CN103820557A

CN103820557A - MP (Mycoplasma Pneumoniae) drug resistance diagnostic kit

Info

Publication number: CN103820557A
Application number: CN201410073883.9A
Authority: CN
Inventors: 辛德莉; 李静宜; 孙岚; 郭东星; 姜越
Original assignee: Beijing Friendship Hospital
Current assignee: Beijing Friendship Hospital
Priority date: 2013-10-30
Filing date: 2014-02-28
Publication date: 2014-05-28
Anticipated expiration: 2034-02-28
Also published as: CN103820557B

Abstract

The invention discloses an MP (Mycoplasma Pneumoniae) drug resistance diagnostic kit. The kit comprises an upstream primer sequence P1: 5'TCCAGGTACGGGTGAAGACA'3, a downstream primer sequence P2: 5'GTCCTGATCAATATTAAGCTACAGTAAAGCT'3, a probe sequence T1: 5'ACGGAAAGACCCC'3 marked by VIC, and a probe sequence T2: 5'CGGGAAGACCCC'3 marked by FAM. According to the MP drug resistance diagnostic kit provided by the invention, through building a fluorogenic quantitative PCR allele identification method, the genotype of 2063 locus of MP is identified, the drug resistance of the MP can be judged while rapid diagnosis is carried out, and the detection sensitivity is better.

Description

Mycoplasma pneumoniae resistance diagnostic kit

Technical field

The present invention relates to a kind of PCR detection kit, more particularly, relate to a kind of mycoplasma pneumoniae resistance diagnostic kit of real-time quantitative.

Background technology

Mycoplasma pneumoniae (Mycoplasma pneumoniae, referred to as MP) is the common disease substance of children and adolescents and the upper and lower respiratory tract infection of being grown up.23%～50% preschool children and teenager's community acquired pneumonia are infected and are caused by MP, and popular cycle is 3～7 years.Mycoplasma pneumoniae pneumonia is recurrence or protracted course of disease easily, and patient with severe symptoms often merges the outer symptom of lung, serious to Health hazard.

MP is acellular wall construction, can only select suppress or affect its protein and the synthetic medicine of nucleic acid, as macrolide antibiotics, tetracycline antibiotics, quinolone antibiotic etc. clinically.But due to other antibiotic untoward reactions, treatment children MP infects first-selected macrolide antibiotics.Since calendar year 2001 is found the MP of macrolide antibiotics resistance, MP resistant rate raises year by year and Epidemic Scope expands gradually, and existing multiple countries are separated to MP persister.According to the literature, Japan's MP resistant rate in 2007 is up to more than 40%, and Korea S children inpatient MP resistant rate is 61.3%, and Italy is 26%, and France is 9.8%, and Germany is 3%.China MP resistance situation is more severe, 92% above macrolide antibiotics resistance in MP clinical separation strain.The resistance mechanism of MP is mainly the transgenation of large ribosomal subunit 23S rRNA and ribosomal protein L 4, L22 transgenation, and wherein 2063 sites in 23S rRNA structural domain V district and the point mutation in 2064 sites are occupied an leading position.In the resistance MP that China finds, 2063A-G sudden change accounts for more than 97%.

At present, conventional MP diagnostic method is that MP cultivates, serology detects and PCR clinically.MP cultivates length consuming time, and positive rate is low, and the monitoring of resistance conventionally needs vitro culture and carries out drug sensitive test, measures minimal inhibitory concentration (MIC).Serology test is simple and easy to do, but needs patient's convalescent phase serum to contrast, acute phase diagnosis effect not good.Conventional PCR method has advantages of fast, positive rate is high, but has false-positive problem.Quantitative fluorescent PCR is with high specificity, the advantage such as quantitatively accurate, reproducible and developed rapidly, but it can not judge pathogenic agent resistance, limited to the directive significance of clinical treatment.

Summary of the invention

Technical problem to be solved by this invention is to provide a kind of mycoplasma pneumoniae resistance diagnostic kit.This test kit can, by setting up quantitative fluorescent PCR allelotrope discrimination method, be identified the genotype in MP2063 site, in diagnosis, judges its resistance.

For realizing above-mentioned goal of the invention, the present invention adopts following technical scheme:

A kind of mycoplasma pneumoniae resistance diagnostic kit, comprising:

Upstream primer sequence P1:5'TCCAGGTACGGGTGAAGACA'3;

Downstream primer sequence P2:5'GTCCTGATCAATATTAAGCTACAGTAAAGCT'3;

Probe sequence T1:5'ACGGAAAGACCCC'3, VIC mark;

Probe sequence T2:5'CGGGAAGACCCC'3, FAM mark.

Mycoplasma pneumoniae resistance diagnostic kit provided by the invention by setting up quantitative fluorescent PCR allelotrope discrimination method, is identified the genotype in MP2063 site, is judged its resistance, thereby instruct clinical practice in quick diagnosis.The detection sensitivity of this diagnostic kit is better, and potential applicability in clinical practice is huge.

Accompanying drawing explanation

Fig. 1 is the standard plasmid PCR result of MP type strain FH, persister 307 and structure.Wherein, 1 is MP type strain FH, and 2 is that persister 307,3 is responsive 2063A plasmid, and 4 is resistance 2063G plasmid, the negative contrast of N, the positive contrast of P; M is 100bp DNA Ladder.

Fig. 2 is real-time fluorescence quantitative PCR typical curve.

Fig. 3 has shown that real-time fluorescence quantitative PCR identifies 2063 allelic diagnostic values.

Embodiment

Further set forth the present invention below in conjunction with specific embodiment.The experimental technique using in following embodiment if no special instructions, is ordinary method.Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, or the condition of advising according to manufacturer.

Mycoplasma pneumoniae (MP) is a kind of common disease substance that causes children Streptococcus and extrapulmonary complication.The primary treatment medicine that children MP infects is at present macrolide antibiotics.Recent year, international more and more MP strains that are separated to resistance to macrolide antibiotics clinically, the encoding gene sudden change of the 23S rRNA that main resistance mechanism is large ribosomal subunit.In China, report that at present more than 97% persister is 2063A → G sudden change.Since 2000 report real-time quantitative PCR diagnosis MP for the first time, existing a large amount of researchs of the real-time quantitative PCR diagnostic method for different extension increasing sequences occur, also occur a lot of commercial reagent box.But these methods can only provide positive or negative result, can not obtain resistance information.Therefore, the present invention is directed to the point mutation that causes 2063 A → G of MP resistance, design primer and probe, set up the test kit of MP resistance diagnosis single stage method.This is launched detailed specific description below.

1 materials and methods

1.1 sample

1.1.1MP type strain

MP type strain FH(ATCC15531), mycoplasma hominis (ATCC27813) is that tropical medicine institute of Beijing Friendship Hospital Attached to Capital Medical Univ. laboratory stores; Pyriform mycoplasma, myoplasna penetrans, mycoplasma genitalium are presented by professor Wang Bei of HSPH of Southeast China University.

1.1.2MP clinical separation strain

MP clinical separation strain separates the respiratory tract oropharyngeal swab specimen of going to a doctor year February from February, 2010～2011 in 43 routine Diagnosis of Suspected Pneumonia children with mycoplasma pneumoniae pneumonias of Beijing Friendship Hospital Attached to Capital Medical Univ.'s paediatrics (inpatient department and outpatient service), Beijing Chaoyang Hospital Attached to Capital Medical Univ.'s paediatrics (inpatient department).12 parts of collections of Nasopharyngeal swabs sample were gone to a doctor in the case of the doubtful MPP of The Third Affiliated Hospital of Peking University's paediatrics from December, 2012.

1.1.3 compare bacterial strain

Pseudomonas aeruginosa (ATCC27853), escherichia coli (ATCC25922), enterobacter cloacae (ATCC700323), streptococcus aureus (ATCC25922), kerekou pneumonia uncle's clinical separation strain (1705) are presented by clinical laboratory of Beijing Friendship Hospital Attached to Capital Medical Univ..

1.2 reagent

Calf serum, yeast extract, glucose, penbritin, IPTG, X-Gal, agarose, Tryptones are all purchased from Beijing biological company limited of ring Ya Taike; 2 × Tap plus PCR Green Mix is purchased from Takara company; PGEM

-T Easy Vector Systems II is purchased from Promega company; QIAamp DNA minikit DNA extraction test kit is purchased from Qiagen company; PCR product reclaims test kit and plasmid purification test kit is century bio tech ltd purchased from Beijing health; Quantitative fluorescent PCR Genotyping mix is purchased from American AB I company.

1.3 quantitative fluorescent PCR

1.3.1DNA template extraction

Get the cultivation MP of 200 μ L logarithmic phase growths, 20000g, centrifugal 20min; 200 μ L PBS precipitations are resuspended; QIAamp DNA minikit extracts DNA profiling.In aseptic picking colony to 200 μ of transfering loop L PBS, QIAampDNA minikit extracts DNA profiling.The sterilized cotton swabs MP nutrient solution that extracts oropharyngeal swab specimen is soaked, discard cotton swab through repeatedly rinsing after washing extruding, by soak solution with 20000g, centrifugal 10min, after abandoning supernatant, add sample treatment solution 50 μ L, and fully mix, put water-bath 10min in 100 ℃ of boiling water, this solution is for subsequent use as DNA profiling.

1.3.2 primer sequence and probe sequence

According to MP type strain M129 sequence (NC_000912.1) 23S RNA mutational site design upstream and downstream primer and probe; Upstream primer sequence P1:5'TCCAGGTACGGGTGAAGACA'3(SEQ ID NO.1), downstream primer sequence P2:5'GTCCTGATCAATATTAAGCTACAGTAAAGCT'3(SEQ IDNO.2), probe sequence T1:5'ACGGAAAGACCCC'3(SEQ ID NO.3), VIC mark; T2:5'CGGGAAGACCCC'3(SEQ ID NO.4), FAM mark.Primer sequence and probe sequence are synthetic by Ying Weijie base trade Co., Ltd.

1.3.3PCR

Reaction system: 2 × damping fluid, 10.0 μ L, the primer P31.0 μ L of 10 μ mol/L, 10 μ mol/L primer P41.0 μ L, template DNA 1.0 μ L, ddH2O7.0 μ L.

Reaction conditions: 93 ℃ of sex change 2min; 95 ℃ of 1min, 50 ℃ of 1min, 72 ℃ of 1min, 35 circulations; 72 ℃ are extended 5min.

Quantitative fluorescent PCR product adopts glue to reclaim test kit and reclaims, and adopts T Easy carrier linked system clone, and 4 ℃ of connections are spent the night, transformed competence colibacillus cell, blue hickie screening.Random 6 white colonies of picking, take lysate as template, increase with original quantitative fluorescent PCR reaction system, and 2% agarose gel electrophoresis evaluation recon is selected 2 positive colony Song Yingweijie base trade Co., Ltds order-checkings; Adopt Blast function to carry out sequential analysis.Selecting the consistent clone of sequencing result, to extract plasmid for subsequent use.

1.3.4 real-time fluorescence quantitative PCR

Reaction system: 2 × damping fluid, 10.0 μ L, 40 × Assay Mix(is containing P1, P2, T1, T2) 0.5 μ L, DNA profiling (wild-type 2063A or saltant type 2063G standard plasmid) 1.0 μ L, ddH2O7.0 μ L, cumulative volume 20 μ L.

Reaction conditions: 95 ℃ of 1min; 92 ℃ of 15s, 60 ℃ of 1min, 40 circulations; Collect respectively before amplification, fluorescent signal after when amplification, amplification, adopt the SDS software of ABI company quantitative real time PCR Instrument 7500 to obtain typical curve.Positive plasmid from 600000 to 6 carries out 10 times of doubling dilutions.Adopt different strains DNA to carry out specificity experiment as template, the specificity of primer and probe in detection real-time fluorescence quantitative PCR reaction system.The evaluation of 43 strain MP clinical separation strain 2063 loci gene types and Nasopharyngeal swabs sample 2063 loci gene types all completes under this reaction system.

1.3.523S rRNA nest-type PRC 23S rRNA nest-type PRC primer is overcoat upstream: 5 ' GGTCCTAAGGTAGCGAAATT3 ' (SEQ ID NO.5); Overcoat downstream: 5 ' CAGTTACCAATTAGAACAGC3 ' (SEQ ID NO.6); Inner sleeve upstream P3:5 ' CCTAGTCGGGTAAATTCCGT3 ' (SEQ ID NO.7); Inner sleeve downstream P4:5 ' CCAAGGGTAGTATTCCACCT3 ' (SEQ ID NO.8) is (referring to the paper " respiratory infection of mycoplasma peneumoniae in children resistance present situation " of Li Jing, Cui Feifei, Xin Deli, be published in " Applied Clinical Pediatrics magazine " 2009,24(22): 1717～1719.), two take turns the order-checking of product Song Yingweijie base trade Co., Ltd.Take 23S rRNA nest-type PRC sequencing result as contrast, calculate real-time fluorescence quantitative PCR and identify the susceptibility of 2063 loci gene types, specific degree, positive predictive value, negative predictive value etc.

2 results

2.1 build standard plasmid

With MP type strain FH(sensitive strain, 2063A) and clinical separation strain 317(persister, 2063G) be DNA profiling, carry out pcr amplification, amplified fragments is positioned at position, 250bp left and right, with the object fragment 244bp (see figure 1) in the same size of design.Above-mentioned PCR product is connected to transformed competence colibacillus cell after T-EASY, and coated plate contains ITPG, X-gal and penbritin selectivity flat board, selects white bacterium colony to carry out PCR evaluation, the clip size obtaining and the consistent (see figure 1) of expection.The demonstration of plasmid sequencing result, responsive 2063A plasmid 2063 sites and MP type strain FH are A, and resistance 2063G plasmid 2063 sites are G, and FH is inconsistent with MP type strain.

2.2 typical curve

The R of responsive 2063A plasmid control curve ²be 0.9979, slope is-3.4893, and amplification efficiency is 93%; The R of resistance 2063G plasmid control curve ²be 0.9979, slope is-3.7262, and amplification efficiency is 86%.Under identical copies number, the Ct value that responsive 2063A plasmid and resistance 2063G plasmid are corresponding is very approaching, the better (see figure 2) of circulation ratio.The detection lower limit of responsive 2063A plasmid and resistance 2063G plasmid is respectively and 6 and 60, and responsive 2063A plasmid copy number is 6～6 × 10 ⁶, genotype is 2063A; Resistance 2063G plasmid copy number is 60～6 × 10 ⁶, genotype is 2063G.

2.3 specificity experiments

In MP clinical separation strain, the Ct value of persister is 24.69, and genotype is 2063G; The Ct value of MP type strain FH is 26.05, and genotype is 2063A.Except mycoplasma genitalium, all there is not amplification in mycoplasma hominis, pyriform mycoplasma, myoplasna penetrans and Pseudomonas aeruginosa, escherichia coli, enterobacter cloacae, streptococcus aureus, klebsiella pneumoniae clinical separation strain, the Ct value of mycoplasma genitalium is 26.15, and genotype is 2063A.

2.443 strain clinical separation strain 2063 loci gene types

43 strain clinical separation strains carry out real-time fluorescence quantitative PCR and all occur amplification, and Ct value is 26.82～34.25, and copy number is 2.05 × 10 ⁴～2.95 × 10 ⁶; Wherein 6 strain 2063 sites are A, are sensitive strain, and 37 strain 2063 sites are G, are persister, and MP resistant rate is 86.05%.Compared with 23S rRNA nest-type PRC sequencing result, real-time fluorescence quantitative PCR identifies that 2063 allelic susceptibilitys, specific degree, positive predictive value, negative predictive value are 100%(and see Fig. 3).

2.5 Nasopharyngeal swabs sample 2063 loci gene types

In 12 parts of Nasopharyngeal swabs samples, 2 parts are carried out all appearance amplifications of real-time fluorescence quantitative PCR, and in all the other 10 parts of samples, 6 part of 2063 site is A, is sensitive strain, and 3 strain 2063 sites are G, are persister, and 1 part of sample is found 2063A and 2063G site simultaneously.Nasopharyngeal swabs sample MP positive rate is 83.33%(10/12), resistant rate is 33.33%(4/12).

The present invention adopts MP type strain FH, using the clear and definite clinical separation strain 307 of Antibiotic Resistance as template, builds responsive type 2063A plasmid, using drug-resistant type 2063G plasmid as positive criteria product, and drawing standard curve.Minimum the detecting of amphitypy is respectively 6 and 60 copy numbers.Drug-resistant type standard substance, compared with the low order of magnitude of responsive type, consider that reason may be that 2063 G hydrogen bond ruptures need higher energy.So in the time of identical annealing temperature, low compared with A containing G open chain efficiency, therefore detect effect poor compared with A.So it is necessary carrying out nucleic acid quantification according to different genotype structure typical curve again.Specificity experimental result shows that mycoplasma genitalium MG has amplification, and genotype is 2063A.MG is a kind of pathogenic pathogenic agent that spreads through sex intercourse of having of urogenital tract that is colonizated in, and first-selected medicine is Macrolide, quinolone and tetracycline antibiotics.MG is carried out to sequential analysis, find that near the MG sequence in 2063A position and type strain M129 consistence reach 99%.Because of the restriction of detection site region, fluorescence quantification PCR primer and probe experimental design, this intersection is inevitable.But can distinguish by serology or 16s RNA PCR.

Apply this test kit and detect 43 strain clinical separation strains, 6 strains are sensitive strain, and 37 strains are persisters.43 strain clinical separation strains are checked order after traditional 23S rRNA nest-type PRC show result and the present invention in full accord.This shows, for clinical separation strain, utilize this test kit can quick and precisely identify 2063 genotype, distinguish resistance and sensitive strain, thereby simplify the operation flow process, reduce labour intensity.

This test kit is applied to clinical samples, finds that MP positive rate is 88.33%.All detect the positive with batch sample 23S rRNA nest-type PRC.Contriver by analysis, thinks it may is that oropharyngeal swab specimen DNA extraction liquid is mixed with a large amount of impurity, and simple boiling method can not be removed PCR inhibition completely, causes real-time quantitative PCR decrease in efficiency, and recall rate reduces; Or due to indivedual patient's carrying capacity lower due to, can consider to optimize DNA sample extracting method or use ripe DNA extraction test kit.

The present invention detects 2063A and 2063G heterozygous genes type for the first time in same sample, illustrates same patient and may have sensitivity and persister simultaneously.And common Chao Shi PCR order-checking can cause dominant strain gene to be amplified in a large number, sequencing result only illustrates dominant microflora genotype conventionally, can not react strictly according to the facts the phenotype of the actual infection of patient MP.Achievement in research of the present invention shows that MP can produce resistance under macrolide antibiotics pressure in vitro, or also may have for MP in environment the low-level sudden change of 2063A → G, and just microbiotic uses while killing sensitive strain, and persister just becomes dominant microflora.

In sum, the present invention has tentatively set up a kind of quick diagnosis MP and infects and judge the mycoplasma pneumoniae resistance diagnostic kit of drug-resistant phenotype.This test kit detection sensitivity is better, but 2063A is different with 2063G genotype detection lower limit, and 2063G, compared with the low order of magnitude of 2063A, only has and intersects with mycoplasma genitalium.Should continue optimizing reaction system and expanding clinical application, effect be assessed.The present invention is compared with traditional 23S rRNA Chao Shi PCR sequence measurement, and susceptibility and specificity are all better, and potential applicability in clinical practice is huge.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

SEQUENCE?LISTING

<110> Beijing Friendship Hospital Attached to Capital Medical Univ.

<120> mycoplasma pneumoniae resistance diagnostic kit

<130>/

<160>8

<170>PatentIn?version3.5

<210>1

<211>20

<212>DNA

<213> synthetic

<400>1

tccaggtacg?ggtgaagaca20

<210>2

<211>31

<212>DNA

<213> synthetic

<400>2

gtcctgatca?atattaagct?acagtaaagc?t31

<210>3

<211>13

<212>DNA

<213> synthetic

<400>3

acggaaagac?ccc13

<210>4

<211>12

<212>DNA

<213> synthetic

<400>4

cgggaagacc?cc12

<210>5

<211>20

<212>DNA

<213> synthetic

<400>5

ggtcctaagg?tagcgaaatt20

<210>6

<211>20

<212>DNA

<213> synthetic

<400>6

cagttaccaa?ttagaacagc20

<210>7

<211>20

<212>DNA

<213> synthetic

<400>7

cctagtcggg?taaattccgt20

<210>8

<211>20

<212>DNA

<213> synthetic

<400>8

ccaagggtag?tattccacct20

Claims

1. a mycoplasma pneumoniae resistance diagnostic kit, is characterized in that comprising:

Upstream primer sequence P1:5'TCCAGGTACGGGTGAAGACA'3;

Downstream primer sequence P2:5'GTCCTGATCAATATTAAGCTACAGTAAAGCT'3;

Probe sequence T1:5'ACGGAAAGACCCC'3, VIC mark;

Probe sequence T2:5'CGGGAAGACCCC'3, FAM mark.

2. mycoplasma pneumoniae resistance diagnostic kit as claimed in claim 1, is characterized in that:

Adopt mycoplasma pneumoniae type strain, using the clear and definite clinical separation strain of Antibiotic Resistance as template, build responsive type 2063A plasmid, using drug-resistant type 2063G plasmid as positive criteria product, drawing standard curve.