CN103834742B - Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method - Google Patents
Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method Download PDFInfo
- Publication number
- CN103834742B CN103834742B CN201410103717.9A CN201410103717A CN103834742B CN 103834742 B CN103834742 B CN 103834742B CN 201410103717 A CN201410103717 A CN 201410103717A CN 103834742 B CN103834742 B CN 103834742B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- red sandalwood
- gene chip
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and detect hedgehog red sandalwood (Pterocarpus? erinaceus? Poir.) application specific probe, primer, gene chip and method.Does is this application specific probe that nucleotide sequence is as SEQ in sequence table? ID? DNA fragmentation shown in NO.12, or is nucleotide sequence as SEQ in sequence table? ID? the DNA fragmentation of the reverse complementary sequence of sequence shown in NO.12.Can be differentiated common rosewood hedgehog red sandalwood at short notice by this gene chip, achieve in the level of " kind " the qualification that redwood carries out, improve accuracy and the resolving power of redwood qualification.
Description
Technical field
The invention belongs to biological technical field, particularly detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method.
Background technology
Redwood is the general designation of the high-quality hardwood that a class appearance takes on a red color, and fecund, in tropical and subtropical zone area, is always just subject to the favor of the people all over the world.Especially in the Ming and Qing Dynasties of China, the mahogany furniture made through traditional technology creates the model of Chinese classic furniture especially.According to the standard GB/T 18107-2000 " redwood " of China, " redwood " scope is defined as 5 genus 8 classes, 33 principal items.At present, redwood is divided into eight classes according to indexs such as heartwood color, smell, the tangential diameter of pore, air-dry density, rays by traditional authentication method, and qualification result is only differentiated " class ", and the aspect being difficult to be deep into again " kind " is identified.
Gene chip is that the one of DNA recognition technology embodies, utilize the high-throughout advantage of chip, can detect multiple DNA bar code of multiple redwood on a chip simultaneously, not only drastically increase the accuracy of qualification, but also the small DNA difference can distinguished between redwood kind and kind, namely gene chip can carry out precise Identification to different redwood in the level of " kind ".
Summary of the invention
The technical problem to be solved in the present invention is, for the defect of different redwood being carried out to precise Identification at present in the level of " kind ", there is provided a kind of application specific probe, primer, gene chip and the method that detect hedgehog red sandalwood, the method can carry out precise Identification to hedgehog red sandalwood in the level of " kind ".
The technical scheme that the present invention solves the problems of the technologies described above is as follows:
One of technical scheme of the present invention is: the application specific probe detecting hedgehog red sandalwood (PterocarpuserinaceusPoir.), it is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.12, or the DNA fragmentation of nucleotide sequence reverse complementary sequence of sequence as shown in SEQ ID NO.12.
The target sequence of above-mentioned probe in detecting hedgehog red sandalwood is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.9, or the DNA fragmentation of nucleotide sequence reverse complementary sequence of sequence as shown in SEQ ID NO.9.
Two of technical scheme of the present invention is: the gene chip detecting hedgehog red sandalwood, it contains described application specific probe.Gene chip of the present invention is as conventional in this area, and the detection probes on it is then application specific probe as above.
Three of technical scheme of the present invention is: the device detecting hedgehog red sandalwood, it comprises described application specific probe or described DNA chip.Device of the present invention is as conventional in this area, wherein, preferably, described device also comprises primer pair, in described primer pair, the nucleotide sequence of a primer is as the SEQIDNO.10 in sequence table, and the nucleotide sequence of another primer is as shown in the SEQIDNO.11 in sequence table.Wherein, preferably, containing fluorescent mark on described primer.
Four of technical scheme of the present invention is: the primer detecting hedgehog red sandalwood, it is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.10 or SEQIDNO.11.Wherein, preferably, containing fluorescent mark on described primer.
Five of technical scheme of the present invention is: a kind of method detecting hedgehog red sandalwood, comprises the following steps:
(1) STb gene of sample to be tested is prepared, as template, pcr amplification is carried out with the primer pair containing certification mark, obtain PCR primer, in described primer pair, article one, the nucleotide sequence of primer is as the SEQIDNO.10 in sequence table, and the nucleotide sequence of another primer is as shown in the SEQIDNO.11 in sequence table;
(2) application specific probe is incorporated on the sheet base of gene chip, wash away unconjugated probe, obtain the gene chip detecting hedgehog red sandalwood, described application specific probe is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.12, or the DNA fragmentation of nucleotide sequence reverse complementary sequence of sequence as shown in SEQ ID NO.12;
(3) in the gene chip of the detection hedgehog red sandalwood of step (2) gained, add the PCR primer of step (1) gained, hybridize, wash away the PCR primer of not hybridizing;
(4) gene chip after the hybridization of detecting step (3) gained.
Wherein, the method preparing the STb gene of sample to be tested described in step (1) is conventional.The amplification method of described PCR is also conventional, and preferably pcr amplification program is as follows: 95 DEG C of preheating 5min; 35 circulations: 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s; Last 72 DEG C extend 5min.
Wherein, the method be incorporated on the sheet base of gene chip by application specific probe described in step (2) is conventional.The sheet base of gene chip is conventional, and preferably, described sheet base is aldehyde radical sheet base, and described probe is amination probe.Preferably, rosewood house-keeping gene detection probes is added in the other well of the gene chip described in step (2), described rosewood house-keeping gene detection probes is conventional, preferably the nucleotide fragments of sequence sequence as shown in SEQ ID NO.16.Preferably, other reagent can also be added in the other well of the gene chip described in step (2), as various contrast reagent, detect the detection probes etc. of other kind of rosewood.
Wherein, the hybridization described in step (3) is conventional.
Wherein, the detection method described in step (4) is conventional, and preferred laser confocal scanner detects gene chip, obtains results of hybridization.Preferably, the results of hybridization detecting gained according to step (4) is passed judgment on as follows: results of hybridization is positive, then described sample to be tested is hedgehog red sandalwood; Results of hybridization is not positive, then described sample to be tested is not hedgehog red sandalwood.
On the basis meeting this area general knowledge, above-mentioned each optimum condition, can arbitrary combination, obtains the preferred embodiments of the invention.
Agents useful for same of the present invention and raw material are all commercially.
Positive progressive effect of the present invention is:
The invention provides application specific probe, primer, gene chip and the method for differentiating hedgehog red sandalwood.DNA qualification is carried out to hedgehog red sandalwood this kind of rosewood, the level of " kind " detects this rosewood and identifies, for traditional wood identification provides a kind of new technology and thinking.
Feature of the present invention comprises:
(1) high-throughput: simultaneously can identify multiple hedgehog red sandalwood sample; If be placed on same chip by the detection probes of multiple rosewood, multiple rosewood kind can be identified simultaneously;
(2) accuracy: based on the detection of DNA difference, result is more reliable;
(3) ageing: compared to 15 days consuming time of traditional redwood qualification, the present invention only needed within 8 hours, to complete the qualification to redwood kind.
(4) reliability: containing internal reference point, carries out Quality Control to the accuracy of detection operation.
Accompanying drawing explanation
Fig. 1 is the detected result figure of Andaman padauk.In figure, Pd is the detection site of Andaman padauk; Pi is the detection site of India red sandalwood; The detection site that Pe is; QC is the detection site of house-keeping gene, is also the Quality Control site of chip.
Fig. 2 is the detected result figure of India red sandalwood.In figure, Pd is the detection site of Andaman padauk; Pi is the detection site of India red sandalwood; The detection site that Pe is; QC is the detection site of house-keeping gene; Also be the Quality Control site of chip.
The detected result figure that Fig. 3 is.In figure, Pd is the detection site of Andaman padauk; Pi is the detection site of India red sandalwood; The detection site that Pe is; QC is the detection site of house-keeping gene, is also the Quality Control site of chip.
Fig. 4 control group gets over the detected result of card red sandalwood.In figure, Pc is the detection site of more card red sandalwood; Dc is the detection site of knife-like rosewood; Df is the detection site of fine hair yellow wingceltis; QC is the detection site of house-keeping gene, is also the Quality Control site of chip.
The detected result of Fig. 5 control group knife-like rosewood.In figure, Pc is the detection site of more card red sandalwood; Dc is the detection site of knife-like rosewood; Df is the detection site of fine hair yellow wingceltis; QC is the detection site of house-keeping gene, is also the Quality Control site of chip.
