but be to be understood that these embodiment are only not used in restriction the scope of protection of present invention for the present invention is described.
Material:
Blood plasma miRNA is extracted test kit (Macherey-Nagel), NanoDrop1000(Thermo), MMLV reversed transcriptive enzyme (Takara), 5 × reverse transcription damping fluid (Takara), 2.5mM dNTP(Takara), RNA enzyme inhibitors (Takara), SYBR Green Real Time PCR Kit(Thermo), DEPC water, regular-PCR instrument (ABI), CFX-96 quantitative real time PCR Instrument (Biorad).
Embodiment:
The detection of miR-9 in Plasma of The Patients With Lung Cancer
1, the design of primer is with synthetic
The mature sequence (MIMAT0000441) of first searching hsa-miR-9 from http://www.mirbase.org/, then designs three primer sequences, serves marine life Engineering Co., Ltd synthetic.
The mature sequence of hsa-miR-9 is as follows:
UCUUUGGUUAUCUAGCUGUAUGA（SEQ?ID?NO.4）
Hsa-miR-9 specificity reverse transcriptase primer, sequence is as follows:
5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATACA-3'（SEQ?ID?NO.1）
Hsa-miR-9 fluorescence quantification PCR primer, sequence is as follows:
Forward primer: 5'-GGGTCTTTGGTTATCTAGC-3'(SEQ ID NO.2)
Reverse primer: 5'-TGCGTGTCGTGGAGTC-3'(SEQ ID NO.3)
2, the extracting of blood plasma miRNA
Get 300 μ l Plasma of The Patients With Lung Cancers in 1.5ml centrifuge tube, the miRNA(extracting in the step extraction blood plasma described in test kit according to blood plasma miRNA is shown in producer's working instructions), concentration and the purity of measuring RNA by NanoDrop1000, the second best in quality sample carries out next step experiment.
3, hsa-miR-9 specificity reverse transcription
Use the synthetic specific reverse transcriptase primer of miR-9 by the Shanghai biological company limited of raw work, and Takara company the MMLV reversed transcriptive enzyme, the 5 × reverse transcription damping fluid that provide, 2.5mM dNTP, RNA enzyme inhibitors carries out reverse transcription, and 10 μ l reverse transcription systems are as follows:
MiRNA reverse transcription program is as follows:
First RNA is mixed with DEPC water, denaturation on PCR instrument, 70 DEG C of 10min, leave standstill 2min on ice.Again other reagent are added to 42 DEG C of 60min on PCR instrument, 70 DEG C of 10min.
4, miR-9 specificity fluorescent quantitative PCR
20 μ l reaction systems are as follows:
MiR-9 real-time fluorescence quantitative PCR response procedures:
95 DEG C of 10min, 95 ° of c15sec, 60 DEG C of 15sec, 72 DEG C of 15sec, 40 circulations of increasing.
The melt curve analysis figure of sample is referring to Fig. 1, and the fluorescent signal figure of sample is referring to Fig. 2.
In 15 routine Healthy Peoples and 15 routine Plasma of The Patients With Lung Cancers, the relative expression quantity of miR-9 is as follows:
Claims (9)
1. the detection method of the quantitative fluorescent PCR of miR-9 in a human plasma, it is characterized in that first designing specific " stem ring-type " reverse transcriptase primer and specific miR-9 PCR amplimer, then through reverse transcription, quantitative fluorescent PCR program, finally calculate the relative expression quantity of miR-9 according to △ Ct method.
2. the detection method of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 1, is characterized in that, wherein the sequence of specific miR-9 reverse transcriptase primer is as shown in SEQ ID NO.1; Specific miR-9 pcr amplification primer sequence is as shown in SEQ ID NO.2 and 3.
3. the detection method of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 1, it is characterized in that, its 10 μ l reverse transcription system is as follows: 5 × reverse transcription damping fluid, 2 μ l, the specificity reverse transcriptase primer 1 μ l of 62.5nM, the dNTP 0.5 μ l of 2.5mM, the MMLV reversed transcriptive enzyme 0.5 μ l of 200U/ μ l, the RNA enzyme inhibitors 0.2 μ l of 40U/ μ l, 1ug sample rna, supplements DEPC water to 10 μ l.
4. the detection method of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 1, is characterized in that, reverse transcription program is as follows: first RNA is mixed to denaturation on PCR instrument, 70 with DEPC water
oC10min, leaves standstill 2min on ice; Again other reagent are added, on PCR instrument 42
oC60min, 70
oC10min.
5. the detection method of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 1, it is characterized in that, in quantitative fluorescent PCR, 20 μ l PCR reaction systems are made up of following component: 10 μ l SYBR Mix, 10 μ M forward primers, the each 1 μ l of reverse primer, 1 μ l sample cDNA, supplements aqua sterilisa as for 20 μ l.
6. the detection method of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 5, is characterized in that, its PCR response procedures is as follows: 95
oc 10min, 95
oc 15sec, 60
oc 15sec, 72
oc 15 sec, 40 circulations of increasing.
7. a detection kit for the quantitative fluorescent PCR of miR-9 in human plasma, is characterized in that, this test kit contains specificity miR-9 reverse transcriptase primer, as shown in SEQ ID NO.1; Specific miR-9 pcr amplification primer, as shown in SEQ ID NO.2 and 3; Reverse transcription reagent; PCR reagent.
