Summary of the invention
The invention provides a kind of clone of the dengue type 2 virus replicon with two reporter genes, this clone is with the dengue fever virus 2 type replicons of Rluc and Neo label, and leather fever virus 2 type replicons can well copy in this cell, continuous passage.This clone has been delivered to the center preservation of Chinese Typical Representative culture collection on December 20th, 2011, Classification And Nomenclature: the hamster kidney continuous cell line BHK-21BHK-21/pACYC-TSV-Rluc2A-Rep-3NTR-IRES-Neo that contains dengue virus replicon, CCTCC NO:C2011124, address: Wuhan, China Wuhan University.
Another object of the present invention has been to provide a kind of application of clone of the dengue type 2 virus replicon with two reporter genes, in this clone, the albumen of Rluc coding is convenient to detect virus genomic copying, the albumen of Neo genes encoding can make host cell have the ability of anti-G418 medicine, described application comprises the research of this clone for aspects such as mechanism of action, vaccine and the diagnostic reagents of anti-DENV virus drug screening, anti-DENV virus drugs, and prospect is widely used.
In order to achieve the above object, the present invention has taked following technical scheme:
Mentality of designing of the present invention is:
At the DENV2 plasmid pACYC-DENV2-TSV-Rluc2A-Rep(Development and char acterization of a stable luciferase dengue virus for high-throughput screening[J with Rluc] .Antiviral r esearch, 2011, 91 (1): 11-19.) in, insert IRES-Neo gene, build the dengue fever virus 2 type replicons with Rluc and Neo gene, the RNA of this clone's in-vitro transcription is transfected in BHK-21 cell, under the lasting resistance screening of suitable concn G418, through continuous passage screening, finally obtain a kind of stable cell lines of dengue type 2 virus (DENV-2) replicon with Rluc and the two reporter genes of Neo.
With a clone for the dengue type 2 virus replicon of two reporter genes, its preparation method is as follows:
1) with the structure of the dengue fever virus 2 type replicons of luciferase gene and neomycin resistance gene, its method is as follows:
(1) utilize and merge round pcr, in the DENV2 plasmid pACYC-DENV2-TSV-Rluc2A-Rep with Rluc, build C9250G sudden change, create Nhe1 restriction enzyme site.
(2) DENV2-TSV-Age I-Cla I gene fragment of utilizing restriction enzyme A ge I and Cla I double digestion to obtain, working concentration is that 1% agarose gel electrophoresis detects PCR product, and use sepharose recovery test kit to reclaim respectively DNA fragmentation, connect in the DENV2-TSV-F of same enzyme double digestion gene fragment called after DENV2-TSV-F-Nhe I;
(3) utilize primer Nhe I-IRES-neo-F(TATGCTAGCCCGCCCCTCTCCCTCCCCCCCC) and Nh e I-IRES-Neo-R(ACAGCTAGCTCAGAAGAACTCGTCAAGAAGG), be purchased from Clontech company of the U.S. take pLVX-IRES-Neo[] as template, pcr amplification Nhe I-IRES-Neo-Nhe I gene fragment; Nhe I enzyme is connected in DENV2-TSV-F-Nhe I after cutting, called after DENV2-TSV-F-Nhe I-IRES-Neo after order-checking is correct;
(4) Xho I and Cla I double digestion DENV2-TSV-F-Nhe I-IRES-Neo recombinant plasmid, the fragment of the gene containing IRSE-Neo obtaining is connected in the pACYC-DENV2-TSV-Rluc2A-Rep of same enzyme double digestion plasmid, called after pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo(Fig. 1), its sequence is shown in SEQ ID NO.1.
2) a kind of screening of clone of the dengue type 2 virus replicon with two reporter genes:
(1) determining of microbiotic G418 screening clone optimum concn:
In each hole of 24 porocyte culture plates, inoculate respectively 2 × 10
4individual BHK-21 cell, in each hole, add G418, final concentration is respectively 0,200,400,600,700,800 and 1000 μ g/ml, screen and within about 10 days, observe cell state in the 12 each holes of orifice plate cell, G418 concentration is that in two holes of 700ug/ml, cell is all dead, thereby select to be used for than the 800ug/ml of its high concentration gradient the best Select to use concentration of G418 of follow-up cell line selection, 400ug/ml is that clone maintains concentration while going down to posterity.
(2) preparation of pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo RNA:
Cut pACYC-TA-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo with Cla I enzyme and carry out linearization process, linearizing product is after the extracting of phenol chloroform, respectively take it as template, use in-vitro transcription test kit T7mMESSAGE mM ACHINE kit, carry out in-vitro transcription according to test kit explanation and obtain pACYC-TA-DENV2-TSV-Rluc2A-Rep-3NT R-IRES-Neo RNA.
(3) transfection BHK-21 cell:
The method that adopts electricity to turn the RNA of the pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo of 10 μ g in-vitro transcription proceeds to 0.8ml BHK-21 cell and (contains 8 × 10
6individual cell), use the state of microscope observing cell every day, in the time that becoming mono-clonal, cell adopt the monoclonal method of picking to carry out enlarged culturing.
Finishing screen is selected the stable cell lines of the sick 2 type replicons of a kind of Dengue with two reporter genes, this clone has been delivered to the center preservation of Chinese Typical Representative culture collection on December 20th, 2011, Classification And Nomenclature: the hamster kidney continuous cell line BHK-21BHK-21/pACYC-TSV-Rluc2A-Rep-3NTR-IRES-Neo that contains dengue virus replicon, CCTCC NO:C2011124, address: Wuhan, China Wuhan University.
The hamster kidney continuous cell line physio-biochemical characteristics that contain dengue virus replicon, and cultural characters: in this clone, dengue type 2 virus replicon can be stablized and copies, current stable 47 generations that reached, and can stably express virus self Nonstructural Protein and Rluc luciferase.This cell and normal BHK-21 plesiomorphism, be rectangular shuttle type when adherent, and not adherent cell is circular.Optimal culture conditions is 37 ℃, 5%CO
2, use containing the DMEM perfect medium of 10% foetal calf serum (V/V), 100U/ml penicillin, 100 μ g/ml Streptomycin sulphates, 500ug/ml G418 and cultivate.
Described clone separates while going down to posterity, uses 0.25% pancreatin that contains 0.02%EDTA as Digestive system.
With an application for the clone of the sick 2 type replicons of the Dengue of two reporter genes, its application process is:
The present invention selects a kind ofly known have inhibiting medicine NITD008 to detect its restraining effect to the hamster kidney continuous cell line BHK-21 that contains dengue virus replicon to flavivirus:
The hamster kidney continuous cell line BHK-21 that inoculation contains dengue virus replicon in the 12 every holes of porocyte culture plate, at 37 ℃, 5%CO
2under culture condition, in the time that degree of converging reaches 60%, add respectively and use the NITD008(concentration of the DMEM substratum serial dilution that contains 2% foetal calf serum to be respectively 0,0.11,1,3,9 and 27 μ M), in 37 ℃, 5%CO
2incubator in cultivate and inhale respectively the supernatant of abandoning in hole after 48h, and Xiang Kongzhong adds after 1ml PBS and inhales and abandon PBS in hole, and add respectively 200 μ l cell pyrolysis liquids process cell and mix the cell lysate in hole, get 20 μ l in white 96 orifice plates, and add the substrate of 50 μ l, use multi-functional microplate reader to detect the activity of Rluc according to the requirement of Luciferase Assay System specification sheets.
Above-described application process can be used for the study on mechanism of anti-DENV virus drug screening, anti-DENV virus drugs.
The present invention compared with prior art, has the following advantages and effect:
1, the present invention filters out the stable cell lines with dengue type 2 virus (DENV-2) replicon of Rluc and the two reporter genes of Neo, dengue virus replicon with Rluc and the two reporter genes of Neo can be stablized and copy in this clone, and high efficient expression Rluc and Neo.
2, in clone of the present invention, contained replicon has been deleted the genomic most of structural protein gene of dengue fever virus 2 type, only retain 38 amino acid of C albumen n end and 31 amino acid of E albumen n end, retain whole nonstructural protein genes simultaneously, do not affect viral genome copying in cell, but can not produce ripe virion, eliminate the potentially dangerous of viral diffusion.And the albumen of Rluc coding is convenient to detect virus genomic copying, the albumen of Neo genes encoding can make host cell have the ability of anti-G418 medicine.
3, suppress experiment by medicine, proves that the stable cell lines of dengue type 2 virus (DENV-2) replicon with Rluc and Neo pair of reporter genes prepared by the present invention can be used as effective medicine sorting platform.Compared with traditional drug screening method, this clone not only has obvious sensitivity and high-level efficiency, can also be used for the medicine that high flux screening action target spot is Nonstructural Protein, can carry out rapid detection to multi-medicament antiviral effect simultaneously, shortening the medicament research and development cycle, is the effective tool of the anti-DENV virus drugs of research and development specificity.
4, be used for studying corresponding flavivirus with the stable cell lines of dengue type 2 virus (DENV-2) replicon of the two reporter genes of Rluc and Neo and copy regulatory mechanism and there is clear superiority, can within longer research cycle, replicon be copied with translation skill and be detected in real time; After replicon transfectional cell, can not assemble and releasing virus particle, can get rid of the interference that virus assembly brings; The means such as the detection of object reporter gene, RT-PCR and IFA can Real-Time Monitoring replicon copy the change with translation skill.
5, with the BHK-21 cell of dengue type 2 virus (DENV-2) replicon of the two reporter genes of Rluc and Neo, dengue fever virus 2 type replicons can well copy in this cell, continuous passage 47 generation replicon stable existence in cell, indirectly weigh the genomic levels of replication of dengue fever virus by detecting the expression of Rluc in this cell, can replace loaded down with trivial details, time-consuming, the RT-PCR vitro detection of effort, this model can be used as the new cell model of high flux screening anti-dengue virus medicine.
Embodiment
Experimental technique in the present embodiment, if no special instructions, is ordinary method.What below enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to following examples, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
Embodiment 1:
With the pACYC-TSV-Rluc2A-Rep-3NTR-IR ES-Neo replicon plasmid construction of luciferase (Rluc) and neomycin phosphotransferase (Neo), the steps include:
(1) utilize and merge round pcr, derive from the DENV2 replicon pACYC-DENV2-TSV-Rluc2A-Re p(with Rluc: Development and characterization of a stable luciferase dengue virus for high-t hroughput screening[J] .Antiviral research, 2011,91 (1): 11-19.) in, build C9250G sudden change, create Nhe1 restriction enzyme site.
1. utilize Xho I and Cal I double digestion pACYC-DENV2-TSV-Rluc2A-Rep plasmid, enzyme is cut after product glue reclaims and is obtained DENV2-TSV-F gene fragment; Take DENV2-TSV-F gene fragment as template, utilize primer-Age I-F(A AAACCGGTTGAATGCATTG) and primer-Nhe I-R(GGGGCTCACAGCTAGCATAGTTTT TTCCG) pcr amplification DENV2-TSV-Age I-Nhe I gene fragment.PCR reaction system is: 5 × PS buffer (T aKaRa): 10 μ l, dNTP:2 μ l, primer primer-Age I-F (10uM) is (AAAACCGGTTGAATGCATTG): 1 μ l, primer primer-Nhe I-R (10uM) is (GGGGCTCACAGCTAGCATAGTTTTTTCCG): 1 μ l, P rimeSTAR HS enzyme (TaKaRa): 0.5 μ l, template TA-DENV2-TSV-F (15ng): 1 μ l, ddH2O:34.5 μ l, total system 50 μ l. amplification conditions are: 94 ℃ of 2min, 94 ℃ of 10s, 60 ℃ of 15s, 72 ℃ of 3min, 72 ℃ of 10min, 16 ℃ of 1min, 30 circulations.Working concentration is that 1% agarose gel electrophoresis detects PCR product, and use sepharose recovery test kit (TIANGEN Biotech (Beijing) Co., Ltd.) to reclaim respectively DNA fragmentation, use Thermo Scientific Na noDrop2000 to measure the concentration of DNA.
2. utilize primer-Nhe I-F(AAACTATGCTAGCTGTGAGCCCCGTCCAAG) and primer-Cla I-R(ACAATCGATAGACATGATAAGATAC) pcr amplification DENV2-TSV-Nhe I-Cla I gene fragment.PCR reaction system is: 5 × PS buffer (TaKaRa): 10 μ l, dNTP:2 μ l, primer primer-Nhe I-F (10uM) (A AACTATGCTAGCTGTGAGCCCCGTCCAAG): 1 μ l, primer primer-Cla I-R (10uM) (ACAA TCGATAGACATGATAAGATAC): 1 μ l, PrimeSTAR HS enzyme (TaKaRa): 0.5 μ l, template TA-DEN V2-TSV-F (15ng): 1 μ l, ddH2O:34.5 μ l, total system 50 μ l. amplification conditions are: 94 ℃ of 2min, 94 ℃ of 10s, 60 ℃ of 15s, 72 ℃ of 1min, 72 ℃ of 10min, 16 ℃ of 1min, 30 circulations.Working concentration is that 1% agarose gel electrophoresis detects PCR product, and use sepharose recovery test kit (TIANGEN Biotech (Beijing) Co., Ltd.) to reclaim respectively DNA fragmentation, use Thermo Scientific NanoDrop2000 to measure the concentration of DNA.
3. utilize primer-Age I-F(AAAACCGGTTGAATGCATTG) and primer-Cla I-R(ACAATCGA TAGACATGATAAGATAC), Age I-Nhe I gene fragment and Nhe I-Cla I gene fragment are fused to DEN V2-TSV-Age I-Cla I gene fragment; PCR reaction system is: 5 × PS buffer (TaKaRa): 10 μ l, dNTP:4 μ l, primer primer-Age I-F (10uM) is (AAAACCGGTTGAATGCATTG): 2 μ l, primer primer-Cla I-R (10uM) is (ACAATCGATAGACATGATAAGATAC): 2 μ l, PrimeSTAR HS enzyme (TaKaRa): 0.5 μ l, template DENV2-TSV-Age I-Nhe I gene fragment: 25ng, template DENV2-TSV-Nhe I-Cla I gene fragment: 50ng, ddH2O: supply 50 μ l.Amplification condition is: 98 ℃ of 2min, 98 ℃ of 15s, 55 ℃ of 15s, 72 ℃ of 3.5min, 72 ℃ of 10min, 16 ℃ of 1min, 30 circulations.Working concentration is that 1% agarose gel electrophoresis detects PCR product, and use sepharose recovery test kit (TIANGEN Biotech (Beijing) Co., Ltd.) to reclaim respectively DNA fragmentation, use Thermo Scientific NanoDrop2000 to measure the concentration of DNA.
(2) DENV2-TSV-Age I-Cla I gene fragment of utilizing restriction enzyme A ge I and Cla I double digestion to obtain, working concentration is that 1% agarose gel electrophoresis detects PCR product, and use sepharose recovery test kit (TIANGEN Biotech (Beijing) Co., Ltd.) to reclaim respectively DNA fragmentation, connect in the DENV2-TSV-F of same enzyme double digestion gene fragment called after DENV2-TSV-F-Nhe I;
(3) utilize primer Nhe I-IRES-neo-F(TATGCTAGCCCGCCCCTCTCCCTCCCCCCCC) and Nh e I-IRES-Neo-R(ACAGCTAGCTCAGAAGAACTCGTCAAGAAGG), be purchased from Clontech company of the U.S. take pLVX-IRES-Neo[] as template, pcr amplification Nhe I-IRES-Neo-Nhe I gene fragment, PCR reaction system is: 5 × PS buffer (TaKaRa): 10 μ l, dNTP:2 μ l, primer Nhe I-IRES-neo-F (10uM) (TATGCTAGC CCGCCCCTCTCCCTCCCCCCCC): 1 μ l, primer Nhe I-IRES-Neo-R (10uM) (ACAGCTAGCT CAGAAGAACTCGTCAAGAAGG): 1 μ l, prime STAR enzyme (TaKaRa): 0.5 μ l, template pLVX-IR ES-Neo (15ng): 1 μ l, ddH2O:34.5 μ l, total system 50 μ l. amplification conditions are: 94 ℃ of 2min, 94 ℃ of 10s, 60 ℃ of 15s, 72 ℃ of 1.5min, 72 ℃ of 10min, 16 ℃ of 1min, 30 circulations.Nhe I enzyme is connected in DE NV2-TSV-F-Nhe I after cutting, called after DENV2-TSV-F-Nhe I-IRES-Neo after order-checking is correct;
(4) Xho I and Cla I double digestion DENV2-TSV-F-Nhe I-IRES-Neo recombinant plasmid, the fragment of the gene containing IRSE-Neo obtaining is connected in the pACYC-DENV2-TSV-Rluc2A-Rep of same enzyme double digestion plasmid, called after pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo(Fig. 1), its sequence is shown in SEQ ID NO.1.
Embodiment 2:
PACYC-TSV-Rluc2A-Rep-3NTR-IRES-Neo replicon plasmid is successfully saved out has replication, and the replicon of the efficient expressing luciferase of energy and neomycin phosphotransferase gene, the steps include:
(1) preparation of pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo RNA:
1. the linearizing of plasmid and the extracting of phenol chloroform: respectively get 10 μ g plasmid pACYC-DENV2-TSV-Rluc2A-Rep-3N TR-IRES-Neo and plasmid pACYC-DENV2-TSV-Rluc2A-Rep, cut with Cla I enzyme, 37 ℃ of enzymes are cut two hours, after 1% agarose gel electrophoresis identifies that enzyme cuts entirely, cut and in product, add the saturated phenol of 100 μ l (purchased from chemical reagents corporation of traditional Chinese medicines group) to enzyme, vibration mixes, the centrifugal 5min of 17000g, draw supernatant liquid in new centrifuge tube, and add 100 μ l sterilized water vibrations to mix in former centrifuge tube, the centrifugal 5min of 17000g; (cumulative volume approximately 200 μ l), add 200 μ l chloroforms (purchased from chemical reagents corporation of traditional Chinese medicines group) to mix, the centrifugal 5min of 17000g to draw supernatant liquid and the merging of previous step gained liquid; (approximately 150~200 μ l) in aseptic import centrifuge tube pipe to draw supernatant liquid, add the pH5.2 of 1/10th volumes, 3mol/l sodium-acetate (purchased from chemical reagents corporation of traditional Chinese medicines group) and 2.5 times of volume dehydrated alcohols (purchased from chemical reagents corporation of traditional Chinese medicines group) mix, place 30min, the centrifugal 5min of 17000g for-20 ℃; Supernatant is abandoned in suction, adds 1ml70% washing with alcohol, and the centrifugal 5min of 17000g inhales and abandons supernatant; Room temperature is placed 15min, finally add the water dissolution of 11 μ l without RNAase, use Thermo Scientific NanoDrop2000 (already described) to measure the concentration of DNA above, use 1% agarose gel electrophoresis to detect the quality of DNA, save backup in-20 ℃.
2. the in-vitro transcription of RNA: pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo and the plasmid pACYC-DENV2-TSV-Rluc2A-Rep linearizing product of respectively getting 2.5 μ g phenol chloroform extractings are template, according to T7mMES SAGE mMACHINE kit(purchased from Ambion company of the U.S.) requirement of specification sheets is RNA by its in-vitro transcription, use Thermo Scientific NanoDrop2000 (already described) to measure the concentration of RNA above, use 1% agarose gel electrophoresis to detect the quality of RNA, the outer gained RNA of detection bodies all has after obvious master tape, save backup in-80 ℃.
(2) after transfection, Rluc is active detects:
The method that adopts electricity to turn the pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo of 5 μ g in-vitro transcription and pACYC-DENV2-TSV-Rluc2A-Rep RNA proceeds to respectively 0.8ml BHK-21 cell and (contains 8 × 10
6individual cell), after transfection, inoculate 2 × 10
5this cell is in 6 orifice plates, after transfection 2, 6, 12, 24, 36, 48, 60, 72 and when 96h, supernatant substratum is abandoned in suction, every hole adds 1ml PBS to wash after one time, PBS in hole is abandoned in suction, and add respectively 200 μ l cell pyrolysis liquids to process cell, mix respectively the cell lysate in hole, get 20 μ l in white 96 orifice plates, and add the substrate coelenterazine (coelenterazine) of 50 μ l, being purchased from Promega company according to Luciferase Assay System() requirement of specification sheets uses multi-functional microplate reader (be purchased from German Thermo company) to detect the activity (Fig. 2 A) of Rluc.Known from Fig. 2 A, transfection the BHK-21 cell of DENV2-TSV-Rluc2A-Rep RNA, the time point that Rluc signal value raises is early than the BHK-21 cell that contains DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo, the peak value reaching the former also higher than the latter, show that the reproduction speed in BHK-21 is slower than DENV2-TSV-Rluc2A-Rep after DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo transfection.Concrete uciferase activity value is as shown in the table:
(3) after transfection, replicon copies situation detection:
Inoculation 2 × 10
5transfection the BHK-21 cell of pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo and pACYC-DENV2-TSV-Rluc2A-Rep RNA placed in 6 orifice plates of three 10mm × 10mm cover glasses in every hole, respectively at after transfection 24, 48, after 72h with acetone stationary liquid (being purchased from chemical reagents corporation of traditional Chinese medicines group) room temperature fixed cell 15 minutes, PBS washes after three times, hatch primary antibodie in room temperature environment, antibody be 1:250 doubly dilute for Flavivirus NS5 albumen mouse monoclonal antibody (being purchased from Millipore company of the U.S.), primary antibodie is hatched 1~2h, PBS rinses after 10 times, hatching two in room temperature lucifuge resists, antibody is coupling texas Red (Texs-Red) sheep anti-mouse antibody that 1:125 doubly dilutes.Hatch after two anti-1h, PBS rinses 10 times, uses 200 × magnification to observe (Fig. 2 B) under fluorescent microscope.Known from Fig. 2 B, transfection the BHK-21 cell of DENV2-TSV-Rluc2A-Rep RNA be transfection after 24h NS5 albumen can be detected, 48h NS5 expressing quantity peaks, and then declines; And transfection BHK-21 cell 48h after transfection of DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo RNA just detect and the expression of NS5 albumen show that the reproduction speed of this replicon is slower than DENV2-TSV-Rluc2A-Rep.
Embodiment 3:
With a clone for the dengue type 2 virus replicon of two reporter genes, its screening process is as follows:
(1) determining of microbiotic G418 screening clone optimum concn:
In each hole of 24 porocyte culture plates, inoculate respectively 2 × 10
4individual BHK-21 cell, after 24 hours, inhales the substratum of abandoning in hole, and the DMEM substratum (purchased from Gibco company of the U.S.) that access contains 10%FBS with 0.5ml adds G418 respectively simultaneously in each hole, and final concentration is respectively 0, 200, 400, 600, 700, 800 and 1000 μ g/ml, two repetitions of each concentration, in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate, inhale the substratum of abandoning in hole after 72h, the DMEM substratum (purchased from Gibco company of the U.S.) that access contains 10%FBS with 0.5ml adds G418 respectively simultaneously in each hole, and final concentration is respectively 0, 200, 400, 600, 700, 800 and 1000 μ g/ml, two repetitions of each concentration, in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate, inhale the substratum of abandoning in hole after 72h, the DMEM substratum (purchased from Gibco company of the U.S.) that access contains 10%FBS with 0.5ml adds G418 respectively simultaneously in each hole, and final concentration is respectively 0, 200, 400, 600, 700, 800 and 1000 μ g/ml, two repetitions of each concentration, in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate the state of observation of cell after 72h, so all death of cell in two holes that in the 12 each holes of orifice plate cell, cell state G418 concentration is 700ug/ml is observed in screening for about 10 days, thereby select to be used for than the 800ug/ml of its high concentration gradient the best working concentration of G418 of follow-up cell line selection, 400ug/ml is that clone maintains concentration while going down to posterity.
(2) preparation of pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo RNA:
Cut pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo with Cla I enzyme and carry out linearization process, linearizing product is after the extracting of phenol chloroform, take it as template, use in-vitro transcription test kit T7mMESSAGE mMACHIN E kit(purchased from Ambion company of the U.S.), carry out in-vitro transcription according to test kit explanation and obtain the DENV-2 replicon rna with Rluc and Neo gene.
(3) transfection BHK-21 cell:
The method that adopts electricity to turn the RNA of the pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo of 5 μ g in-vitro transcription proceeds to 0.8ml BHK-21 cell and (contains 8 × 10
6individual cell), then the DMEM substratum (purchased from Gibco company of the U.S.) that adds 20ml to contain 10%FBS, mix cell, then respectively according to 1:3, 1:5, 1:10, the ratio of 1:30 and 1:50 is diluted the BHK-21 cell turning through electricity, final each dilution final volume is 10ml, and proceeded to the Tissue Culture Dish of 10cm, in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate and inhale the substratum of abandoning in hole after 24h, wash 3 times with PBS, each 6ml, wash rear suction and abandon the PBS in hole, and add the DMEM(of the G418 that 10ml contains best working concentration to contain 10%FBS), after 72h, inhale and abandon substratum in hole, and add the DMEM(of the G418 that 10ml contains best working concentration to contain 10%FBS), after 72h, inhale and abandon substratum in hole, and add the DMEM(of the G418 that 10ml contains best working concentration to contain 10%FBS), after 72h, inhale and abandon substratum in hole, and add the DMEM(of the G418 that 10ml contains best working concentration to contain 10%FBS).Use the state of microscope observing cell every day, in the time that cell becomes mono-clonal, adopt the monoclonal method of picking to carry out enlarged culturing.
(4) picking mono-clonal:
Get filter paper (Sigma#F37847-0001) a slice with tweezers, be immersed in pancreatin, 2min, inhale the substratum of abandoning in 10cm culture dish simultaneously, add 6ml PBS, inclination culture dish, mono-clonal that only will picking exposes, other cellular infiltrations are in PBS, with tweezers, filter paper taken out from pancreatin and be placed on single cell clone, after 3min, with tweezers, filter paper is placed on and contains the G418 that 1ml DMEM(contains 10%FBS and optimum concn) in the hole of 12 orifice plates, after 72h, inhale the substratum of abandoning in hole, and add the DMEM(of the G418 that 1ml contains best working concentration to contain 10%FBS).Every day observation of cell state, changed liquid dosing every 3 days the 4th day.When treating that Growth of Cells reaches at the bottom of hole 50% left and right, the substratum in hole is abandoned in suction, wash 1 time with 1ml PBS, wash rear suction and abandon the PBS in hole, add 200 μ l pancreatin, after 1min, inhale and abandon pancreatin, and the DMEM(that adds the G418 that 1ml contains best working concentration contains 10%FBS), then it is all proceeded in the Tissue Culture Dish of 3.5cm, and the DMEM(that adds the G418 that 1ml contains best working concentration contains 10%FBS), in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate, after 72h, inhale the substratum of abandoning in hole, and add the DMEM(of the G418 that 2ml contains best working concentration to contain 10%FBS).Every day observation of cell state, changed liquid dosing (Fig. 3 A) every 3 days the 4th day.
(5) enlarged culturing: when treating that Growth of Cells reaches at the bottom of hole 60% left and right, the substratum in hole is abandoned in suction, wash 1 time with 1ml PBS, wash rear suction and abandon the PBS in hole, add 200 μ l pancreatin, after 1min, inhale and abandon pancreatin, and the DMEM(that adds the G418 that 1ml contains best working concentration contains 10%FBS), then it is all proceeded in T25 Tissue Culture Flask, and the DMEM(that adds the G418 that 5ml contains best working concentration contains 10%FBS), in 37 ℃, 5%(v/v) cultivate in the incubator of CO2, and every day observation of cell state, changed liquid every 3 days the 4th day.Treat Growth of Cells reach bottle at the bottom of when 60% left and right, the substratum in hole is abandoned in suction, washes 1 time with 5ml PBS, washes rear suction and abandons the PBS in hole, add 500 μ l pancreatin, after 3min, inhales and abandon pancreatin, and the DMEM(that adds the G418 that 5ml contains best working concentration contains 10%FBS), then proceed in T25 Tissue Culture Flask according to the ratio of 1:2, in 37 ℃, 5%(v/v) in the incubator of CO2, cultivate, and every day observation of cell state, changed liquid every 3 days the 4th day.Sieve wherein a strain cell reach after the 4th generation, its Rluc fluorescent value tend towards stability (Fig. 3 C).
In addition, when going down to posterity, get 100 μ l enchylema (approximately containing 1 × 10 at every turn
4individual cell), 4 ℃ of centrifugal 5min, abandon supernatant, add 100 μ l PBS, mix rear 4 ℃ of centrifugal 5min, add after cell pyrolysis liquid 60 μ l-80 ℃ of preservations; The RNA of extracting BHK-21 simultaneously after at every turn going down to posterity ,-80 ℃ of preservations.
Carry out altogether in this manner going down to posterity for 25 times, finishing screen is selected the stable cell lines of the sick 2 type replicons of a kind of Dengue with two reporter genes, in the 26th generation of this clone, has been delivered to the center preservation of Chinese Typical Representative culture collection on December 20th, 2011, Classification And Nomenclature: the hamster kidney continuous cell line BHK-21BHK-21/pACYC-TSV-Rl uc2A-Rep-3NTR-IRES-Neo that contains dengue virus replicon, CCTCC NO:C2011124, address: Wuhan, China Wuhan University.
The genetic stability checking of the hamster kidney continuous cell line BHK-21 that contains dengue virus replicon:
(1) RT-PCR amplification: adopt RT-PCR test kit (purchased from Takara company), carry out RT-PCR amplification specific gene.PCR instrument is the MyCycler Thermal cycler of Biorad company, and the primer is synthetic by Shanghai Ying Jun Bioisystech Co., Ltd.The reaction system of RT-PCR is: PrimeScript1Step Enzyme Mix:2 μ l, 2 × 1Step Buff er:25 μ l, primer (5 '-GTCATAGCCATCCTTACAGTGG-3 '): 1 μ l, primer (5 '-GGTCCTCC TTTTGTTAGGCCTTTG-3 '): 1 μ l, template ribonucleic acid is: 3 μ l, and without RNase water: 18 μ l.Amplification condition is: 50 ℃ of 30min, 94 ℃ of 2min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5min, 72 ℃ of 10min, 16 ℃ of 10min, 28 circulations.The product of RT-PCR is used to 1% agarose gel electrophoresis, find all can amplify the band of big or small about 1.4kb, this clone continuous passage 25 times very stable (Fig. 3 B) is described.
(2) detection of Rluc: get respectively the cell pyrolysis liquid 20 μ l of the the the 5th, 10,20,25,47 generations in white 96 orifice plates, and add the substrate of 100 μ l, use the multi-functional activity of reading plate instrument and detect Rluc according to the requirement of Luciferase Assay System specification sheets.Detect and find by the activity to Rluc, the hamster kidney continuous cell line BHK-21Rluc signal value that contains dengue virus replicon the the 5th, 10,20,25 until between 47 generations without significant difference, very stable, show this clone continuous passage very stable (Fig. 3 C).To the applying date, clone of the present invention reached for 47 generations, and uciferase activity value is 7.56lg, with the 7.41lg in P5 generation without significant difference.Concrete uciferase activity value is as shown in the table:
Passage number of times | Mock | |
5 |
10 |
20 |
25 |
47 |
Uciferase activity (log number of photons) |
0.430 |
7.41 |
7.72 |
7.43 |
7.64 |
7.56 |
(3) hamster kidney continuous cell line BHK-214 × 10 that inoculation the 25th generation contains dengue virus replicon
5place in 6 orifice plates of three 10mm × 10mm cover glasses in every hole, acetone stationary liquid (being purchased from chemical reagents corporation of traditional Chinese medicines group) room temperature fixed cell 15 minutes for 24h after inoculation, PBS washes after three times, hatch primary antibodie in room temperature environment, antibody be 1:250 doubly dilute for Flavivirus NS5 albumen mouse monoclonal antibody (being purchased from Millipore company of the U.S.), primary antibodie is hatched 1~2h, PBS rinses after 10 times, hatching two in room temperature lucifuge resists, antibody is coupling texas Red (Te xs-Red) sheep anti-mouse antibody that 1:125 doubly dilutes, hatch after two anti-1h, PBS rinses 10 times, finally be purchased from Wuhan Boster Biological Technology Co., Ltd. with DAPI(), under fluorescent microscope, use 200 × magnification to observe (Fig. 3 D).Known from Fig. 3 D, this clone passes 25 generations, the expression of NS5 albumen still can be detected, goes down to posterity very stable with the cell line cell of the sick 2 type replicons of the Dengue of two reporter genes.When described clone reached for 47 generation, immunofluorescence detects still stably express of NS5 albumen.
Embodiment 4:
The application of the hamster kidney continuous cell line BHK-21 that contains dengue virus replicon in anti-DENV virus drug screening, the steps include:
The present invention selects a kind ofly known DENV virus (1-4 type) is had to inhibiting medicine NITD008(An ade nosine nucleoside inhibitor of dengue virus[J] .Proceedings of the National Academy of Sc iences, 2009,106 (48): 20435-20439.) detect the restraining effect of this medicine to the hamster kidney continuous cell line BHK-21 that contains dengue virus replicon:
The hamster kidney continuous cell line BHK-21 that inoculation contains dengue virus replicon in the 12 every holes of porocyte culture plate, at 37 ℃, 5%CO
2under culture condition, in the time that degree of converging reaches 60%, add respectively and use the NITD008(concentration of the DMEM substratum serial dilution that contains 2% foetal calf serum to be respectively 0,0.11,1,3,9 and 27 μ M), in 37 ℃, 5%CO
2incubator in cultivate and inhale respectively the supernatant of abandoning in hole after 48h, and Xiang Kongzhong adds after 1ml PBS and inhales and abandon PBS in hole, and add respectively 200 μ l cell pyrolysis liquids process cell and mix the cell lysate in hole, get 20 μ l in white 96 orifice plates, and add the substrate of 50 μ l, and according to already described before Luciferase Assay System() requirement of specification sheets uses multi-functional microplate reader (already described) to detect the activity (Fig. 4) of Rluc above.Activity by Rluc detects to be found, along with the increase of NI TD008 concentration, Rluc signal value weakens gradually, shows that in hamster kidney continuous cell line BHK-21 that NITD008 suppresses to contain dengue virus replicon, copying of replicon presents concentration dependent.Therefore, can be used for the screening of anti-dengue virus medicine.Concrete uciferase activity value is as shown in the table:
NITD008 concentration (μ M) |
0 |
0.11 |
1 |
3 |
9 |
27 |
Uciferase activity (log number of photons) |
6.92 |
6.91 |
6.63 |
5.76 |
4.90 |
4.33 |
SEQUENCE LISTING
<110> Wuhan Virology Institute,Chinan academy of Sciences
<120> clone and application with a dengue type 2 virus replicon for two reporter genes
<130> clone and application with a dengue type 2 virus replicon for two reporter genes
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 14692
<212> DNA
<213> artificial sequence
<400> 1
gctagctaat acgactcact atagagttgt tagtctacgt ggaccgacaa agacagattc 60
tttgagggag ctaagcttaa cgtagttcta acagtttttt aattagagag cagatctctg 120
atgaataacc aacggaaaaa ggcgagaaat acgcctttca atatgctgaa acgcgagaga 180
aaccgcgtgt caactgtgca gcagctgaca aagagattct cacttggaat gctaatggct 240
tccaaggtgt acgaccccga gcaacgcaaa cgcatgatca ctgggcctca gtggtgggct 300
cgctgcaagc aaatgaacgt gctggactcc ttcatcaact actatgattc cgagaagcac 360
gccgagaacg ccgtgatttt tctgcatggt aacgctgcct ccagctacct gtggaggcac 420
gtcgtgcctc acatcgagcc cgtggctaga tgcatcatcc ctgatctgat cggaatgggt 480
aagtccggca agagcgggaa tggctcatat cgcctcctgg atcactacaa gtacctcacc 540
gcttggttcg agctgctgaa ccttccaaag aaaatcatct ttgtgggcca cgactggggg 600
gcttgtctgg cctttcacta ctcctacgag caccaagaca agatcaaggc catcgtccat 660
gctgagagtg tcgtggacgt gatcgagtcc tgggacgagt ggcctgacat cgaggaggat 720
atcgccctga tcaagagcga agagggcgag aaaatggtgc ttgagaataa cttcttcgtc 780
gagaccatgc tcccaagcaa gatcatgcgg aaactggagc ctgaggagtt cgctgcctac 840
ctggagccat tcaaggagaa gggcgaggtt agacggccta ccctctcctg gcctcgcgag 900
atccctctcg ttaagggagg caagcccgac gtcgtccaga ttgtccgcaa ctacaacgcc 960
taccttcggg ccagcgacga tctgcctaag atgttcatcg agtccgaccc tgggttcttt 1020
tccaacgcta ttgtcgaggg agctaagaag ttccctaaca ccgagttcgt gaaggtgaag 1080
ggcctccact tcagccagga ggacgctcca gatgaaatgg gtaagtacat caagagcttc 1140
gtggagcgcg tgctgaagaa cgagcagcgt acgcagctgt tgaattttga ccttctcaag 1200
ctggcgggag acgtcgagtc caaccctggg ccatggatag gaatgaattc acgcagcacc 1260
tcactgtctg tgtcactagt attagtgggg gtcgtgacat tatatttggg agttatggtg 1320
caggccgata gtggctgcgt tgtgagttgg aaaaacaaag aactgaaatg tggcagtggg 1380
atttttatca cagacaacgt gcacacatgg acagaacaat acaaattcca accagaatcc 1440
ccttcaaagc tggcttcagc tatccagaag gctcatgaag agggcatttg tggaatccgc 1500
tcagtaacaa gactggagaa tctgatgtgg aaacaaataa caccagaact gaatcacatt 1560
ctatcagaaa atgaggtaaa gttgactatc atgacaggag acattaaagg aatcatgcag 1620
gcaggaaaac gatccctgcg gcctcaaccc actgagctga agtactcttg gaaagcatgg 1680
ggcaaagcga aaatgctctc cacagagctt cataaccaca cctttctcat tgatggcccc 1740
gaaacagcag aatgtcccaa cacaaacaga gcttggaact cactagaagt tgaagactat 1800
ggctttggag tattcaccac caacatatgg ctgaaattga aagaaaggca ggatgtattt 1860
tgtgactcaa aactcatgtc agcagccata aaagacaaca gagccgtcca cgccgatatg 1920
ggttattgga tagaaagcgc actcaatgac acatggaaga ttgagaaagc ctcttttatt 1980
gaagttaaaa gctgccactg gccaaagtca cacactctct ggagtaatgg agtgctagaa 2040
agtgagatga taattccaaa gaattttgca ggaccagtgt cacaacacaa ttacagacca 2100
ggctatcata cacaaacggc aggaccctgg catctaggta ggcttgagat ggactttgat 2160
ttctgcgaag gaaccacagt ggtagtgact gaggactgtg gaaacagagg accctcttta 2220
agaacaacta ctgcttctgg aaaactcata acagaatggt gctgccgatc ctgcacatta 2280
ccaccgctaa ggtacagagg tgaggatgga tgctggtatg gaatggaaat cagaccattg 2340
aaagagaaag aagagaactt ggtcaactct ttggtcacag ccggacatgg acagattgac 2400
aacttctcac taggagtctt gggaatggca ttgttcctgg aagagatgct caggacccga 2460
gtaggaacga aacatgcaat attactagtt gcagtttctt tcgtgacatt gatcacaggg 2520
aacatgtcct ttcgagattt ggggagagtg atggtcatgg tgggcgctac tatgacggat 2580
gacataggca tgggcgtgac ttatctcgcc ctattagcag ccttcaaagt cagaccaact 2640
ttcgcagctg gactactctt aagaaagctg acctccaagg aattgatgat gaccaccata 2700
ggaatcgtac tcctctctca gagcaccata ccagagacta tacttgaact gactgacgcg 2760
ttggctttgg ggatgatggt tctcaaaata gtgagaaaca tggaaaagta tcaactagca 2820
gtgactatca tggccatctt gtgcgtccca aatgcagtga tattacaaaa cgcatggaaa 2880
gtgagctgca caacactggc agtggtgtcc gtttccccac tgcttttaac atcctcacag 2940
cagaaagcgg attggatacc actggcgttg acgatcaaag gcctcaatcc aacagccatt 3000
ttcttaacaa ccctctcaag aactagcaag aaaaggagct ggccactaaa tgaggctatt 3060
atggcagtcg ggatggtgag cattttagcc agttctctct taaagaatga tattcccatg 3120
acaggaccat tagtggctgg agggcttctc actgtgtgtt acgtgctcac tggaagatcg 3180
gctgatttgg aactggagag agctgctgac gtaagatggg aagaacaggc agagatatca 3240
ggaagtagtc caattctgtc aataacaata tcggaagatg gtagcatgtc gataaaaaat 3300
gaagaagaag aacaaacact gaccatactc attagaacag gactgctggt gatatcagga 3360
ctttttcccg cgtcaatacc aatcacggca gctgcatggt acctgtggga agtgaaaaaa 3420
caacgagccg gagtattgtg ggatgtccct tcacccccac ctgtgggaaa ggccgaactg 3480
gaagatggag cctatagaat caagcagaaa gggattctag gatactcgca gatcggagcc 3540
ggagtttaca aagaaggaac attccacaca atgtggcatg tcacacgtgg tgctgtccta 3600
atgcataaag ggaagagaat tgaaccatca tgggcggacg tcaagaaaga cctaatatcg 3660
tatggaggag gctggaagct agaaggagaa tggaaggaag gagaagaagt ccaggtcctg 3720
gcattagagc ctggaaagaa tccaagagcc gtccaaacaa aacccggtct ttttaaaact 3780
aacactggaa ccataggcgc cgtatctctg gacttctctc ctggaacgtc aggatctcca 3840
attgtcgaca aaaaaggaaa agttgtgggc ctttatggca acggtgtcgt cacaaggagt 3900
ggagcatatg tgagtgccat agcccagact gaaaaaagca tcgaagacaa tccagagatt 3960
gaagatgaca tctttcgaaa gaaaagattg accatcatgg acctccaccc aggagcggga 4020
aaaacaaaga gataccttcc agcaatagtt agagaagcca taaaacgagg cttgagaaca 4080
ctaatcctgg cccccactag agttgtggcg gctgaaatgg aagaagctct cagaggactt 4140
ccaataagat accaaacccc agctatcaga gctgagcaca ctgggcggga gattgtggat 4200
ctaatgtgtc acgccacatt taccatgagg ctgctatcac caattagagt gccaaattac 4260
aacctgatca tcatggatga agcccatttc acagacccag caagcatagc agctagagga 4320
tacatttcaa ctcgagtaga gatgggtgaa gcagctggga ttttcatgac agctactcct 4380
cctggaagca gagacccatt tcctcagagc aatgcaccaa tcatggatga agaaagggaa 4440
atccctgagc gttcgtggaa ctctggacat gagtgggtta cggattttaa agggaagact 4500
gtttggtttg ttccaagtat aaaagcagga aatgatatag cagcttgcct gagaaagaat 4560
ggaaagaaag tgatacaact cagcaggaag acctttgatt ctgaatatat caagactagg 4620
accaatgatt gggactttgt ggtcacgaca gacatttcag aaatgggtgc taacttcaag 4680
gctgagaggg ttatagaccc cagacgctgc atgaaaccag tcatactaac tgacggtgaa 4740
gagcgggtga tcttggcagg acccatgcca gtgacccact ctagtgcagc acaaagaaga 4800
gggagagtag gaagaaatcc aaaaaatgaa aatgaccagt acatatacat gggggaacct 4860
ctggaaaatg atgaagactg tgcacactgg aaagaagcta agatgcttct agataacatc 4920
aacacgcctg aaggaatcat tcccagcatg ttcgaaccag agcgtgaaaa ggtggatgcc 4980
attgatggtg aataccgctt gagaggagaa gcgaggaaaa cttttgtgga cctaatgaga 5040
agaggagacc taccagtctg gctagcctac agagtggctg ctgaaggtat caactacgca 5100
gacagaagat ggtgctttga tggagtcaag aacaaccaaa tcttggaaga aaatgtggaa 5160
gtggaaattt ggacaaaaga aggagaaagg aagaaattaa aacccagatg gttggatgcc 5220
aggatctact ctgacccact ggcgctcaaa gaattcaagg aattcgcagc tggaagaaag 5280
tccctgactc tgaatctaat cacagagatg ggtaggctcc caaccttcat gacccagaaa 5340
gcaaggaatg cactggacaa cttagcagtc ctgcatacgg ctgaagcagg cggaagggcg 5400
tacaatcatg ctcttagtga actgccggag accctggaga cattgctttt actgacactt 5460
ttggccacag tcacgggcgg aatcttcctg ttcttgatga gcggaaaggg tatagggaag 5520
atgaccctgg gaatgtgctg cataatcacg gccagtattc tcctatggta tgcacaaata 5580
cagccacact ggatagcagc ctcaataata ctggagtttt ttctcatagt cttgctcatt 5640
ccagaaccag aaaagcagag aacaccccaa gataaccaat taacttatgt tgtcatagcc 5700
atccttacag tggtggccgc aaccatggca aacgagatgg gtttcctgga aaaaacaaag 5760
aaagatttcg gattgggaag cattgcaacc cagcaacctg agagcaacat cctggacata 5820
gatctacgtc ctgcatcagc ttggactcta tatgccgtgg caacaacttt catcacacca 5880
atgttgagac atagcattga aaattcctca gtgaatgtgt ctctaacagc cattgccaac 5940
caagccacag tgttaatggg tcttgggaaa ggatggccat tgtcaaaaat ggacatcgga 6000
gttccccttc tcgctatcgg gtgctattca caagtcaacc ccataactct cacggcagcc 6060
cttctcttat tggtagcaca ttatgctatc atagggccag gactccaagc gaaagcaact 6120
agagaggctc agaaaagagc agcagcgggc atcatgaaaa acccaactgt ggatggaata 6180
acagtgattg acctagatcc aataccctat gatccaaagt ttgaaaagca gttgggacaa 6240
gtaatgctct tagtcctctg cgtgacccaa gtattgatga tgaggactac atgggcttta 6300
tgtgaagctc taaccttagc gaccgggccc atctctacac tgtgggaagg aaatccaggg 6360
agattttgga atacaactat tgcagtgtca atggctaaca tttttagagg gagttacctg 6420
gccggagccg gacttctctt ttctatcatg aagaacacgg ccaacacaag aaggggaact 6480
ggcaacacag gagagacgct tggagagaaa tggaaaaacc ggttgaatgc attggggaag 6540
agtgaattcc agatctataa gaaaagtgga atccaggaag tggatagaac cttagcaaaa 6600
gaaggcatca aaagaggaga aacggaccat cacgctgtgt cgcgaggctc ggcgaaactg 6660
agatggttcg tcgagagaaa cctggtcaca ccagaaggga aagtagtgga ccttggctgc 6720
ggcagggggg gctggtcata ctattgtggg ggactaaaga atgtaaaaga agtcaaaggc 6780
ctaacaaaag gaggaccagg acacgaagaa cccattccca tgtcaacata tggttggaat 6840
ctggtgcgtc ttcaaagtgg agttgatgtt ttttttactc cgccagaaaa gtgtgacaca 6900
ttactgtgtg acatagggga gtcgtcacca aaccccacgg ttgaggcagg acgaacactc 6960
agagttctaa acttagtgga aaattggctg aacaacaaca cccaattttg cataaaggtt 7020
ctcaacccat atatgccctc agttatagaa aaaatggaag cgctacaaag gaaatacgga 7080
ggagctttgg tgaggaatcc actctcacga aattccacac acgagatgta ctgggtatcc 7140
aatgcttccg ggaacatagt gtcatcagtg aacatgattt caagaatgtt gattaacaga 7200
ttcacaatga gacataagaa ggccacatac gagccagatg ttgacctcgg aagcggaacc 7260
cgcaacatcg gaattgaaag tgagacacca aatttagaca taattgggaa aagaatagag 7320
aaaataaaac aagagcatga aacatcatgg cactatgacc aagaccaccc atacaaaacg 7380
tgggcctacc atggcagcta cgaaacaaaa cagactggat cagcatcatc catggtgaac 7440
ggagtggtta ggctgctaac aaaaccttgg gacatcatcc ctatggtgac acagatggca 7500
atgacagaca cgactccatt tgggcaacag cgcgttttca aagagaaagt ggacacgaga 7560
acccaagaac cgaaagaagg cacgaaaaaa ctaatgaaaa tcacggcaga atggctctgg 7620
aaagaactag gaaagaaaaa gacacctagg atgtgcacca gagaagaatt cacaagaaag 7680
gtgagaagca atgcagcctt aggtgccata ttcactgatg agaacaagtg gaagtcggca 7740
cgtgaggctg ttgaagatag tggattttgg gaattggttg acaaggaaag gaatctccat 7800
cttgaaggaa agtgtgagac atgtgtgtat aacatgatgg gaaagagaga gaagaagcta 7860
ggggagttcg gcaaagcaaa aggcagcaga gccatatggt acatgtggct tggagcacgc 7920
ttcttagagt ttgaagccct aggattcttg aatgaagatc actggttttc cagagagaac 7980
tccctgagtg gagtggaagg agaagggctg cacaaactag gctacatttt aagagacgtg 8040
agtaagaaag aaggaggagc aatgtacgcc gatgacaccg caggatggga cacaagaatc 8100
acactagagg acttaaaaaa tgaagaaatg gtgacaaacc acatggaagg agaacacaag 8160
aaacttgctg aagccatttt caaattaacg taccaaaaca aggtggtgcg tgtgcaaaga 8220
ccaacaccaa gaggcacagt aatggacatt atatcgagaa gagaccaaag aggtagtgga 8280
caagttgtca cctacggcct caatactttc accaacatgg aagcccaact gatcagacag 8340
atggagggag aaggagtctt caaaagcatc cagcacctga cagtcacaga agaaattgca 8400
gtgaaaaact ggttagtaag agtggggcgt gagaggttat caagaatggc catcagtgga 8460
gatgattgtg ttgtgaaacc cttagatgac aggtttgcaa gcgctctaac agctctaaat 8520
gacatgggaa aggttaggaa agacatacaa caatgggaac cttcaagagg atggaacgat 8580
tggacacaag tgcccttttg ttcacaccat ttccatgagt taatcatgaa ggacggtcgt 8640
gtactcgtag ttccatgtag aaaccaagat gaactgattg gtagggcccg aatttcccag 8700
ggagccgggt ggtccttgcg ggaaacagcc tgtttgggga agtcttacgc ccaaatgtgg 8760
agcctgatgt acttccacag acgtgacctt aggctggcgg caaatgccat ttgctcggca 8820
gtcccatcac attgggttcc aacaagtcga acaacctggt ccatacacgc cacacatgag 8880
tggatgacaa cagaagacat gctgacagtc tggaacaggg tgtggattca agaaaaccca 8940
tggatggaag acaaaactcc agtagaatca tgggaggaaa tcccatattt ggggaaaaga 9000
gaagaccaat ggtgcggctc attgattggg ctaacaagca gggccacctg ggcaaagaac 9060
atccaaacag caataaatca agttagatcc ctaataggca atgaggaata cacagactac 9120
atgccatcca tgaaaagatt cagaagagaa gaggaagagg caggagtctt gtggtagaaa 9180
gcaggaacat catgagacaa agtcagaagt caggtcggat taagccatag tacggaaaaa 9240
actatgctag cccgcccctc tccctccccc ccccctaacg ttactggccg aagccgcttg 9300
gaataaggcc ggtgtgcgtt tgtctatatg ttattttcca ccatattgcc gtcttttggc 9360
aatgtgaggg cccggaaacc tggccctgtc ttcttgacga gcattcctag gggtctttcc 9420
cctctcgcca aaggaatgca aggtctgttg aatgtcgtga aggaagcagt tcctctggaa 9480
gcttcttgaa gacaaacaac gtctgtagcg accctttgca ggcagcggaa ccccccacct 9540
ggcgacaggt gcctctgcgg ccaaaagcca cgtgtataag atacacctgc aaaggcggca 9600
caaccccagt gccacgttgt gagttggata gttgtggaaa gagtcaaatg gctctcctca 9660
agcgtattca acaaggggct gaaggatgcc cagaaggtac cccattgtat gggatctgat 9720
ctggggcctc ggtacacatg ctttacatgt gtttagtcga ggttaaaaaa acgtctaggc 9780
cccccgaacc acggggacgt ggttttcctt tgaaaaacac gatgataata ccatgattga 9840
acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga 9900
ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg 9960
gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaggacga 10020
ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt 10080
tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct 10140
gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct 10200
gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg 10260
agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca 10320
ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg acggcgagga 10380
tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt 10440
ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt 10500
ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct 10560
ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt 10620
cttctgagct agctgtgagc cccgtccaag gacgttaaaa gaagtcaggc cactacaagt 10680
gccatagctt gagtaaacta tgcagcctgt agcttcacct gagaaggtgt aaaaaatctg 10740
ggaggccaca aaccatggaa gctgtacgca tggcgtagtg gactagcggt tagaggagac 10800
ccctccctta caaatcgcag caacaatggg ggcccaaggt gagatgaagc tgtagtctca 10860
ctgaaaggac tagaggttag aggagacccc cccgaaataa aaaacagcat attgacgctg 10920
ggaaagacca gagatcctgc tgtctcctca gcatcattcc aggcacagaa cgccagaaaa 10980
tggaatggtg ctgttgaatc aacaggttct gggtcggcat ggcatctcca cctcctcgcg 11040
gtccgacctg ggctacttcg gtaggctaag ggagaagaac ttgtttattg cagcttataa 11100
tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 11160
ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctatc gattgtatgg 11220
gaagcccgat gcgccagagt tgtttctgaa acatggcaaa ggtagcgttg ccaatgatgt 11280
tacagatgag atggtcagac taaactggct gacggaattt atgcctcttc cgaccatcaa 11340
gcattttatc cgtactcctg atgatgcatg gttactcacc actgcgatcc ccgggaaaac 11400
agcattccag gtattagaag aatatcctga ttcaggtgaa aatattgttg atgcgctggc 11460
agtgttcctg cgccggttgc attcgattcc tgtttgtaat tgtcctttta acagcgatcg 11520
cgtatttcgt ctcgctcagg cgcaatcacg aatgaataac ggtttggttg atgcgagtga 11580
ttttgatgac gagcgtaatg gctggcctgt tgaacaagtc tggaaagaaa tgcataagct 11640
tttgccattc tcaccggatt cagtcgtcac tcatggtgat ttctcacttg ataaccttat 11700
ttttgacgag gggaaattaa taggttgtat tgatgttgga cgagtcggaa tcgcagaccg 11760
ataccaggat cttgccatcc tatggaactg cctcggtgag ttttctcctt cattacagaa 11820
acggcttttt caaaaatatg gtattgataa tcctgatatg aataaattgc agtttcattt 11880
gatgctcgat gagtttttct aatcagaatt ggttaattgg ttgtaacact ggcagagcat 11940
tacgctgact tgacgggacg gcggctttgt tgaataaatc gaacttttgc tgagttgaag 12000
gatcagatca cgcatcttcc cgacaacgca gaccgttccg tggcaaagca aaagttcaaa 12060
atcaccaact ggtccaccta caacaaagct ctcatcaacc gtggctccct cactttctgg 12120
ctggatgatg gggcgattca ggcctggtat gagtcagcaa caccttcttc acgaggcaga 12180
cctcagcgct caaagatgca ggggtaaaag ctaaccgcat ctttaccgac aaggcatccg 12240
gcagttcaac agatcgggaa gggctggatt tgctgaggat gaaggtggag gaaggtgatg 12300
tcattctggt gaagaagctc gaccgtcttg gccgcgacac cgccgacatg atccaactga 12360
taaaagagtt tgatgctcag ggtgtagcgg ttcggtttat tgacgacggg atcagtaccg 12420
acggtgatat ggggcaaatg gtggtcacca tcctgtcggc tgtggcacag gctgaacgcc 12480
ggaggatcct agagcgcacg aatgagggcc gacaggaagc aaagctgaaa ggaatcaaat 12540
ttggccgcag gcgtaccgtg gacaggaacg tcgtgctgac gcttcatcag aagggcactg 12600
gtgcaacgga aattgctcat cagctcagta ttgcccgctc cacggtttat aaaattcttg 12660
aagacgaaag ggcctcgtga tacgcctatt tttataggtt aatgtcatga taataatggt 12720
ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt 12780
tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca 12840
ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt 12900
ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga 12960
tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa 13020
gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct 13080
gctatgtggc gcggtattat cccgtgttga cgccgggcaa gagcaactcg gtcgccgcat 13140
acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga 13200
tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc 13260
caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat 13320
gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa 13380
cgacgagcgt gacaccacga tgcctgcagc aatggcaaca acgttgcgca aactattaac 13440
tggcgaacta cttactctag cttcccggca acaattaata gactggatgg aggcggataa 13500
agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc 13560
tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc 13620
ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag 13680
acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag accaagttta 13740
ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa 13800
gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc 13860
gtcagacccc ttaataagat gatcttcttg agatcgtttt ggtctgcgcg taatctcttg 13920
ctctgaaaac gaaaaaaccg ccttgcaggg cggtttttcg aaggttctct gagctaccaa 13980
ctctttgaac cgaggtaact ggcttggagg agcgcagtca ccaaaacttg tcctttcagt 14040
ttagccttaa ccggcgcatg acttcaagac taactcctct aaatcaatta ccagtggctg 14100
ctgccagtgg tgcttttgca tgtctttccg ggttggactc aagacgatag ttaccggata 14160
aggcgcagcg gtcggactga acggggggtt cgtgcataca gtccagcttg gagcgaactg 14220
cctacccgga actgagtgtc aggcgtggaa tgagacaaac gcggccataa cagcggaatg 14280
acaccggtaa accgaaaggc aggaacagga gagcgcacga gggagccgcc agggggaaac 14340
gcctggtatc tttatagtcc tgtcgggttt cgccaccact gatttgagcg tcagatttcg 14400
tgatgcttgt caggggggcg gagcctatgg aaaaacggct ttgccgcggc cctctcactt 14460
ccctgttaag tatcttcctg gcatcttcca ggaaatctcc gccccgttcg taagccattt 14520
ccgctcgccg cagtcgaacg accgagcgta gcgagtcagt gagcgaggaa gcggaatata 14580
tcctgtatca catattctgc tgacgcaccg gtgcagcctt ttttctcctg ccacatgaag 14640
cacttcactg acaccctcat cagtgccaac atagtaagcc agtatacact cc 14692