The detected result of Fig. 6 control group cutter fine hair yellow wingceltis.In figure, Pc is the detection site of more card red sandalwood; Dc is the detection site of knife-like rosewood; Df is the detection site of fine hair yellow wingceltis; QC is the detection site of house-keeping gene, is also the Quality Control site of chip.
Embodiment
Mode below by embodiment further illustrates the present invention, but does not therefore limit the present invention among described scope of embodiments.The experimental technique of unreceipted actual conditions in the following example, conventionally and condition, or selects according to catalogue.
The determination of embodiment 1 target sequence
According to the Andaman padauk (PteroearpusdalbergioidesBenth.) of report, India red sandalwood (PterocarpusindicusWiild.), hedgehog red sandalwood (PterocarpuserinaceusPoir.) gene order, select one section of specificity is better, fragment length is applicable to gene order as the target sequence of detection.Selected target sequence, after sequence analysis retrieval, is defined as the DNA sequence dna that one section of specificity is higher at present.
The specific detection target sequence of 3 kinds of rosewoods is respectively:
Andaman padauk:
5’AGTTTATTTTGAAATAATTCATTTTTTTTTCCTTACAATACAAAGAGAAATNTATGTTTGGCAAAATTTTGAAAAAGGGGGTAAAATNTTCAATGTNTTTCTTTAGATNTTAAAAAGGTAAAAAAAAAGATAAAAAAAGGGGGGGGTAAGATATATGGGTAATTAATCAAAGAAGAATTAGTTTTCCTTTTGAGAACCGAAGGAAGGTTTTTCCCCTGACCCGGAGCAATG—3’（SEQIDNO.1）；
India red sandalwood:
5’GAAAGGAAAAGGCTATACATATATATATATGTATATATACGTATTTGTACTGAAATACTATTTCAATTGAGTAATGAAGACTCCAAATCTCTATTTGTGACTCTTTATATCACAAATGACAAATGAAAAATGTGAATCAAATCAATCCAAGTTGA—3’（SEQIDNO.5）；
Hedgehog red sandalwood:
5’CAATCCCGGCGCCTCCGGGCACCGGGCGGGGCGGATGCTGGCCTCCCGCGAGCGAGCGCCTCTCGGTTGGCCGAAAATCGGGTTCGTGGCGGAGGGCAGCGCCACGACAGGTGGCGGTTGAGCGCAATCTCGAGGCCGGCCGTGCGCGCGCCCCCTCCGTCGTTGCGGACCCTAAGACCCGCGGGCGGCACCGATCCGCCGCCCATGACGCGACCTC—3’（SEQIDNO.9）。
The design of embodiment 2 primer and probe and synthesis
After target sequence is determined, according to primer and probe design principle, design primer and probe as follows:
Andaman padauk:
Primer 1:5 ' Hex-AGTTTATTTTGAAATAATTCA-3 ' (SEQIDNO.2);
Primer 2: 5 '-CATTGCTCCGGGTCAGGGGAAAAAC-3 ' (SEQIDNO.3);
Detection probes:
5’NH
3—TTTTTTTTTTTCAAAAGGAAAACTAATTCTTCTTTGATT—3’（SEQIDNO.4）。
Designed primer and probe are carried out sequence analysis on NCBI, and result display primer is only similar to the Andaman padauk sequence 100% of report with probe sequence.In addition, though comparison result display sequence and other seeds have certain similar, but effectively cannot be combined with other seeds sequences, thus can only increase and detect Andaman padauk.
India red sandalwood:
Primer 1:5 ' Hex-GAAAGGAAAAGGCTATACAT-3 ' (SEQIDNO.6);
Primer 2: 5 '-TCAACTTGGATTGATTTGATTC-3 ' (SEQIDNO.7);
Detection probes:
5’NH
3—TTTTTTTTTTGATATAAAGAGTCACAAATAGAGATT—3’（SEQIDNO.8）。
Designed primer and probe are carried out sequence analysis on NCBI, and result display primer is only similar to India's red sandalwood sequence 100% of report with probe sequence.In addition, though comparison result display sequence and other seeds have certain similar, but effectively cannot be combined with other seeds sequences, thus can only increase and detect India red sandalwood.
Hedgehog red sandalwood:
Primer 1:5 ' Hex-CAATCCCGGCGCCTCCGGGCACC-3 ' (SEQIDNO.10);
Primer 2: 5 '-GAGGTCGCGTCATGGGCGGCGG-3 ' (SEQIDNO.11);
Detection probes:
5’NH
3—TTTTTTTTTTTTGAGATTGCGCTCAACCGCCACCTGTCG—3’（SEQIDNO.12）。
Designed primer and probe are carried out sequence analysis on NCBI, and result display primer is only similar to the hedgehog red sandalwood sequence 100% of report with probe sequence.In addition, though comparison result display sequence and other seeds have certain similar, but effectively cannot be combined with other seeds sequences, thus can only increase and detect hedgehog red sandalwood.
Further, by homology comparison, the Chloroplast gene of 3 kinds of rosewoods have found the gene order of one section of high conservative, and it can be used as the chip of house-keeping gene to preparation to carry out Quality Control.Sequence is as follows:
5’AATAATTTTTCGTCTACCTTATCCTTCTTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTATCCG—3’（SEQIDNO.13）
For house-keeping gene sequence, design pcr amplification primer and decorating site as follows:
Quality Control primer 1:5 ' Hex-AATAATTTTTCGTCTACCTTATC-3 ' (SEQIDNO.14);
Quality Control primer 2: 5 '-CGGATAATAATTGGTTTATATG-3 ' (SEQIDNO.15).
For house-keeping gene sequence, sequence and the decorating site thereof of design detection probes are as follows:
5’NH
3—TTTTTTTTTGATAGTATTTCCATTTATTCATCAAAAGAGGCGC—3’（SEQIDNO.16）。
Above primer and detection probes are served marine life Engineering Co., Ltd and carries out synthetic.5 ' end band HEX fluorescent mark of primer, for subsequent use.5 ' end band amino group of probe, namely the amination of probe, for subsequent use.
Embodiment 3 template extraction
Test kit SPPlantDNAMaxiKit(purchased from American OmegaBio-Tek company is extracted by the Plant Genome of OMEGA), take the heartwood extracting section STb gene of Andaman padauk, India red sandalwood, hedgehog red sandalwood three kinds of timber.Extracting method and step refer to specification sheets.Finally DNA is dissolved in the water, is prepared into the solution that concentration is 10ng/ μ l.
Embodiment 4PCR amplification and fluorescent mark
Carry out pcr amplification (adopting the PCRAmplificationKit of Japanese TaKaRa company) by the template that fluorescently-labeled primer pair extracts, PCR amplification system is as follows:
| Composition | Concentration | Consumption |
| Primer (HEX mark 5 ' end) | 10pM | 0.2μl |
| 10×PCR buffer | 2.5μl | |
| Template DNA | 10ng/μl | 3μl |
| Archaeal dna polymerase | 5U/μl | 0.5μl |
| dNTP | 10mM | 2μl |
| ddH 2O | Be supplemented to 25 μ l |
PCR program is as follows: 95 DEG C of preheating 5min; 35 circulations: 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s; Last 72 DEG C extend 5min.
Prepared by embodiment 5 chip
Be 500nl by amidized probe by final concentration 20pmoL/L(point sample volume) put respectively on aldehyde radical sheet base (purchased from Ling Cheng bio tech ltd, Shanghai), left at room temperature over night, successively with elutriant I(5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS) each wash-out 5min, to the probe fixed do not had to wash away, then centrifuge dripping be for subsequent use.
Embodiment 6 molecular hybridization
On the chip prepared in embodiment 5 by the PCR primer of embodiment 4 point, at 42 DEG C, keep 40min, with elutriant I(5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS) each wash-out 5min.The Loaded samples of each chip sees the following form:
Embodiment 7 results of hybridization detects
Detect the results of hybridization of above-mentioned 3 chips with laser confocal scanner, result is see Fig. 1-3.As seen from the figure, the Quality Control point in three result figure all shows normally, illustrates that whole detection operating process is reliable, and the detection probes of three kinds of redwood is hybridized all respectively and gone up target sequence, and chip specificity is better.
Embodiment 8 simultaneous test
For reliability and the resolving power of further proofing chip, choose three kinds of other redwood and get over card red sandalwood (PterocarpuscambodianusPierre), knife-like rosewood (DalbergiacultrataGrah) and fine hair yellow wingceltis (Dalbergiafrulescens) and carry out control test.Step is as follows:
1) template extraction: extract the STb gene that test kit extracts more card red sandalwood, knife-like rosewood and fine hair yellow wingceltis three kinds of timber respectively by the Plant Genome of OMEGA.Extracting method and step are with embodiment 3.
2) pcr amplification: according to the PCR amplification system in embodiment 4 and condition, increases to the template DNA that step 1) obtains.
3) molecular hybridization: by step 2) PCR primer and embodiment 5 in the chip prepared carry out in situ hybridization, hybridization conditions is consistent with embodiment 6.
4) interpretation of result: detect results of hybridization with laser confocal scanner, the results are shown in Figure 4-6, the chip of display prepared by the present invention cannot detect more card red sandalwood, knife-like rosewood and fine hair yellow wingceltis three kinds of redwood, controlled trial illustrates that the target sequence of detection can distinguish with other seeds by this chip, demonstrates accuracy and the resolution of chip of the present invention.
In the present invention, each sequence is respectively:
Andaman padauk: target sequence: SEQIDNO.1; Primer 1:SEQIDNO.2; Primer 2: SEQIDNO.3; Detection probes: SEQIDNO.4.
India red sandalwood: target sequence: SEQIDNO.5; Primer 1:SEQIDNO.6; Primer 2: SEQIDNO.7; Detection probes: SEQIDNO.8.
Hedgehog red sandalwood: target sequence: SEQIDNO.9; Primer 1:SEQIDNO.10; Primer 2: SEQIDNO.11; Detection probes: SEQIDNO.12.
Quality Control gene order: SEQIDNO.13; Quality Control primer 1:SEQIDNO.14; Quality Control primer 2: SEQIDNO.15; Quality Control detection probes: SEQIDNO.16.
Should be understood that those skilled in the art can make various changes or modifications the present invention after having read foregoing of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (8)
1. detect the application specific probe of hedgehog red sandalwood (PterocarpuserinaceusPoir.), it is characterized in that, it is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.12, or the DNA fragmentation of nucleotide sequence reverse complementary sequence of sequence as shown in SEQ ID NO.12.
2. detect the gene chip of hedgehog red sandalwood, it is characterized in that, it contains application specific probe according to claim 1.
3. detect the device of hedgehog red sandalwood, it is characterized in that, it comprises application specific probe as claimed in claim 1 or gene chip as claimed in claim 2.
4. device as claimed in claim 3, it is characterized in that, described device also comprises primer pair, in described primer pair, article one, the nucleotide sequence of primer is as the SEQIDNO.10 in sequence table, and the nucleotide sequence of another primer is as shown in the SEQIDNO.11 in sequence table.
5. device as claimed in claim 4, is characterized in that, containing fluorescent mark on described primer.
6. detect a method for hedgehog red sandalwood, it is characterized in that, comprise the following steps:
(1) STb gene of sample to be tested is prepared, as template, pcr amplification is carried out with the primer pair containing certification mark, obtain PCR primer, in described primer pair, article one, the nucleotide sequence of primer is as the SEQIDNO.10 in sequence table, and the nucleotide sequence of another primer is as shown in the SEQIDNO.11 in sequence table;
(2) application specific probe is incorporated on the sheet base of gene chip, wash away unconjugated probe, obtain the gene chip detecting hedgehog red sandalwood, described application specific probe is the DNA fragmentation of nucleotide sequence as shown in SEQ ID NO.12, or the DNA fragmentation of nucleotide sequence reverse complementary sequence of sequence as shown in SEQ ID NO.12;
(3) in the gene chip of the detection hedgehog red sandalwood of step (2) gained, add the PCR primer of step (1) gained, hybridize, wash away the PCR primer of not hybridizing;
(4) gene chip after the hybridization of detecting step (3) gained.
7. method as claimed in claim 6, it is characterized in that, the sheet base of the gene chip described in step (2) is aldehyde radical sheet base, and described probe is amination probe.
8. method as claimed in claim 7, it is characterized in that, rosewood house-keeping gene detection probes is added, the nucleotide fragments of sequence sequence as shown in SEQ ID NO.16 of described rosewood house-keeping gene detection probes in the other well of the gene chip described in step (2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410103717.9A CN103834742B (en) | 2014-03-20 | 2014-03-20 | Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410103717.9A CN103834742B (en) | 2014-03-20 | 2014-03-20 | Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834742A CN103834742A (en) | 2014-06-04 |
| CN103834742B true CN103834742B (en) | 2016-01-13 |
Family
ID=50798634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410103717.9A Expired - Fee Related CN103834742B (en) | 2014-03-20 | 2014-03-20 | Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834742B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925695A (en) * | 2016-05-17 | 2016-09-07 | 中国林业科学研究院资源昆虫研究所 | Standard gene for molecular identification of pterocarpus macarocarpus kurz and molecular identification method |
| CN106636412A (en) * | 2016-12-28 | 2017-05-10 | 广东产品质量监督检验研究院 | Method for recognizing Dalbergia and Pterocarpus by ITS (Internal Transcribed Spacer) sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392300A (en) * | 2008-10-28 | 2009-03-25 | 天津出入境检验检疫局动植物与食品检测中心 | One-step method real-time fluorescent reverse transcription PCR detection of bean pod mottle virus |
-
2014
- 2014-03-20 CN CN201410103717.9A patent/CN103834742B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392300A (en) * | 2008-10-28 | 2009-03-25 | 天津出入境检验检疫局动植物与食品检测中心 | One-step method real-time fluorescent reverse transcription PCR detection of bean pod mottle virus |
Non-Patent Citations (2)
| Title |
|---|
| Genbank：JN083479.1;NCBI;《Genbank》;20120221;全文 * |
| The Use of Phylogeny to Interpret Cross-Cultural Patterns in Plant Use and Guide Medicinal Plant Discovery: An Example from Pterocarpus (Leguminosae);C. Haris Saslis-Lagoudakis等;《PLoS ONE》;20110731;第6卷(第7期);附表2，摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834742A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103820568B (en) | Detect the application specific probe of India red sandalwood, primer, gene chip and method | |
| CN104911256B (en) | A kind of Radix Angelicae Sinensis SCAR molecular labelings and its authentication method and specific primer pair | |
| CN103820569B (en) | Detect the application specific probe of Andaman padauk, primer, gene chip and method | |
| CN104046700A (en) | Detection kit for quickly identifying donkey skin, horse skin and mule skin | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN103740855A (en) | DNA (deoxyribonucleic acid)-barcode-based eel species identification method | |
| CN103834742B (en) | Detect the application specific probe of hedgehog red sandalwood, primer, gene chip and method | |
| CN101962677A (en) | Method for identifying poultry gender | |
| CN104059975A (en) | Providencia O3, O4, O8, O12, O13 and O20 specific nucleotides and application thereof | |
| CN106119377B (en) | A kind of primer, kit and discrimination method identifying red porgy, black porgy and its filial generation | |
| CN102634584A (en) | Fluorescence quantitative PCR (polymerase chain reaction) qualitative detection method for rabbit-derived fiber composition | |
| CN107345246A (en) | A kind of diatom rbcL genetic analysis method and its application in legal medical expert detects | |
| CN107164525B (en) | A kind of DNA for differentiating 6 kinds of Pterocarpus timber combines bar code and its discrimination method and application | |
| CN106636412A (en) | Method for recognizing Dalbergia and Pterocarpus by ITS (Internal Transcribed Spacer) sequence | |
| CN105969893B (en) | The method and special DNA bar shaped chip segment of a kind of elm mushroom bacterium identification | |
| CN103074336B (en) | Goby mitochondrion ND1 gene complete sequence amplimer, design and amplification method | |
| PH12020551550A1 (en) | Bacterial identification method using rna of sample bacteria, and kit therefor | |
| CN105950776B (en) | A kind of flat mushroom strain mirror method for distinguishing and special DNA bar shaped chip segment | |
| CN105861711A (en) | Poppy species specificity genetic marker detecting system | |
| CN105779627B (en) | Utilize the method for mitochondrial molecule mark identification Zhejiang slurry bee | |
| JP5150963B2 (en) | Primer set for detection of clams in Japan and method for distinguishing clams | |
| CN105969891B (en) | A kind of pleurotus eryngii quel strains mirror method for distinguishing and special DNA bar shaped chip segment | |
| CN104962618B (en) | It is a kind of to carry out the labeled primer and method that ox/mutton identifies using HRM method | |
| CN101130819A (en) | Method and kit for detection of microsatellite instability-positive cell | |
| CN110564883A (en) | uncaria plant identification method based on ITS sequence and machine learning |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160113 Termination date: 20200320 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |