CN103880960B - A kind of monoclonal antibody of anti-CD10 molecule and application thereof - Google Patents

Abstract

The present invention relates to one can specific recognition human leukocyte differentiation antigen 10(CD10) the preparation method of monoclonal antibody, object is to provide a kind of application method this antibody being used for kinds of tumors immunology diagnosis.Does is CD10 molecule otherwise known as acute lymphoblastic leukemia cell common antigen (Common? acute? Lymphoblastic? Leukemia? Antigen, CALLA), it is a kind of correlation factor participating in tumour-interstitial and do mutually, does this albumen have neutral endopeptidase (neutral? endopeptidase, or name enkephalinase (enkephalinase NEP)? A) enzymic activity, the antigen preparing this antibody be one section preferred, by escherichia coli expression, there is the recombinant protein of immunogenic activity, the antibody of final acquisition belongs to IgG2a hypotype, the sequence of its variable region of encoding obtains through the mode of gene clone, the Immunohistochemical detection of kinds of tumors tissue is found, this antibody can well differentiate the generation of tumour, may be used for the immunology diagnosis of these tumours.

Description

A kind of monoclonal antibody of anti-CD10 molecule and application thereof

Technical field

The present invention relates to and a kind ofly can identify the mono-clonal molecule of people CD10 protein molecule and the hybridoma cell line of this antibody can be secreted.Specifically, the invention provides a kind of monoclonal antibody of antitumor cell surface antigen CD10 molecule, this heavy chain of antibody and the aminoacid sequence of variable region of light chain and the DNA sequence dna of encoding variable regions are determined, this antibody may be used for by artificial or automatization mode, the expression status of CD10 in cell is detected with immunohistochemical staining (IHC), Enzyme-linked Immunosorbent Assay (ELISA) or immunoblotting (WesternBlot) mode, thus in diagnostic method, belong to field of biological detection for carrying out these tumours.

Background technology

CD10 molecule is a kind of zinc dependency Zinc metalloproteinase (neutralmetalloendopeptidase) being present in cell surface, suppress by EDTA, phosphamide (Phosphoramidon), be also called neutral endopeptidase (EC3.4.24.11) or enkephalinase.This enzyme makes prothetic group with zine ion, can the peptide bond that formed of the alpha-amino group of hydrolyse hydrophobic nitrogen base acid, generation take phenylalanine, α-amino-isovaleric acid or tyrosine as the polypeptide of first residue, the substrate specificity of this enzyme comprises enkephalin, bradykinin, angiotensinⅠ/II, neurotensin, pitocin, Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2 and chenotactic peptide (Met-Leu-Phe tripeptides, Fmlp) etc.CD10 molecule is the antigen molecule of universality and acute lymphoblastic leukemia, therefore can be used as acute leukemia and the conventional diagnosis index of non-Hodgkin lymphoma classification.Research and analyse, CD10 is not only expressed in marrow sexual cell, also expression is had in non-marrow sexual cell, as mammary gland myoepithelical cell (breastmyoepithelialcell), bile canaliculus (bilecanaliculi), in inoblast (fibroblasts), particularly at kidney, the brush border height of gastric epithelial cell is expressed.

Except common and acute leukemia, CD10 is also used to discriminating and the confirmation of other tumours in recent years, as uterus mesenchymoma (Gu Yang, Wang Shuwen, Liu Wen, existing system evaluation CD10 antibody being used for CD10 differential diagnosis endometrial stromal sarcoma at present for subsequent use, modern medical oncology, 2011, 19(11): 2301-2304), rodent cancer (Yang Xichuan, Yan Heng, leaf celebrating a dance squad, clock white jade, Hao Fei, the meaning of CD10 immunohistochemical staining in rodent cancer and trichoepithelioma differential diagnosis, Chongqing Medical, 2009, 38(2): 142-143), colorectal cancer (Huang Wenbin, Zhou Xiaojun, Chen Jieyu, Meng Kui, Shi Qunli, Ma Henghui, Lu Zhenfeng, the expression of CD10 and clinical meaning thereof in Colorectal Carcinoma, clinical in experimental pathology magazine, 2005, 20 (4): 446-448), cancer of the stomach (Huang Wenbin, Zhou Xiaojun, Meng Kui, Chen Jieyu, Zhang Lihua, the expression of stomach organization interstitial cells CD10 and clinical meaning thereof, Diagnosis pathology magazine, 2005,12 (6): 447-449), the expression in primary lung cancer and thyroid carcinoma also has research.Nearest discovery, in soft tissue sarcoma the expression of CD10 also to some extent rise (KemalDeniz, GanimeCoban, TurhanOkten.Anti-CD10 (56C6) expressioninsofttissuesarcomas.Pathology – ResearchandPractice.2012, (208): 281 – 285).The glycoprotein of CD10 molecule to be a part amount be about 100kDa, different antigen is selected to carry out the antibody that immunity may prepare different binding characteristic, even if the antibody that same antigen obtains also can identify glycosylated moieties or the protein portion of antigen, there is the multiple varient caused because of variable sheer or single nucleotide polymorphism in this molecule, finally cause different antibodies different with pattern to the recognition capability expressing cell antigen simultaneously.In view of the importance of CD10 molecule in cancer pathology research, existing different antibody is for the preparation of at different immunological method CD10 molecule.Application number be 201180018729.6 patent of invention " method and test kit for cancer diagnosis " namely describe and a kind of one or more antibody in CD13, CD59, CD10, CD26, CD142, CD143 and MHCI to be used alone or in combination, the method of tumor of prostate diagnosis is carried out with flow cytometry or ELISA mode, the CD10 monoclonal antibody that it uses is numbered MCA1556F, is prepared as immunogen by the white corpuscle purification membrane antigen of fresh preparation.Publication number is that the patent of invention " test kit of detection B-lineage Acute Lymphocyte Leukemia associated immunophenotype and application thereof " of CN103018463A also provides with the method for the Antibody Combination of CD58, CD10, CD34, CD123, CD38, CD19 and CD45 for the somatotype of B-lineage Acute Lymphocyte Leukemia, the CD10 antibody that it uses is numbered HI10a, be particularly suitable for flow cytometry, in diagnosing tumor, use the 56C6 antibody that maximum cell strains is CD10 at present.

Summary of the invention

First object of the present invention is to provide a kind of method preparing CD10 recombinant protein, and this recombinant protein is by the extracellular domain fragment of signal peptide, CD10 molecule and form for the histidine-tagged of purifying.

It is good that second object of the present invention is to provide a species specificity, the preparation method of the CD10 monoclonal antibody that avidity is high, this antibody capable specific combination CD10 recombinant antigen and natural antigen.

3rd object of the present invention is to provide a kind of using method this antibody being used for tumor tissue section's Immunohistochemical detection.

the technique means that technical solution problem adopts

The present invention is to the CD10 molecule of expressing on common and acute lymphoblastic leukemia medium size lymphocyte film, analyze according to the sequence announced, according to the structure on cytolemma, antigenicity, form amino acid whose hydrophilic and hydrophobic and secondary structure, suitable soluble-expression is selected to have again good immunogenic region for recombinant expressed, for promoting the soluble-expression of recombinant protein, improve its expression behavior, and be convenient to purifying, the N end of recombinant protein and C end respectively fusion have the PelB signal peptide of intestinal bacteria polygalacturonase and histidine-tagged, through gene chemical synthesis rear clone enter carry out in expression plasmid carrier pET-pelB recombinant expressed, the soluble part of separation and purification expression product carries out after affinity purification as immunogen, immunity Balb/c mouse.Through cytogamy, recombinant C D10 screening and cloning, obtain the positive hybridoma cell system of efficient secretion monoclonal antibody.

Utilize this hybridoma cell line to carry out ascites preparation with mouse, ProteinA/G post affinitive layer purification ascites, obtain mouse monoclonal antibody.The subclass measuring this monoclonal antibody with elisa technique is IgG2 type monoclonal antibody, and affinity costant is 1.92 × 10 ⁹.The CD10 albumen of this antibody capable specific recognition of immunoblotting analysis (Westernblotting) experiment display restructuring and the tumour cell of expression CD10 molecule.

Particularly, the present invention relates to the following aspects:

A kind of monoclonal antibody, is secreted by mouse hybridoma cell system 60656-7H5.

Described monoclonal antibody, the antigen of its immune mouse to have the nucleotide sequence coded recombinant C D10 antigen protein obtained via Recombinant protein expression of SEQ ID No .1.

Described monoclonal antibody, its heavy chain and chain variable region amino acid sequence are coded by the DNA sequence dna shown in SEQIDNO.2 and SEQIDNO.3.

Described monoclonal antibody, its heavy chain and chain variable region amino acid sequence are respectively the aminoacid sequence shown in SEQIDNO.4 and SEQIDNO.5.

Described monoclonal antibody, it is mouse IgG 2a hypotype monoclonal antibody.

Described monoclonal antibody, the CD10 molecule of the restructuring of its identifiable design and tumor cell surface.

Described monoclonal antibody, it detects the CD10 expression in tumour and normal tissue cell for immunohistochemical method, immunoblotting and enzyme connection adsorption measurement.

Described monoclonal antibody, the application in immunohistochemical methods pathological diagnosis agent.

CD10 positive cell source tumour is precursor B lymphoblastic leukemia, follicular lymphoma, Burkitt lymphoma, angioimmunoblastic T cell lymphoma, endometrial stromal sarcoma, liver cancer, clear cell carcinoma of kidney

Described recombinant C D10 antigen protein, this recombinant protein is by impelling the signal peptide sequence of secreting, expressing, preferably have antigenic CD10 fragment and form for the protein tag of recombinant protein.

Described recombinant C D10 antigen protein, signal peptide sequence is intestinal bacteria polygalacturonase signal peptide sequence, and CD10 fragment comprises the 411st fragment to the 750th amino acids, and the label for purifying is made up of 5 to 7 Histidines.

Described monoclonal antibody is nucleotide sequence coded by shown in SEQIDNo:1, comprising CD10 molecule the 411st fragment to the 750th amino acids sequence at expression in escherichia coli, and through nickel post affinity purification.

The heavy chain of the antibody of acquisition secreted by hybridoma cell strain and variable region of light chain are coded by the DNA sequence dna shown in SEQID2 and SEQID3, further, the aminoacid sequence of heavy chain and variable region of light chain is as shown in SEQID4 and SEQID5, and this antibody is a kind of mouse IgG 2a hypotype monoclonal antibody.

Described monoclonal antibody, independently or with other Antibody Combination can be applied to tumour cell prepared product, the immunoblotting of tumor tissue section or enzyme-linked immune detection method.

advantage of the present invention and beneficial effect

(1) monoclonal antibody that hybridoma (60656-7H5) secretion that the present invention obtains produces, the lymphocyte of recombinant protein c D10 molecule and expression CD10 can be identified, there is the kinds of tumors tissues such as lymphoma, lobular carcinoma of breast, kidney clear cell tumor, breast ductal cancer, primary hepatocarcinoma and the metastatic liver cancer detecting high expression level CD10 albumen.

(2) the present invention obtain hybridoma (60656-7H5) be a kind of IgG2 antibody-like, with CD10 albumen be combined with extremely strong specificity and susceptibility.

(3) detection and the examinations such as the monoclonal antibody that produces of hybridoma (60656-7H5) that the present invention obtains can be applicable to immunohistochemistry (IHC), prepared by immunoblotting analysis (Westernblotting), indirect ELISA, antibody chip, specificity and highly sensitive.With in the contrast experiment of the commercialization 56C5 cell strain generally used at present, amount to more than 800 routine samples and include 342 routine lymphomas, 7 routine lobulars carcinoma of breast, 109 routine kidney clear cell tumors, 98 routine breast ductal cancers, 302 routine primary hepatocarcinoma and 23 routine hepatic metastases cancer samples, the susceptibility of antibody to various diagnosing tumor prepared by cell strain of the present invention is respectively lymphoma 21.1%, lobular carcinoma of breast 28.6%, kidney clear cell tumor 82.6%, breast ductal cancer 22.4%, primary hepatocarcinoma 37.4% and hepatic metastases cancer 26.1%, and the susceptibility of control antibodies is respectively 15.2%, 28.6%, 82.6%, 22.4%, 37.4% and 26.1%.Except the resolving ability of lobular carcinoma of breast, breast ductal cancer and hepatic metastases cancer sample two kinds of antibody is similar, but staining power is higher than contrast.The susceptibility of other three kinds of tumours all exceeds 9%-38% than control antibodies 56C6, and therefore, CD10 monoclonal antibody of the present invention has wider range of application, can significantly improve the accuracy of diagnosis.

Accompanying drawing explanation

fig. 1: the CD10 recombinant antigen protein of purifying

1,2 is the result of expression product 300mM imidazoles wash-out, and Marker is molecular weight protein, and the size of expression product is about 41kDa, uses 12%SDS-PAGE gel.Purified recombinant C D10 albumen is solvable state, partly can protect native conformation, and its purity is about 90%, and concentration is higher than 1.5mg/ml.

the evident characteristics of Fig. 2: 60656-7H5 antibody and practical application effect

1 is molecular weight marker.The 60541S-4 monoclonal antibody of application of purified can detect CD10 recombinant protein specifically in western blot hybridization.

fig. 3: with the result of CD10 monoclonal antibody to immunohistochemistry chip detection kinds of tumors tissue, existing attached be the picture of renal clear cell carcinoma.Carry out staining analysis with 60656-7H5 monoclonal antibody to renal clear cell carcinoma, titre is 1:4000, and a left side is control antibodies 56C6, and right is CD10 antibody of the present invention, and the staining power of this antibody is higher than contrast, and specificity is consistent.

Embodiment

Below in conjunction with chart and the concrete mode implemented, the present invention is further elaborated, to make those skilled in the art can more clearly learn technical scheme of the present invention, not limitation of the present invention.

the preparation of embodiment 1 recombinant C D10 protein fragments

One, gene clone

CD10 mono-clonal is the nucleotide sequence of NM_000902.3 in the protein sequence of P08473.2 and corresponding Genbank according to accession number in Uniprot database, design specific upstream primer CD10-F (5 '-CCTAAGCTTGGCAGTTGTGCAAACTATGTCAATGGGAATATGG-3 ') and downstream primer CD10-R (5 '-CTTGGGATCCCCAAACCCGGCACTTCTTTTCTGG-3 '), from the reverse transcription product lymphocyte, amplification comprises coding the 411st to the 750th amino acid whose gene fragment.Add respectively at gene 5 ' and 3 ' end in the process of PCR hindIII and bamhI restriction enzyme site.PCR primer reclaims after agarose gel electrophoresis is separated, and carries out respectively to the antigen-4 fusion protein gene reclaimed and the plasmid vector pET-pelB for expressing hindIII and bamhI enzyme is cut, and electrophoresis reclaims again, connects with T4DNA ligase enzyme.Connect product conversion competent escherichia coli cell BL21, the clone's inoculation on picking flat board, extracts plasmid DNA, carries out PCR qualification.The clone that PCR shows the antigen-4 fusion protein gene positive carries out sequencing analysis, and sequence right-on clone use.

Two, Protein expression and purification

The bacterium that spends the night cultivated by single bacterium colony in the ratio of 1:100 is forwarded to 100mlLB substratum, and add the kantlex that final concentration is 50 μ g/ml, 37 DEG C of shaking culture are to OD ₆₀₀be 0.6 ~ 0.8.Add the IPTG of 0.1mol/L, 8h is cultivated in 25 DEG C of concussions, ultrasonication after receipts bacterium.This recombinant protein, with histidine-tagged, uses nickel post to carry out the affinity purification of protein.After carrying out wash-out with the imidazole solution of different concns, each component and stream are worn loading respectively and carry out SDS-PAGE separation detection, Fig. 1 merges the expression and purification result having pelB signal peptide and histidine-tagged recombinant C D10 albumen.The purity of recombinant C D10 albumen is more than 90%, and concentration is about 1-1.5mg/mL, can meet the requirement of immune animal and antibody screening and qualification.

the foundation of embodiment 2 hybridoma cell line

One, immunity

By polypeptide Freund's complete adjuvant (Sigma company) emulsification crosslinked in embodiment 1, immune 4-6 age in week female Balb/c mouse (purchased from Beijing Vital River Experimental Animals Technology Co., Ltd.), abdominal part hypodermic every mouse 6 point, dosage be 60 μ g/ only.Once, antigen uses adjuvant (Sigma company) emulsification of Fu Shi non-fully to every 14 days booster immunizations, and dosage is 30 μ g/.Within after 3rd booster immunization 7 days, to detect in mice serum anti-immunogenicly manyly anti-ly to tire with indirect ELISA (wavelength 450nm), the highest mouse of tiring impacts immunity with tail vein injection, and antigen physiological saline mixes, dosage be 50 μ g/ only.

Two, cytogamy

The mouse boosting cell suspension that aseptic preparation immunity is up to standard, with murine myeloma cell sp2/0(ATCC) mix with 5:1 ratio, centrifugal 1500rpm, 5min.After abandoning supernatant, centrifuge tube puts into 37 DEG C of water-baths, slowly adds the PEG1500(Roche company of 1ml in 1 minute), and stir cell.Leave standstill 1min in warm water after, add the IMDM(Sigma company of 10ml serum-free), mixing, centrifugal 1000rpm, 5min.After abandoning supernatant, add 10ml serum (PAA company) careful by cell blow and beat, and add 5ml mixing 10xHAT(Sigma company) thymocyte, mix.Add the semisolid medium that 25ml contains 2.1% Nitrocellulose (Sigma company) more fully to mix, then pour into uniformly in 20 Tissue Culture Dishs.Tissue Culture Dish is put in wet box, puts into 37 DEG C of 5%CO ₂cultivate in incubator.

Three, clone is chosen

Merge latter 7 days clone cell group size medium density, under anatomical lens, round, real, the large cloning cluster of absorption is squeezed into and is ready in 96 well culture plates of substratum in advance, puts into 37 DEG C of 5%CO ₂cultivate in incubator.

Four, ELISA screens positive hybridoma cell

After 3 days, cell concentration accounts for greatly floorage 2/3, gets 100 μ l supernatant immunogens and improvement on synthesis carries out ELISA screening respectively.Positive colony changes liquid completely, adds 200 μ l containing feeder cell and 1%HT(Sigma company) perfect medium.Carry out second time ELISA screening two days later, positive colony proceeds to 24 orifice plates getting out substratum (containing feeder cell and HT) in advance and cultivates.Get 100 μ l supernatants after five days to carry out third time ELISA and screen, positive colony successively proceeds to 6 orifice plates and Tissue Culture Flask enlarged culturing and frozen.

embodiment 3 ascites induces legal system for monoclonal antibody

one, ascites preparation

Logarithmic phase cell washs with serum free medium and has hanged, counting 5 × 10 ⁵, 1ml.The cell abdominal injection suspended uses the mouse of paraffin oil sensitization in advance.Start to collect ascites after 7 days.The ascites of taking out is in 4 DEG C of centrifugal 4000rpm, 10min.Ascites in the middle of careful sucking-off is collected in centrifuge tube, 4 DEG C or-20 DEG C of preservations.

two, the purifying of monoclonal antibody

Use HiTraprProteinAFF(GE company) affinity chromatography by specification antibody purification from ascites.SDS-PAGE glue qualification purity, Bradford method measures concentration.The antibody of purifying is stored in-20 DEG C.

embodiment 4 monoclonal antibody CHARACTERISTICS IDENTIFICATION

one, subgroup identification

With 100mMPBS(pH7.4) by sheep anti-mouse igg (Beijing Bioisystech Co., Ltd of Zhong Shan Golden Bridge), to 0.5 μ g/ml, every hole adds 100 μ l to dilution bag, 4 DEG C, spends the night.Be emptied liquid, with containing the PBS(PBS-T of 0.05%Tween) wash 3 times, every hole adds 200 μ l confining liquids (PBS containing 2%BSA and 3% sucrose), hatches 1h for 37 DEG C.Be emptied liquid, clean 3 times with PBS-T.Every hole adds 0.1ml hybridoma supematant, hatches 1h for 37 DEG C.Be emptied liquid PBS-T and clean 3 times.Sheep anti mouse (κ, the λ) antibody of HRP mark or sheep anti mouse (IgM, the IgG1 of 1:2000 dilution HRP mark is diluted with confining liquid 1:1000, IgG2a, IgG2b, IgG3, IgA) antibody (SouthernBiotech company) the every hole of 0.1ml adds in suitable hole respectively, hatches 1h for 37 DEG C.Be emptied liquid, clean 3 times with PBS-T.Every hole adds 50 μ l containing 0.15%ABTS(SouthernBiotech company) and 0.03%H ₂o ₂citrate buffer solution (PH4.0) carry out color reaction, measure the OD value under 405nm wavelength in 10-20min.Result shows, and monoclonal antibody of the present invention is IgG1 type mouse resource monoclonal antibody.

two, affinity costant measures

CD10 albumen, wrapping by concentration is 2 μ g/ml, 100 μ l/ holes, and 4 DEG C of bags are spent the night, and PBS-T washes 3 times.Every hole adds 200 μ l confining liquids 37 DEG C of closed 2h, PBS-T and washes 3 times.The monoclonal antibody of purifying in embodiment 4,2 times of gradient dilutions from 1:200, last 1 hole blanks contrast, and hatch 1h for 37 DEG C, PBS-T washes 3 times.The anti-1:20000 dilution of sheep anti mouse two of HRP mark, every hole 100 μ l, hatch 1h for 37 DEG C, PBS-T washes 3 times.Every hole adds 100 μ l containing 0.1%TMB(Sigma company) and 0.03%H ₂o ₂citrate phosphate buffer colour developing 10min, add 50 μ l0.5M sulphuric acid soln termination reactions.The light absorption value of wavelength 450nm is measured by microplate reader.Draw the curve of the corresponding antibody dilution multiple of OD value, find out >=extension rate A corresponding to 1/2 " platform OD value ".Utilizing following formulae discovery to go out affinity costant is 1.92 × 10 ⁹.

Affinity costant

three, monoclonal antibody atopic and effect

Select the CD10 albumen of restructuring, detect the identification specificity of monoclonal antibody of the present invention by the method for immunoblotting, immunoblot experiment process is as follows: often kind of albumen loading is about 5-10ng, carries out 12% polyacrylamide gel electrophoresis.In Bio-Rad electrotransfer system, gel protein band is transferred to (Millipore company) on pvdf membrane according to a conventional method.The TBS-T confining liquid 4 DEG C be placed in by film containing 5% skim-milk spends the night.Add monoclonal antibody 60541S-4(1:1000 dilution) 4 DEG C of overnight incubation.After washing film with TBS-T, add the sheep anti mouse two anti-(Beijing Bioisystech Co., Ltd of Zhong Shan Golden Bridge) of 1:5000 dilution, incubated at room 1 hour.TBST washes film again, adds the super quick nitrite ion of ECL (Beijing Puli's lema gene Technology Co., Ltd.), carries out the collection of chemiluminescence image data with ChemiDocMP multicolor fluorescence imaging system (Bio-Rad).

the variable region sequences of embodiment 4 antibody measures

Cultivating fresh hybridoma, get supernatant and carry out antigenic binding property checking, confirming that the cell strain for cloning can secrete the antibody of needs really, after having confirmed, collected by centrifugation 10 ⁶above hybridoma.Trizol method extracts hybridoma total serum IgE, gets 9 μ L total serum IgE, adds 2.5 μ Loligo (dT) 12 – 18primer (10mM), and 5 μ LdNTPs, mix, 70 DEG C insulation 5 minutes rearmounted 5 minutes on ice, or according to use reversed transcriptive enzyme carry out sex change operation.Add 5 μ LRTbuffer (5X) subsequently, 2.5 μ LDTT (0.1M) and 1 μ L reversed transcriptive enzyme, 42 DEG C are reacted 1 hour.Hatch 15 minutes with termination reaction for 70 DEG C, the cDNA of acquisition is kept at-20 DEG C.The the first chain cDNA obtained is carried out pcr amplification, in 50 μ L reaction systems, adds each 25pmol of primer, the sequence of primer doubly puts forth energy the design of mouse monoclonal antibody primer sequence and synthesis in " recombinant antibodies " (Science Press publishes for 2005) book of editing according to Shen.All the other dNTPs and damping fluid all conveniently add, and finally add cDNA template and add 1 μ L and 1U warm start Taq DNA polymerase.Pcr amplification program is set, be generally 94 DEG C 40 seconds, 52 DEG C 40 seconds, 72 DEG C 40 seconds, carry out 20 to 25 and respectively circulate, last 72 DEG C extend 3 minutes, product can be placed in 4 DEG C of electrophoresis for subsequent use or direct.Get 20 μ LPCR products and carry out electrophoretic analysis, 1.5% sepharose is separated, and the length of light chain (κ light chain) is between 320-340, and the length of heavy chain is between 340-370, have during this region specific product and cut glue recovery, be cloned into carrier T or expression vector order-checking.

the dyeing of embodiment 5. organization chip and qualification

one. chip fabrication process

To each sample advanced row HE section statining, to determine tumor locus.Tumour target site is drawn a circle, preparation punching.When making blank acceptor wax block, plastic processing frame is placed on mould, pours the paraffin (fusing point is at 56 ~ 58 DEG C) melted into mould, mould is put into-20 DEG C of refrigerator 6min after being cooled to room temperature, wax stone is taken out from mould.Tissue sample machine is selected the sample pin of 1mm diameter punch on acceptor wax block, hole depth 3 ~ 4mm, organize core, its length about 0.1mm more shallow than the hole depth of acceptor wax block with the perforating needle of another diameter 1mm in the punching collection of the mark position of wax stone.Organize core directly to insert by what collect or insert in the emptying aperture of acceptor wax block with the careful gripping of tweezers.So repeatedly until complete the preparation of whole sample spot.Finally with slide glass by a organized way core by flat, make organization chip wax stone flat-satin.The organization chip wax stone made is put into wax stone again and make mould, put into 60 DEG C of baking box 15min, make to organize the wax of core and cured piece of acceptor to combine together, then from baking box, mould is taken out gently, the paraffin partly melting state is allowed to cool about 30min at ambient temperature, taken out from mould by organization chip wax stone after putting into-20 DEG C of refrigerator freezing 6min again, cutting into slices or putting into 4 DEG C of refrigerators saves backup.Serial section is carried out after repairing sheet, thickness is decided to be 4 μm, serial section is floated in cold water, it is allowed naturally to launch, again the section separated is transferred in the warm water of 45 DEG C and open up sheet 30 seconds, cut into slices with the slide glass mount through the process of 2%APES acetone solution, the organization chip made is put into the roasting sheet of 60 DEG C of baking boxs 2 hours, taking-up room temperature cools, and puts into-4 DEG C of Refrigerator stores.

two .IHC dyeing and analyses

Conventional dimethylbenzene dewaxes 3 times, each 6 minutes, aquation in 100%, 100%, 95%, 85% graded ethanol, each 3 minutes, last tap water.Carry out antigen retrieval, then wet box is put in section, PBS rinses 3 × 3 minutes.Drip 3%H ₂o ₂hatch 10 minutes, PBS rinses 3 × 3 minutes.Get rid of PBS, drip confining liquid (the BSA solution of 1%) incubated at room 10 minutes.Dry section, primary antibodie (diluting the Dilution ratio carrying out designerantibodies according to the antibody concentration first) room temperature (25 DEG C) dripping suitable proportion dilution hatches 1 hour, PBS rinses 3 × 3 minutes, drip two anti-incubated at room 20-30 minute, PBS rinses 3 × 3 minutes, get rid of PBS, with the DAB nitrite ion colour developing 3-10 minute of fresh configuration.Hematorylin redyes 25 seconds, and PBS returns blue 30 seconds.According to 85%(3 minute)-95%(3 minute)-100%(3 minute)-100%(3 minute) alcohol gradient dewater successively, transparent 3 minutes of last dimethylbenzene, neutral gum mounting.

three. data statistics

According to the coloring case of each antibody at sample point, add up the tinctorial yield (painted sample number/total sample number) of each index, see the following form.

SEQUENCELISTING

<110> Fuzhou Maixin biotechnology Development Co., Ltd

<120> mono-kind secretes monoclonal antibody and the application thereof of anti-CD10 molecule

<130>7

<160>7

<170>PatentInversion3.3

<210>1

<211>1032

<212>DNA

<213> nucleotide sequence

<400>1

ggcagttgtgcaaactatgtcaatgggaatatggaaaatgctgtggggaggctttatgtg60

gaagcagcatttgctggagagagtaaacatgtggtcgaggatttgattgcacagatccga120

gaagtttttattcagactttagatgacctcacttggatggatgccgagacaaaaaagaga180

gctgaagaaaaggccttagcaattaaagaaaggatcggctatcctgatgacattgtttca240

aatgataacaaactgaataatgagtacctcgagttgaactacaaagaagatgaatacttc300

gagaacataattcaaaatttgaaattcagccaaagtaaacaactgaagaagctccgagaa360

aaggtggacaaagatgagtggataagtggagcagctgtagtcaatgcattttactcttca420

ggaagaaatcagatagtcttcccagccggcattctgcagccccccttctttagtgcccag480

cagtccaactcattgaactatgggggcatcggcatggtcataggacacgaaatcacccat540

ggcttcgatgacaatggcagaaactttaacaaagatggagacctcgttgactggtggact600

caacagtctgcaagtaactttaaggagcaatcccagtgcatggtgtatcagtatggaaac660

ttttcctgggacctggcaggtggacagcaccttaatggaattaatacactgggagaaaac720

attgctgataatggaggtcttggtcaagcatacagagcctatcagaattatattaaaaag780

aatggcgaagaaaaattacttcctggacttgacctaaatcacaaacaactatttttcttg840

aactttgcacaggtgtggtgtggaacctataggccagagtatgcggttaactccattaaa900

acagatgtgcacagtccaggcaatttcaggattattgggactttgcagaactctgcagag960

ttttcagaagcctttcactgccgcaagaattcatacatgaatccagaaaagaagtgccgg1020

gtttggggatcc1032

<210>2

<211>380

<212>DNA

<213>DNA sequence

<400>2

caggtgcagctgcaggagtctggggctgaactggtgaagcctgggacttcagtgaagttg60

tcctgcaaggcttctagaaaattcaccggttactatttgtattgggtgaagcagaggcct120

ggacaaggccctgagtggattggagagattgtcaataaaagcaatagaggtactaacctc180

aatgagaagttcaagagcaaggccacactgactgtagacaaatcctccagtacagcatac240

atgcaactcaacagcctgacatctgaggactctgcggtctattactgtacaagactgggc300

ttctggggcagacaaggcaaaaccgtgcctctctcctctgccaaaacgacacccaagctt360

gtctatccactggcccctgg380

<210>3

<211>383

<212>DNA

<213>DNA sequence

<400>3

ggtgatatcttgctgacccaatctccactctccctgactgtgacagcaggagagaaggtc60

actatgagctgcaagtccagtagtgtcataaatagtactaatcaatcaaattacttgacc120

tggtaccagcagaaaccagggcagcctcctaaaatgttgatctactgggcaaggcgatcc180

actagggaatccggggtccctgatcgcttcacaggcagtggatctggaacagatttcact240

ctcaccatcagcagtgtgcaggctgaagacctggcagtttattactgtcctaatgataaa300

ggaagtggccctctcacgttcggtgctgggaccaagctggagctgaaacgggctgatgct360

gcaccaactggatccatcttccc383

<210>4

<211>126

<212>PRT

<213> aminoacid sequence

<400>4

GlnValGlnLeuGlnGluSerGlyAlaGluLeuValLysProGlyThr

151015

SerValLysLeuSerCysLysAlaSerArgLysPheThrGlyTyrTyr

202530

LeuTyrTrpValLysGlnArgProGlyGlnGlyProGluTrpIleGly

354045

GluIleValAsnLysSerAsnArgGlyThrAsnLeuAsnGluLysPhe

505560

LysSerLysAlaThrLeuThrValAspLysSerSerSerThrAlaTyr

65707580

MetGlnLeuAsnSerLeuThrSerGluAspSerAlaValTyrTyrCys

859095

ThrArgLeuGlyPheTrpGlyArgGlnGlyLysThrValProLeuSer

100105110

SerAlaLysThrThrProLysLeuValTyrProLeuAlaPro

115120125

<210>5

<211>127

<212>PRT

<213> aminoacid sequence

<400>5

GlyAspIleLeuLeuThrGlnSerProLeuSerLeuThrValThrAla

151015

GlyGluLysValThrMetSerCysLysSerSerSerValIleAsnSer

202530

ThrAsnGlnSerAsnTyrLeuThrTrpTyrGlnGlnLysProGlyGln

354045

ProProLysMetLeuIleTyrTrpAlaArgArgSerThrArgGluSer

505560

GlyValProAspArgPheThrGlySerGlySerGlyThrAspPheThr

65707580

LeuThrIleSerSerValGlnAlaGluAspLeuAlaValTyrTyrCys

859095

ProAsnAspLysGlySerGlyProLeuThrPheGlyAlaGlyThrLys

100105110

LeuGluLeuLysArgAlaAspAlaAlaProThrGlySerIlePhe

115120125

<210>6

<211>43

<212>DNA

<213> artificial sequence

<400>6

cctaagcttggcagttgtgcaaactatgtcaatgggaatatgg43

<210>7

<211>34

<212>DNA

<213> artificial sequence

<400>7

cttgggatccccaaacccggcacttcttttctgg34

Claims (7)

1. a monoclonal antibody, is characterized in that the antigen of its immune mouse to have the nucleotide sequence coded recombinant C D10 antigen protein obtained via Recombinant protein expression of SEQ ID No .1; Its heavy chain and chain variable region amino acid sequence are coded by the DNA sequence dna shown in SEQIDNO.2 and SEQIDNO.3.

2. monoclonal antibody according to claim 1, is characterized in that its heavy chain and chain variable region amino acid sequence are respectively the aminoacid sequence shown in SEQIDNO.4 and SEQIDNO.5.

3. monoclonal antibody according to claim 1, is characterized in that it is mouse IgG 2a hypotype monoclonal antibody.

4. monoclonal antibody according to claim 1, is characterized in that its CD10 molecule identifying restructuring and tumor cell surface.

5. monoclonal antibody according to claim 1, is characterized in that it detects the CD10 expression in tumour and normal tissue cell for immunohistochemical method, immunoblotting and enzyme connection adsorption measurement.

6. monoclonal antibody according to claim 1, is characterized in that, the application in immunohistochemical methods pathological diagnosis agent.

7. according to recombinant antigen according to claim 1, it is characterized in that, this recombinant protein is by impelling the signal peptide sequence of secreting, expressing, have antigenic CD10 fragment and form for the protein tag of recombinant protein; Signal peptide sequence is intestinal bacteria polygalacturonase signal peptide sequence, and CD10 fragment is the 411st fragment to the 750th amino acids, and the label for purifying is made up of 5 to 7 Histidines.