8. the detection kit of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 7, it is characterized in that, described reverse transcription reagent contains 5 × reverse transcription damping fluid, the dNTP of 2.5mM, 200U/ μ l MMLV reversed transcriptive enzyme, the water of 40U/ μ l RNA enzyme inhibitors and nuclease free.
9. the detection kit of the quantitative fluorescent PCR of miR-9 in a kind of human plasma according to claim 7, is characterized in that, described PCR reagent is SYBR Mix.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410101603.0A CN103882129A (en) | 2014-03-19 | 2014-03-19 | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410101603.0A CN103882129A (en) | 2014-03-19 | 2014-03-19 | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103882129A true CN103882129A (en) | 2014-06-25 |
Family
ID=50951246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410101603.0A Pending CN103882129A (en) | 2014-03-19 | 2014-03-19 | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882129A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970694A (en) * | 2023-06-20 | 2023-10-31 | 合肥工业大学 | Application of miR-9 and analogues thereof in preparation of medicines for diagnosing and/or treating cell inflammation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101363057A (en) * | 2008-09-09 | 2009-02-11 | 浙江理工大学 | Detection method of miRNA absolute expression level in biological sample |
| CN102899392A (en) * | 2011-07-28 | 2013-01-30 | 上海生物芯片有限公司 | miRNA set detection method and application used in colorectal cancer diagnosis |
-
2014
- 2014-03-19 CN CN201410101603.0A patent/CN103882129A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101363057A (en) * | 2008-09-09 | 2009-02-11 | 浙江理工大学 | Detection method of miRNA absolute expression level in biological sample |
| CN102899392A (en) * | 2011-07-28 | 2013-01-30 | 上海生物芯片有限公司 | miRNA set detection method and application used in colorectal cancer diagnosis |
Non-Patent Citations (1)
| Title |
|---|
| LUO H.等: "Down-regulated miR-9 and miR-433 in human gastric carcinoma", 《JOURNAL OF EXPERIMENTAL & CLINICAL CANCER RESEARCH》, vol. 28, no. 82, 30 June 2009 (2009-06-30), pages 1 - 9 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970694A (en) * | 2023-06-20 | 2023-10-31 | 合肥工业大学 | Application of miR-9 and analogues thereof in preparation of medicines for diagnosing and/or treating cell inflammation |
| CN116970694B (en) * | 2023-06-20 | 2024-06-14 | 合肥工业大学 | Application of miR-9 and analogues thereof in preparation of medicines for diagnosing and/or treating cell inflammation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Heneghan et al. | MicroRNAs as novel biomarkers for breast cancer | |
| Chen et al. | Serum miR-19a predicts resistance to FOLFOX chemotherapy in advanced colorectal cancer cases | |
| JP5750710B2 (en) | Cancer marker, cancer evaluation method and evaluation reagent using the same | |
| CN102154505B (en) | Method and primers for detecting mi ribonucleic acid (miRNA) and application thereof | |
| CA3077750C (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| El-Sakka et al. | Assessing miRNAs profile expression as a risk stratification biomarker in oral potentially malignant disorders: A systematic review | |
| JP2014509189A5 (en) | ||
| Wang et al. | A common genetic variation in the promoter of miR-107 is associated with gastric adenocarcinoma susceptibility and survival | |
| CN101824464A (en) | Application of miRNA (Micro-Ribonucleic Acid) expression profile in predicting sensibilities of lung cancer patients to radiotherapy | |
| Miao et al. | miR-27a regulates the self renewal of the H446 small cell lung cancer cell line in vitro | |
| US9631241B2 (en) | Complex sets of miRNAs as non-invasive biomarkers for colon cancer | |
| JP2021045131A (en) | Signature of health | |
| Kim et al. | MicroRNAs as biomarkers for dental diseases | |
| Kovacova et al. | Candidate microRNA biomarkers of therapeutic response to sunitinib in metastatic renal cell carcinoma: A validation study in patients with extremely good and poor response | |
| CN105420393A (en) | Primers, probe, and kit for detecting BRCA1 gene expression | |
| CN103882129A (en) | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas | |
| Jing et al. | Expression levels of miR‑205 and miR‑506 in colon cancer tissuesand their relationships with clinicopathological features | |
| Song et al. | Computational analysis of specific MicroRNA biomarkers for noninvasive early cancer detection | |
| CN104152566B (en) | The purposes of miRNA-26a | |
| Lu et al. | Expression profiling of miR-96, miR-584 and miR-422a in colon cancer and their potential involvement in colon cancer pathogenesis | |
| Rostam | Clinical significance of serum mir-21, ca153 and cea in breast cancer | |
| Jiang et al. | Signatures containing miR-133a identified by large scale miRNA profiling in bladder cancer | |
| CN103740847B (en) | Based on hsa-miR-339-5p detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN103740848B (en) | Based on hsa-miR-146 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| Kim et al. | Next Generation Sequencing Analyses of MicroRNA Expression in Peripheral Blood Mononuclear Cells of Three Warmblood Horses Before and After Exercise |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140625 |