CN103820563A - LAMP (loop-mediated isothermal amplification)-based method for rapid detection of sclerotinia sclerotiorum strain with high resistance to carbendazim - Google Patents

LAMP (loop-mediated isothermal amplification)-based method for rapid detection of sclerotinia sclerotiorum strain with high resistance to carbendazim Download PDF

Info

Publication number
CN103820563A
CN103820563A CN201410089651.2A CN201410089651A CN103820563A CN 103820563 A CN103820563 A CN 103820563A CN 201410089651 A CN201410089651 A CN 201410089651A CN 103820563 A CN103820563 A CN 103820563A
Authority
CN
China
Prior art keywords
lamp
high resistance
strain
carbendazim
sclerotinia sclerotiorum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410089651.2A
Other languages
Chinese (zh)
Other versions
CN103820563B (en
Inventor
周明国
段亚冰
葛常艳
张晓柯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201410089651.2A priority Critical patent/CN103820563B/en
Publication of CN103820563A publication Critical patent/CN103820563A/en
Application granted granted Critical
Publication of CN103820563B publication Critical patent/CN103820563B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification)-based method for rapid detection of a sclerotinia sclerotiorum strain with high resistance to carbendazim. The method can be used for dynamic monitoring and epidemic warning of field sclerotinia sclerotiorum for a carbendazim resistance group, and is a molecular technique established based on LAMP and used for rapid detection of the sclerotinia sclerotiorum strain with high resistance to the carbendazim. According to the detection method, two pairs of LAMP specific primers are designed on beta-tubulin (comprising 198 amino acid mutation sites) of the sclerotinia sclerotiorum strain with high resistance to the carbendazim, and LAMP is performed; whether the strain is the sclerotinia sclerotiorum strain with high resistance to the carbendazim is determined according to the color of a reaction product; if the color is sky blue (an amplification product exists), the strain is the sclerotinia sclerotiorum strain with high resistance to the carbendazim; and if the color is purple (the amplification product does not exist), the strain is the sclerotinia sclerotiorum strain sensitive to the carbendazim. The method is simple, convenient, fast and low in cost, and has important practical significance for sclerotinia sclerotiorum resistance monitoring and rational drug use.

Description

A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain
Technical field
The present invention is based on loop-mediated isothermal amplification technology (1oop-mediated isothermal amplification, LAMP) rapid molecular of derosal high resistance sclerotinite bacterial strain is detected, can be used for dynamic monitoring and the resistance risk assessment of sclerotinite to the development of carbendazim resistance colony, carry out the popular early warning of resistance sclerotinia rot of colza, for the control of sclerotinia rot of colza provides medication guide.
Background technology
Loop-mediated isothermal amplification reaction (LAMP) is the constant temperature nucleic acid Amplification Technologies by a kind of novelty of the inventions such as Japanese scholars Notomi in 2000, is widely used in the gene diagnosis of the disease such as animal, plant.This know-why is: utilize a set of (4 kinds) Auele Specific Primer, under a kind of effect of high reactivity strand displacement archaeal dna polymerase, cause self-circulation strand replacement reaction, in 60～65 ℃ of scope 60min, when synthesizing target dna in a large number, being attended by by product---the magnesium pyrophosphate precipitation of white produces.Hydroxynaphthol blue (HNB) is a kind of Metal ion indicator, present distinct colors according to the variation of magnesium ion in reaction solution, when negative (not amplifying product), being purple, is sky blue when positive (having product amplification).The maximum feature of LAMP method realizes constant-temperature amplification exactly, does not need the expensive instruments such as circulating instrument; Amplified reaction is exceedingly fast, and generally in 1 hour, completes; The product amount that amplification produces is large, gets final product result of determination by naked eyes, does not need loaded down with trivial details electrophoresis process; Highly sensitive, high specificity; Easy and simple to handle, quick, the utmost point is suitable for quick diagnosis and the detection of cause of disease.
Sclerotinia rot of colza is a kind of distributed more widely, the destructive stronger worldwide disease being caused by sclerotinite (Sclerotinia sclerotiorum).This germ host range is very extensive, can infect and comprise that 75 sections 278 belong to 408 kinds and 42 mutation or subspecies plant, have caused serious financial loss to output and the quality of farm crop.Use for many years take derosal as main benzimidazole germicide control sclerotinia rot of colza always, it is reported, Sclerotinia sclerotiorum produces resistance to derosal, and resistant strain distribution range expands year by year, resistance colony ratio constantly rises, and has finally caused derosal field efficacy to decline.Through years of researches, Agricultural University Of Nanjing's phytopharmacology and disease prevention and control laboratory find that sclerotinite is mainly to be caused by 'beta '-tubulin gene (SS1G_04652.3) the 198th or 200 amino acids codon mutations to the drug-fast strain of derosal, the sudden change of the 198th amino acids codon GAG (Glu) → GCG (Ala) shows as high resistance to derosal, and the sudden change of the 200th amino acids codon TTC (Phe) → TAC (Tyr) shows as low anti-to derosal.Wherein the 198th mutation type accounts for the more than 90% of all drug-resistant mutation type total amounts, becomes the major cause of pathogenic bacteria generation field drug-fastness.
Pathogenic bacteria, in natural enormous amount, when the ratio of resistance individuality in colony reaches 3%, can cause that resistance disease is popular, causes chemical control failure.Traditional detection method needs separation and Culture pathogenic bacteria, then with cultivating on pastille substratum, then according to medicament, the restraining effect of mycelial growth is differentiated to resistance.The present invention, on the basis of resistance Mechanism Study, fast, accurately detects the resistance of sclerotinite to derosal based on LAMP technology.This detection method has simply, quick, cost is low, and susceptibility high, can significantly improve detection efficiency, and the popular early warning of effective control, resistance of sclerotium disease is had important practical significance.But, at home and abroad there is no at present through retrieving the relevant report that sclerotinite detects the LAMP rapid molecular of carbendazim resistance bacterial strain.
Summary of the invention
That the evaluation of the sclerotinite of having reported to carbendazim resistance bacterial strain and detection method exist is time-consuming, effort, high in cost of production shortcoming.For this shortcoming, the genotype according to sclerotinite to carbendazim resistance bacterial strain, condition optimizing by experiment, has set up a kind of method of rapid detection derosal high resistance sclerotinite bacterial strain.The features such as that the method has is easy, quick, time saving and energy saving, sensitivity is high, rational use of drug to sclerotium disease, control disease occur with popular, reduce financial loss and there is practical value.
The mutation type of the derosal high resistance sclerotinite bacterial strain of Fields detection is to be caused by the 198th amino acids codon mutation of sclerotinite 'beta '-tubulin genes encoding.The molecular biology method of rapid detection derosal high resistance sclerotinite bacterial strain of the present invention, step is:
(1) on the 'beta '-tubulin gene of derosal high resistance sclerotinite bacterial strain, (comprise the sequence of 198 amino acids) and design 1 pair of outer primer and 1 pair of inner primer, utilize this primer under constant temperature, carry out LAMP amplification;
1. LAMP reacts outer primer pair used:
F3：TCGCCAAAGGTTTCCGATAC
B3：ACCAGGGAAACGGAGACAG
2. LAMP reacts inner primer used to (containing the artificial base mismatch of introducing):
FIPGGCGTCAGAGTTCTCGACCA?ACGTCGTCGAGCCATATAACG
BIP： CGTCAGAGTTCTCGACCAACGTCGTCGAGCCATATAACG
3. LAMP reaction system and condition thereof:
Reaction system (10 μ L):
Figure BSA0000101838270000022
Figure BSA0000101838270000031
Reaction conditions:
63℃60min，80℃10min；
(2) above-mentioned LAMP amplified production is observed to its colour-change, and separate on 3.0% agarose gel electrophoresis, observe amplification;
(3) identify whether be derosal high resistance sclerotinite bacterial strain: if LAMP amplified production shows sky blue (having product amplification), at this moment electrophoretogram should be scalariform band, is judged to be derosal high resistance sclerotinite bacterial strain; If amplified production is purple (without product amplification), at this moment electrophoretogram increases without band, is judged to be the responsive sclerotinite bacterial strain of derosal (Fig. 1).
The molecular biology method of rapid detection derosal high resistance sclerotinite bacterial strain provided by the invention, has the features such as highly sensitive, high specificity, and compared with prior art, advantage of the present invention is:
1, simple and easy to do: this detection method is by thermostat water bath or have the equipment of stable thermal source just can test, and gets final product result of determination by reaction product colour-change, has saved expensive plant and instrument and loaded down with trivial details electrophoresis process;
2, detect high efficiency: this detection method only needs 1 hour detection time used, and traditional indoor bioassay method needs several days time, PCR detection method is also wanted a few hours, can greatly improve like this detection efficiency;
3, high specificity: the method is by 6 isolated areas on 2 pairs of primer specificity identification target sequences, and for 2 isolated areas of PCR primer identification target sequence, specificity improves greatly, and the probability that false positive occurs also decreases;
4, accuracy is high: the method is subject to a large amount of foreign DNAs of existing in reaction mixture and the impact of impurity hardly, need to be from sample purify DNA, can directly utilize incidence tissue and invalid body to extract DNA and carry out rapid detection, greatly improve accuracy in detection;
5, the present invention utilizes LAMP technology to detect derosal high resistance sclerotinite bacterial strain both at home and abroad first, this method is simple and efficient, the Accurate Diagnosis of antagonism bacterial strain, understands resistance colony development trend in time, instructs Scientific Usage of Drugs, reduces costs and reduce environmental pollution and have important practical significance;
6, to 120 gathered strain sclerotinite, the LAMP detected result to derosal high resistance bacterial strain and traditional indoor bioassay method qualification result fit like a glove.
Accompanying drawing explanation
Fig. 1: the LAMP reaction color of the responsive sclerotinite bacterial strain of derosal (HA61S) and derosal high resistance sclerotinite bacterial strain (NT36) changes and electrophoretic band figure
Wherein: M-100bp Marker; 1 is the responsive sclerotinite bacterial strain of derosal; 2 is derosal high resistance sclerotinite bacterial strain (NT36).
Embodiment
Embodiment 1LAMP reaction system optimization
In order to save testing cost, guarantee stability and the reliability of this detection method, to Bst archaeal dna polymerase in reaction system (8U/ μ L) (2U-10U), Mg 2+(25mM) concentration (1-6 μ L), primers F IP/BIP (40 μ M) and F3/B3 (20 μ M) concentration (0.25-1.25 μ L), trimethyl-glycine (8M) concentration (1-6 μ L), HNB (2.5mM) concentration (0.5-2.5 μ L) is optimized, determine that optimum response system is: BstDNA polysaccharase (8U/ μ L) 0.4 μ L, 10 × ThermoPol1.0 μ L, MgCl2 (25mM) 1.6 μ L, dNTP (10mM) 1.0 μ L, FIP (40 μ M) 0.4 μ L, BIP (40 μ M) 0.4 μ L, F3 (10 μ M) 0.2 μ L, B3 (10 μ M) 0.2 μ L, trimethyl-glycine (8M) 1.2uL, HNB (2.5mM) 0.6 μ L, genomic dna 0.4 μ L, dH 2o (sterile purified water) 2.6 μ L.
Embodiment 2LAMP reaction condition optimization
In order to obtain the suitableeest temperature of reaction and time, guarantee the high efficiency of this detection method, temperature of reaction in reaction parameter (60-65 ℃) and time (15-90min) are optimized, and final the suitableeest definite temperature of reaction and the time is respectively 63 ℃ and 60min.
Embodiment 3LAMP primer specificity detects
Genomic dna take derosal high resistance sclerotinite bacterial strain (NT36) and sensitive strain (HA61S) carries out respectively LAMP amplification as template, and this technology has good specificity.In the time that template is high resistance bacterial strain, reaction product color is sky blue, and electrophoretogram becomes scalariform band (Fig. 1); In the time that template is sensitive strain, reaction product color is purple, and electrophoresis is without band (Fig. 1).
Embodiment 4LAMP repeatability detects
120 derosal high resistance sclerotinite strain gene group DNAs that 2011-2013 gathered to diverse geographic location are that template is carried out LAMP detection, and the reaction color of 120 laboratory samples is sky blue, and electrophoretogram is all scalariform band.And show through the sequencing result of mutator gene, 120 samples all suddenly change at 198 origination points of beta tubulin sequence.The above results shows this detection method reliable results, reproducible.
Detection method that the present invention sets up can be accurately, rapid detection goes out derosal high resistance sclerotinite bacterial strain, for scientific research and production practice provide a kind of detection technique easy, quick, with low cost, also be the dynamic monitoring of sclerotinite to carbendazim resistance colony, popular early warning and the rational use of drug of resistance disease provide theoretical basis and technical director, all have reality and profound significance to increasing ecology, society and economic benefit.

Claims (2)

1. the method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain, step is:
(1) use 2 pairs of Auele Specific Primers the genomic dna of bacterial strain to be identified is carried out to LAMP constant-temperature amplification, the base sequence of 2 pairs of wherein said Auele Specific Primers respectively:
LAMP reacts outer primer pair used:
F3：TCGCCAAAGGTTTCCGATAC
B3：ACCAGGGAAACGGAGACAG
LAMP reacts inner primer used to (containing the artificial base mismatch of introducing):
FIP：GGCGTCAGAGTTCTCGACCAACGTCGTCGAGCCATATAACG
BIP：
Figure FSA0000101838260000011
CGTCAGAGTTCTCGACCAACGTCGTCGAGCCATATAACG
(2) above-mentioned LAMP amplified production is observed to its colour-change, and separate on 3.0% agarose gel electrophoresis, observe amplification;
(3) identify whether be derosal high resistance sclerotinite bacterial strain: if LAMP amplified production shows sky blue, at this moment electrophoretogram should be scalariform band, is judged to be derosal high resistance sclerotinite bacterial strain; If amplified production is purple, at this moment electrophoretogram increases without band, is judged to be the responsive sclerotinite bacterial strain of derosal.
2. the method for rapid detection derosal high resistance sclerotinite bacterial strain according to claim 1, is characterized in that: the LAMP reaction system that step (1) is described and condition respectively:
Reaction system (10 μ L):
Figure FSA0000101838260000012
Reaction conditions:
63℃60min，80℃10min。
CN201410089651.2A 2014-03-12 2014-03-12 A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain Active CN103820563B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410089651.2A CN103820563B (en) 2014-03-12 2014-03-12 A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410089651.2A CN103820563B (en) 2014-03-12 2014-03-12 A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain

Publications (2)

Publication Number Publication Date
CN103820563A true CN103820563A (en) 2014-05-28
CN103820563B CN103820563B (en) 2015-08-12

Family

ID=50755849

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410089651.2A Active CN103820563B (en) 2014-03-12 2014-03-12 A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain

Country Status (1)

Country Link
CN (1) CN103820563B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104313177A (en) * 2014-11-11 2015-01-28 南京农业大学 Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain
CN104911258A (en) * 2015-04-23 2015-09-16 南京农业大学 Carbendazim resistant genotype F200Y sclerotinia sclerotiorum LAMP detection primer composition and LAMP test kit and LAMP test method
CN113355451A (en) * 2021-07-21 2021-09-07 陕西理工大学 Method, primer and kit for identifying sclerotinia rot resistance of rape based on CAPS molecular marker

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1514018A (en) * 2003-06-10 2004-07-21 南京农业大学 Sclerotinite anti carbendazol detection gene and its detecting method
CN103436628A (en) * 2013-09-23 2013-12-11 南京农业大学 Method for rapidly detecting moderately-resistant strain in fusarium graminearum to carbendazim

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1514018A (en) * 2003-06-10 2004-07-21 南京农业大学 Sclerotinite anti carbendazol detection gene and its detecting method
CN103436628A (en) * 2013-09-23 2013-12-11 南京农业大学 Method for rapidly detecting moderately-resistant strain in fusarium graminearum to carbendazim

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
周明国等: "A rapid detection method for the plant pathogen Sclerotinia sclerotiorum based on lopp-mediated isothermal amplification(LAMP)", 《AUSTRALASIAN PLIANT PATHOLOGY》, vol. 43, no. 1, 3 July 2013 (2013-07-03), pages 61 - 66 *
周明国等: "Detection of resistance in Sclerotinia sclerotiorum to carbendazim and dimethachlon in Jiangsu Province of China", 《AUSTRALASIAN PLANT PATHOLOGY》, vol. 43, no. 3, 14 February 2014 (2014-02-14), pages 307 - 312 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104313177A (en) * 2014-11-11 2015-01-28 南京农业大学 Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain
CN104313177B (en) * 2014-11-11 2016-05-11 南京农业大学 The molecular detecting method of a kind of Rapid identification the pathogen of Botrytis cinerea to carbendazim resistance gene type F200Y bacterial strain
CN104911258A (en) * 2015-04-23 2015-09-16 南京农业大学 Carbendazim resistant genotype F200Y sclerotinia sclerotiorum LAMP detection primer composition and LAMP test kit and LAMP test method
CN113355451A (en) * 2021-07-21 2021-09-07 陕西理工大学 Method, primer and kit for identifying sclerotinia rot resistance of rape based on CAPS molecular marker

Also Published As

Publication number Publication date
CN103820563B (en) 2015-08-12

Similar Documents

Publication Publication Date Title
CN103436628B (en) Method for rapidly detecting moderately-resistant strain in fusarium graminearum to carbendazim
CN106222263B (en) LAMP primer composition for detecting pythium ultimum, kit and detection method thereof
CN108060257B (en) Primer composition for detecting pythium androsaceus based on loop-mediated isothermal amplification technology and detection method thereof
CN103276057B (en) LAMP technology based rapid Botrytis cinerea detection method
CN102154485B (en) Single tube nested PCR (polymerase chain reaction) detection method for wheat stripe rust bacteria and primer thereof
CN103484571B (en) LAMP (loop-mediated isothermal amplification) detection primer group, detection kit and detection method for infectious hypodermal and hematopoietic necrosis virus
CN105316422A (en) Kit for rapidly detecting pathogeny of acute hepatopancreatic necrosis disease of prawns and application of kit
CN104313177B (en) The molecular detecting method of a kind of Rapid identification the pathogen of Botrytis cinerea to carbendazim resistance gene type F200Y bacterial strain
CN108588250A (en) A kind of LAMP primer and its detection method for detecting Acidovorax Avenae Subsp
CN103820563B (en) A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain
CN108315472A (en) It is a kind of to be used for the Primer composition and its application that alternaric bacteria LAMP is quickly detected
CN104293971B (en) A kind of method for quick based on LAMP technology anti-Botrytis cinerea bacterial strain high to carbendazim
CN108949916B (en) Rape black shank bacterium specific sequence, LAMP detection primer and application
CN111635959B (en) LAMP primer of Fluoxapiprolin resistance genotype G700V phytophthora capsici and application
CN105063187B (en) Method and Primer composition of a kind of quick detection the pathogen of Botrytis cinerea to SDHI series bactericidal agent resistances
CN108315473A (en) It is a kind of to be used for the Primer composition and its application that rice green smut germ LAMP is quickly detected
CN103773867B (en) The LAMP detection primer group of cry2Ab gene, test kit and detection method in genetically modified crops
CN108315391B (en) Primer composition for rapid LAMP detection of pomegranate dry rot and application thereof
CN110878373A (en) Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof
CN107523627B (en) LAMP kit for detecting acute hepatopancreas necrosis pathogen
CN103014164B (en) Duplex fluorescent quantitation RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for shellfish Bonamia and Perkinsus
CN113388697A (en) KASP-SNP molecular probe and detection method and application thereof
CN103820566B (en) Primer, probe and method for specific quantitative polymerase chain reaction (PCR) accurate detection of transgenic maize DAS-40278-9 strain
Dai et al. Establishment and evaluation of a TEF1-α based loop-mediated isothermal amplification assay for detection of Phomopsis longicolla
CN104928364A (en) Method for detecting gene F200Y of fusarium graminearum resisting carbendazim on basis of loop-mediated isothermal amplification technology and primer composition

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant