CN103804474B - E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application - Google Patents
E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application Download PDFInfo
- Publication number
- CN103804474B CN103804474B CN201310754311.2A CN201310754311A CN103804474B CN 103804474 B CN103804474 B CN 103804474B CN 201310754311 A CN201310754311 A CN 201310754311A CN 103804474 B CN103804474 B CN 103804474B
- Authority
- CN
- China
- Prior art keywords
- coli
- protein
- fragment
- amino acid
- flic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
<i>E. of the present invention coli </i>O157: the expression of H7 flagellin H7 antigen fragment, purifying and application relate to genetic engineering technique, vaccine and diagnostic reagent field.The present invention passes through Computer Analysis, do you filter out <i>E. coli </i>O157:H7 strong antigen epi-position in Flic albumen, 215th amino acid is to the 345th amino acid, totally 131 amino acid, select the codon of prokaryotic organism preference, the brand-new gene order of chemosynthesis epitope, utilize genetic engineering technique, express this gene fragment, preparation <i>E. coli </i>O157:H7 Flic albumen strong antigen epitope Fragments.The albumen of expressing can be used for <i>E. coli </i>O157:H7 infects the detection of antibody and monoclonal antibody and many anti-preparations.
Description
Technical field
What the present invention relates to is
e.colithe expression of O157:H7 flagellin H7 antigen fragment, purifying and application, pass through chemosynthesis
e.colithe brand-new gene fragment of O157:H7 flagellin H7 antigen, utilizes genetic engineering technique, prepares recombinant protein.By Computer Analysis, filter out the flagellin H7 antigen fragment containing strong antigen epi-position, select the codon of prokaryotic organism preference, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, the albumen of expression can be used for
e.colithe detection of O157:H7 antibody and the preparation etc. of monoclonal antibody, the present invention relates to genetic engineering technique and detection reagent field.
Background technology
e.colio157:H7 is pathogenic
e.coliin One serotype, the infectious diarrhea caused by it is the very serious infectious intestinal disease of the harm that found in recent years.Except causing diarrhoea, outside hemorrhagic enteritis, can also occur hemolytic uremic syndrome (HUS), thrombotic thrombocytopenic purpura (TTP) etc. serious and freeze, the latter's state of an illness is dangerous, and case fatality rate is high.Nineteen eighty-two, the U.S. causes the outburst of people's hemorrhagic enteritis because of it first, in succession finds the severe infections caused by it subsequently in some other country.
e.colio157:H7 has progressively become the important threat of human health, urgently sets up detection method fast and accurately.
At present for
e.colithe main detection method of O157:H7 has: bacteriology partition method, euzymelinked immunosorbent assay (ELISA) (ELISA), DNA probe and round pcr etc.But it is long that these methods more or less all also exist experimental period, is not suitable for the shortcomings such as field quick detection.In recent years, immune-gold labeled chromatography technology is widely used in each field of biomedicine, for
e.colithe detection of O157:H7 provides new thinking.Screening
e.colio157:H7 adventitia specific antigens, and prepare highly purified specific antigens, be the important prerequisite setting up this technology.
Flagellin H7 antigen is enterohemorrhagic
e.colithe virulence factor that O157:H7 is important, its encoding gene is flic.Primarily of three subregions compositions: the C1 district of two ends high conservative and C2 district and middle Gao Bian C3 district.H7 flagellum is in startup
e.colio157:H7 and intestinal mucosa, mucus or play an important role simultaneously with both cohesive process.
Summary of the invention
The present invention passes through the brachymemma of chemosynthesis
e.colithe brand-new gene fragment of O157:H7 flagellin H7 antigen, utilizes genetic engineering technique, preparation Flic albumen high expression level fragment.By Computer Analysis, filter out the Flic protein extracellular fragment containing strong antigen epi-position, the 215th amino acid-345 amino acid, totally 131 amino acid, select the codon that prokaryotic organism are all had a preference for, the gene order that chemosynthesis is brand-new, utilizes genetic engineering technique to express this gene.The albumen of expressing can be used for
e.colithe detection of O157:H7 antibody or the preparation of monoclonal cell strain.
The present invention filters out the Flic protein fragments containing strong antigen epi-position, and select the codon of prokaryotic organism preference, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, expression product has good antigenicity and specificity, and the albumen of expression can be used for
e.colithe detection of O157:H7 antibody or the preparation of monoclonal cell strain.
the expression of E.coli flagellin H7 antigen fragment, purifying and application take following steps to realize:
The screening of 1.flic extracellular region epitope and the chemosynthesis of gene fragment thereof:
Utilize the softwares such as ANTHEWIN, by the aminoacid sequence of Computer Analysis, find that the C3 district (the 215th amino acid-345th amino acid) of Flic albumen is containing stronger antigenic determinant.Select the codon of prokaryotic organism preference, the gene order that chemosynthesis is brand-new, and add at 5' end
bamhI restriction enzyme site (underscore part), 3' end add terminator codon (TAA) and
ecorI restriction enzyme site (underscore part), makes this gene fragment be easy to be cloned in plasmid pGEX4T-2
bamhI and
ecoin RI restriction enzyme site.
The Flic protein fragments aminoacid sequence (the 215th aa-the 345th aa) of screening:
The DNA sequence dna (412bp) of the flic gene fragment of chemosynthesis:
GC
GGATCCACTACTGATGCTGCATTTGATAAATTAGGTAATGGCGATAAAGTTACAGTTGGCGGCGTAGATTATACTTATAATGCTAAATCTGGTGATTTTACTACTACTAAATCTACTGCTGGTACTGGTGTTGATGCAGCAGCACAAGCTGCTGATTCAGCTTCAAAACGTGATGCGTTAGCTGCAACTCTTCATGCTGATGTTGGTAAATCTGTTAATGGTTCTTATACTACAAAAGATGGTACTGTTTCTTTTGAAACTGATTCAGCAGGTAATATTACTATTGGTGGAAGTCAAGCATATGTAGATGATGCAGGTAATTTAACTACTAATAATGCTGGTAGTGCAGCTAAAGCTGATATGAAAGCACTGCTCAAAGCAGCAAGTGAAGGTAGTGATTAA
CTCGAGGC
2. express the structure of Flic protein extracellular fragment recombinant plasmid:
Extract plasmid pGEX4T-2, use
bamhI and
ecorI double digestion, reclaims the plasmid large fragment that enzyme is cut, is dissolved in deionized water after electrophoresis.Same use
bamhI and
ecothe flic gene fragment of RI double digestion chemosynthesis, electrophoresis is dissolved in deionized water after reclaiming.
The above-mentioned two kinds of enzymes volumetric molar concentration such as getting cut rear DNA fragmentation, connect, flic gene fragment is inserted in vector pGEX 4T-2 in same centrifuge tube with T4DNA ligase enzyme
bamhI and
ecobetween RI site, consistent with the initiator codon translation framework on carrier, express a fusion rotein.
3. the selection systems of recombinant plasmid:
By recombinant plasmid transformed
e.colibL21 (DE3), coating is dull and stereotyped containing penbritin (100 μ g/ml) LB, puts 37 DEG C and spends the night.Next day, random picking transformed bacterium colony and 1 contrast bacterium (plasmid pGEX4T-2 transformed bacteria), extract plasmid respectively, with the plasmid extracted for template, pcr amplification Flic protein extracellular gene fragment, containing the positive recombinant plasmid of flic gene fragment, the gene fragment being about 393bp should be amplified.Plasmid containing foreign gene is carried out DNA sequence analysis, and sequential analysis confirms that recombinant plasmid contains the flic gene fragment of synthesis, and sequence is entirely true:
ACTACTGATGCTGCATTTGATAAATTAGGTAATGGCGATAAAGTTACAGTTGGCGGCGTAGATTATACTTATAATGCTAAATCTGGTGATTTTACTACTACTAAATCTACTGCTGGTACTGGTGTTGATGCAGCAGCACAAGCTGCTGATTCAGCTTCAAAACGTGATGCGTTAGCTGCAACTCTTCATGCTGATGTTGGTAAATCTGTTAATGGTTCTTATACTACAAAAGATGGTACTGTTTCTTTTGAAACTGATTCAGCAGGTAATATTACTATTGGTGGAAGTCAAGCATATGTAGATGATGCAGGTAATTTAACTACTAATAATGCTGGTAGTGCAGCTAAAGCTGATATGAAAGCACTGCTCAAAGCAGCAAGTGAAGGTAGTGATTAA
The expression of recombinant plasmid Flic protein extracellular fragment (131 amino acid) built, hold 226 amino acid merged on carrier at its N, total length 357 amino acid, its aminoacid sequence is as follows:
4. the Screening and Identification of expressed fusion protein engineering bacteria:
By the positive transformant containing recombinant plasmid, be seeded to containing 3mlLB substratum (containing penbritin 100 μ g/ml) in vitro, 37 DEG C of shaking culture 3h, add IPTG to final concentration 1.0mmol/L, continue shaking culture induction 4h, collected by centrifugation thalline carries out SDS-PAGE detection, and recon expresses the Flic albumen that relative molecular weight is about 40kDa, expression amount is about 30%, and contrasts bacterium pGEX4T-2 without this protein band.
5. express the purifying of Flic albumen:
1) ultrasonic degradation of Flic protein engineering bacterium is expressed
Centrifugal for the engineering bacteria of abduction delivering fusion rotein (8000rpm, 20min, 4 DEG C) is received bacterium, thalline is resuspended in the lysate (50mmol/LTris-HClpH8.0,10mmol/LEDTA, 10mmol/LDTT) of original fluid 1/10 volume, ice-bath ultrasonic breaks bacterium 10min, centrifugal (8000rpm, 20min, 4 DEG C) collects supernatant, abandons precipitation.The supernatant collected is for next step affinitive layer purification.
2) purifying of Flic albumen is expressed
Supernatant solution adds counter-balanced GlutathioneSepharose4B gel 3ml, and room temperature is in conjunction with 60min, and loading, collects and penetrate liquid.Wash pillar with 1 × PBS of ten times of column volumes, then use GSH elutriant (50mmol/LTris-HClpH8.0+10mmol/LGSH) point three wash-out target proteins of 15ml high density, be the Flic protein extracellular fragment of purifying.
6. the ELISA of the Flic albumen of purifying detects:
The fusion rotein that preliminary purification obtains is pressed 1:1000 ~ 1:32000 doubling dilution, and by negative control with same concentration doubling dilution, detects the antigenicity of expressing protein.Result shows this amalgamation and expression albumen and has good antigenicity and specificity.
7. the Flic protein fragments of will express, for
e.colio157:H7 infects the detection of antibody and prepares anti-Flic monoclonal antibody and how anti-etc. for immunity.
8. the Flic protein gene fragment of synthesis is connected with other gene fragment, carries out expressing, preparing with the form of fusion rotein.
Described chemosynthesis
e.colithe gene fragment order of O157:H7Flic protein extracellular, utilizes bacterium, yeast cell, insect cell, mammalian cell and genetically modified animals and plants to carry out recombinant expressed, preparation.
Prepared by method described above
e.colio157:H7Flic protein extracellular fragment, for
e.colio157:H7 infects the detection of antibody and monoclonal antibody and many anti-preparations.
the advantage that the present invention compared with prior art has
The Flic protein fragments that the present invention expresses, has more advantages:
1. adopt gene optimization technical optimization goal gene with solubility expression target protein;
2., according to the Flic protein extracellular fragment amino acid sequence filtered out, select the codon of prokaryotic organism preference, the gene order that chemosynthesis is brand-new, this gene is suitable for high expression level in prokaryotic cell prokaryocyte;
3. the expression of the present invention's structure
e.coliO157:H7Flic albumenengineering bacteria, expression amount can reach 30% of tropina, is easy to purifying, can prepare this albumen by large-scale purification.Have no the report of expressing this section of albumen at present;
4. in experiment, the Flic albumen of screening is hemorrhagic
e.colio157:H7 specific antigens, chooses this antigen as research object, can avoid other serotypes
e.colito the interference detected.
Accompanying drawing explanation
Below with reference to accompanying drawing, the invention will be further described:
Fig. 1 is that molecular biology software carries out analytical results to the epitope of Flic albumen.Result shows, in Flic PROTEIN C 3 district, from total length the 215th amino acid to the 345th amino acid, containing strong antigenic determinant.
Fig. 2 is the construction of recombinant plasmid schema of expressing Flic albumen.
Fig. 3 is the Agarose gel detection recon plasmid double digestion product with 1.0%.M:DNAmarkerDL5000
tM; 1 ~ 2:2 the equal double digestion of transformant goes out the goal gene fragment of about 400bp.
Fig. 4 is the SDS-PAGE analytical results of expressing Flic Protein reconstitution bacterium.
M:Marker; 1 ~ 3:1 ~ No. 3 recombinant bacterium, 3 recons all express the fusion rotein that relative molecular weight is about 40KDa.
Fig. 5 is the SDS-PAGE analytical results after the Flic protein purification of expressing.M:Marker; After 1 ~ 2:GlutathioneSepharose4B affinity chromatography column purification Flic albumen, purifying obtains the fusion rotein that molecular weight is about 40kDa.
Fig. 6 is that ELISA detects immune sero-fast result schematic diagram.
Embodiment
The detailed description of embodiment of the present invention:
e.colithe analysis of O157:H7 flagellin H7 epitope, gene chemical synthesis and expression
Pass through Computer Analysis
e.coliwhole aminoacid sequences of O157:H7Flic albumen, filter out
e.colistrong antigen epi-position in O157:H7Flic albumen, selects the codon that bacterium is had a preference for, the brand-new gene fragment of chemosynthesis Flic albumen strong antigen epi-position.By gene fragment clone in plasmid pGEX4T-2
bamhI/
ecorI site, consistent with the translation framework of the initiator codon on carrier, a fusion rotein can be expressed.By recombinant plasmid transformed
e.colibL21 (DE3), screening obtains the engineering bacteria of high expression Flic albumen, and the Flic albumen of expression accounts for about 30% of tropina total amount.
materials and methods
1. bacterial classification and plasmid:
e.colibL21(DE3) and expression vector pGEX4T-2 be this laboratory preserve.
2. molecular biology reagents: restriction enzyme
bamhI,
ecorI and T4DNA ligase enzyme is TaKaRa Products.Plasmid purification kit and the test kit reclaiming DNA fragmentation in sepharose are TaKaRa Products.DTT and IPTG is Promega Products.Other reagent is import or domestic analytical reagent.
3. the synthesis of gene fragment: help synthesis by Dalian TaKaRa company.
4. the enzyme of gene clone method: DNA is cut, connect, electrophoresis; The extraction of plasmid, conversion; The general molecular cloning methods such as the SDS-PAGE analysis of albumen carry out according to a conventional method.Other test kit by specification operates.
5.DNA sequential analysis: with TAKARA company plasmid purification kit plasmid purification, with the full-automatic sequencer of DNA.
result
1.
e.colithe synthesis of the screening of O157:H7Flic Protein Epitopes and gene fragment:
Utilize the softwares such as ANTHEWIN, pass through Computer Analysis
e.coliwhole aminoacid sequences (GeneBank, ID:CAJ76128.1) of O157:H7Flic albumen, filter out
e.colistrong antigen epi-position (Fig. 1) in O157:H7Flic albumen, namely from the 215th amino acid to the 345th amino acid, its aminoacid sequence is as follows:
According to what screen
e.coliepitope aminoacid sequence in O157:H7Flic albumen, selects the codon of prokaryotic organism preference, the gene order that chemosynthesis is brand-new, and adds at 5' end
bamhI restriction enzyme site (underscore part), 3' end add terminator codon (TAA) and
ecorI restriction enzyme site (underscore part), makes this gene fragment be easy to be cloned in plasmid pGEX4T-2
bamhI and
ecoin RI restriction enzyme site.Containing of chemosynthesis
e.colithe DNA sequence dna (408bp) of O157:H7Flic Protein Epitopes gene is as follows:
GGATCCACTACTGATGCTGCATTTGATAAATTAGGTAATGGCGATAAAGTTACAGTTGGCGGCGTAGATTATACTTATAATGCTAAATCTGGTGATTTTACTACTACTAAATCTACTGCTGGTACTGGTGTTGATGCAGCAGCACAAGCTGCTGATTCAGCTTCAAAACGTGATGCGTTAGCTGCAACTCTTCATGCTGATGTTGGTAAATCTGTTAATGGTTCTTATACTACAAAAGATGGTACTGTTTCTTTTGAAACTGATTCAGCAGGTAATATTACTATTGGTGGAAGTCAAGCATATGTAGATGATGCAGGTAATTTAACTACTAATAATGCTGGTAGTGCAGCTAAAGCTGATATGAAAGCACTGCTCAAAGCAGCAAGTGAAGGTAGTGATTAA
CTCGAG
2. express the structure of Flic protein extracellular fragment recombinant plasmid:
Extract plasmid pGEX4T-2, use
bamhI and
ecorI double digestion, reclaims the plasmid large fragment that enzyme is cut, is dissolved in deionized water after electrophoresis.Same use
bamhI and
ecothe Flic protein extracellular gene fragment of RI double digestion chemosynthesis, electrophoresis is dissolved in deionized water after reclaiming.
The above-mentioned two kinds of enzymes volumetric molar concentration such as getting cut rear DNA fragmentation, connect, Flic protein extracellular gene fragment is inserted in vector pGEX 4T-2 in same centrifuge tube with T4DNA ligase enzyme
bamhI and
ecobetween RI site, consistent with the initiator codon translation framework on carrier, express a fusion rotein (build flow process and see Fig. 2).
3. the selection systems of recombinant plasmid:
The recombinant plasmid transformed that upper step connects is arrived
e.colibL21 (DE3), by converted product coating containing on the solid LB media of penbritin (100 μ g/ml), puts 37 DEG C of overnight incubation.Random choose next day 2 transformant colonies (being labeled as No. 1-2 respectively), is inoculated into respectively and in vitro, puts 37 DEG C of shaking culture 5h containing 3ml LB liquid medium (containing penbritin 100 μ g/ml), get bacterium liquid 1ml, centrifugal receipts bacterium.Use the plasmid extraction kit of TAKARA company to extract plasmid, after the Agarose gel detection plasmid extraction success of 1.0%, use restriction enzyme BamHI and XhoI double digestion plasmid 4h under 37 DEG C of water-baths.Get double digestion product with 1.0% Agarose gel detection, result, 2 equal enzymes of transformant cut out the goal gene fragment of about 400bp, and these 2 transformants of tentative confirmation are all containing flic gene fragment (see Fig. 3).
Extract the plasmid of No. 1 recon, measure the Flic protein gene sequence in plasmid, DNA sequence analysis confirms, recombinant plasmid contains synthesis
e.colio157:H7Flic protein gene fragment, sequence is entirely true:
ACTACTGATGCTGCATTTGATAAATTAGGTAATGGCGATAAAGTTACAGTTGGCGGCGTAGATTATACTTATAATGCTAAATCTGGTGATTTTACTACTACTAAATCTACTGCTGGTACTGGTGTTGATGCAGCAGCACAAGCTGCTGATTCAGCTTCAAAACGTGATGCGTTAGCTGCAACTCTTCATGCTGATGTTGGTAAATCTGTTAATGGTTCTTATACTACAAAAGATGGTACTGTTTCTTTTGAAACTGATTCAGCAGGTAATATTACTATTGGTGGAAGTCAAGCATATGTAGATGATGCAGGTAATTTAACTACTAATAATGCTGGTAGTGCAGCTAAAGCTGATATGAAAGCACTGCTCAAAGCAGCAAGTGAAGGTAGTGAT
The expression of recombinant plasmid built
e.colio157:H7Flic protein fragments (131 amino acid), hold 226 amino acid merged on carrier at its N, total length 357 amino acid, its aminoacid sequence is as follows:
4. express the Screening and Identification of Flic protein engineering bacterium:
By 5 positive transformants containing recombinant plasmid and 1 contrast bacterium (plasmid pGEX4T-2 transformed bacteria), be seeded to containing 3mlLB substratum (containing penbritin 100 μ g/ml) in vitro, 37 DEG C of shaking culture 3h, add IPTG to final concentration 1.0mmol/L, continue shaking culture induction 4h, collected by centrifugation thalline carries out SDS-PAGE detection, and recon expresses the Flic albumen that relative molecular weight is about 40kDa, and expression amount is about 30%(and sees Fig. 4).
express the purifying of Flic albumen
According to expression
e.colio157:H7Flic protein amino acid sequence, analyzes its physicochemical property, determines suitable purification process.Flic protein fusion expressed by us has the GST albumen on carrier, and the gst fusion protein of expression can easily be separated with GSH sepharose FF, and therefore we determine to adopt affinity chromatography, carry out purifying with GlutathioneSepharose4B gel.Concrete steps are as follows:
Materials and methods
1. main agents:
GlutathioneSepharose4B gel is GEHeathcare Products, and IPTG, DTT are Promega Products.Other reagent is domestic or Import Analysis pure reagent.
2. express the ultrasonic degradation of Flic albumen:
By the centrifugal (8000rpm of engineering bacteria of the expression Flic albumen of cultivation, 20mins, 4 DEG C), abandon supernatant, thalline is resuspended in the lysate (50mmol/LTris-HClpH8.0,10mmol/LEDTA, 10mmol/LDTT) of original fluid 1/10 volume, and ice-bath ultrasonic breaks bacterium 10mins, centrifugal (8000rpm, 20mins, 4 DEG C) collect supernatant, abandon precipitation.The supernatant collected is for next step affinitive layer purification.
3. express the purifying of Flic albumen:
Supernatant solution add counter-balanced GlutathioneSepharose4B gel 3ml room temperature in conjunction with 60min, loading, collect penetrate liquid.Wash pillar with 1 × PBS of ten times of column volumes, then use GSH elutriant (50mmol/LTris-HClpH8.0+10mmol/LGSH) point three wash-out target proteins of 15ml high density, be the Flic protein extracellular fragment of purifying.
Result
Carry out SDS-PAGE analysis by from the albumen of wash-out on GlutathioneSepharose4B gel column, result display (see Fig. 5), obviously give expression to Flic/GST fusion rotein through inducing, expression product is mainly present in supernatant liquor.SDS-PAGE Explicit Expression product is about 40kDa.
the preparation of protein immunization polyvalent antibody and purifying
The PsaA albumen that purifying obtains can be used for the preparation of polyvalent antibody.We use antigen by the mode with adjuvant combined immunization New Zealand large ear rabbit, and preparation also purifying obtains a large amount of rabbit anti-serums, and indirect elisa method detects antibody titers.Concrete steps are as follows:
Materials and methods
1. main agents:
DEAESepharose
tMfastFlow is GEHeathcare Products, and completely not formula adjuvant and incomplete Freund's adjuvant are SIGMA Products.Other reagent is domestic or Import Analysis pure reagent.
2. immunogen and immune programme for children
Use Flic albumen as immunogen, immunity 5 New Zealand's large ear rabbits, every white rabbit immune 100 μ g antigens at every turn, immunization ways is back multiple spot immunity.First time immunity uses completely not formula adjuvant to mix with antigen, and second and third immunity is cannotd be used up full adjuvant.
3. indirect elisa method surveys antiserum titre
After each immunity 2 weeks, from rabbit ear edge venous blood sampling, the centrifugal 10min of 4000rpm obtained antiserum(antisera).Bag is by Flic albumen, and every hole 1 μ g, 4 DEG C are spent the night, and 20% calf serum is closed, 37 DEG C, 2h, and using the antiserum(antisera) gradient dilution of centrifugal acquisition as primary antibodie, 37 DEG C, after 2h, add two and resist, 1:5000 dilutes goat anti-rabbit igg, adds A, B liquid colour developing also reading.
4. sero-fast acquisition
Indirect elisa method is surveyed after antiserum titre reach a certain height, and gets blood from rabbit carotid artery, 4 DEG C spend the night after, 3000rpm, centrifugal 10min, obtain antiserum(antisera), filtration sterilization, ﹣ 20 DEG C is frozen.
5. sero-fast purifying
Saturated (the NH of equal-volume
4)
2sO
4solution and serum mix, and after 4 DEG C of standing 1h, the centrifugal 10min of 3000rpm, abandons supernatant, use 0.07MNa
3pO
4solubilize precipitates, upper prop after dialysis, DEAESepharose
tMfastFlow anion exchange chromatography purifying resists more.
Result
After last immunity 2 weeks, adopt rabbit carotid artery blood taking method to obtain blood 60ml, 4 DEG C of placements spend the night after separation of serum, DEAESepharose
tMhow anti-FastFlow anion exchange chromatography purifying is as the primary antibodie in ELISA detection, and result display 1:100000 is that serum effectively dilutes gradient, i.e. serum titer, as Fig. 6, illustrates that the PsaA albumen of preparation has good immunogenicity and antigenicity.
Chemosynthesis E.coliO157:H7 flagellin H7 antigen gene sequence table fragment sees appendix document: Nucleotide or the readable carrier of aminoacid sequence list machine.
Claims (3)
1. a gene fragment for chemosynthesis, this gene segment encodes is containing strong antigen epi-position
e.colio157:H7Flic protein extracellular fragment, namely the 215th amino acid is to the 345th amino acid, totally 131 amino acid, and the 5' end of this gene fragment contains
bamhI restriction enzyme site, 3' end containing terminator codon TAA and
ecorI restriction enzyme site, the gene order total length 408bp of described chemosynthesis, sequence is as follows:
5’
GGATCCACTACTGATGCTGCATTTGATAAATTAGGTAATGGCGATAAAGTTACAGTTGGCGGCGTAGATTATACTTATAATGCTAAATCTGGTGATTTTACTACTACTAAATCTACTGCTGGTACTGGTGTTGATGCAGCAGCACAAGCTGCTGATTCAGCTTCAAAACGTGATGCGTTAGCTGCAACTCTTCATGCTGATGTTGGTAAATCTGTTAATGGTTCTTATACTACAAAAGATGGTACTGTTTCTTTTGAAACTGATTCAGCAGGTAATATTACTATTGGTGGAAGTCAAGCATATGTAGATGATGCAGGTAATTTAACTACTAATAATGCTGGTAGTGCAGCTAAAGCTGATATGAAAGCACTGCTCAAAGCAGCAAGTGAAGGTAGTGATTAA
CTCGAG3’。
2. prepare the gene segment encodes of chemosynthesis according to claim 1 for one kind
e.colithe method of O157:H7Flic protein extracellular protein fragments, comprises and adopts genetic engineering technique to express this gene segment encodes
e.colio157:H7Flic protein extracellular protein fragments, the protein fragments that purifying is expressed, concrete steps are as follows:
Comprise
e.colithe structure of O157:H7Flic protein extracellular gene fragment recombinant plasmid:
With
bamhI and
ecothe gene fragment of RI double digestion plasmid pGEX4T-2 and chemosynthesis according to claim 1, electrophoresis connects with T4DNA ligase enzyme, makes coding after reclaiming
e.colithe gene fragment of the Flic protein extracellular of O157:H7 is inserted in vector pGEX 4T-2
bamhI and
ecobetween RI site, consistent with the initiator codon translation framework on carrier, express a fusion rotein, total length 357 amino acid, this fusion rotein N holds 226 amino acid merged on carrier, and C end comprises
e.coli131, the Flic protein extracellular amino acid of O157:H7, the fusion rotein aminoacid sequence of expression is as follows:
The Screening and Identification of expressed fusion protein engineering bacteria:
By recombinant plasmid transformed
e.colibL21 (DE3), coating is dull and stereotyped containing the LB of 100 μ g/ml penbritins, put 37 DEG C to spend the night, next day, random picking transformed bacterium colony and the contrast bacterium containing plasmid pGEX4T-2, extract plasmid, with restriction enzyme BamHI and XhoI to plasmid double digestion, the Agarose gel detection double digestion product of 1.0% should cut the gene fragment of 408bp;
By the positive transformant containing recombinant plasmid, be seeded in the LB substratum containing penbritin 100 μ g/mL, 37 DEG C of shaking culture 3h, add IPTG to final concentration 0.5 ~ 1.0mmol/L, continue shaking culture induction 4 ~ 6h, collected by centrifugation thalline carries out SDS-PAGE detection, and it is 40kD's that recon expresses relative molecular weight
e.colio157:H7Flic protein extracellular fragment, expression amount is 30%, and contrasts bacterium BL21 (DE3) without this protein band;
e.colithe purifying of O157:H7Flic protein extracellular fragment:
By centrifugal for the engineering bacteria of abduction delivering fusion rotein receipts bacterium, thalline is resuspended in lysate, lysate is 50mmol/LTris-HClpH8.0,10mmol/LEDTA, 10mmol/L DTT, carrying out ultrasonic bacteria breaking 10min, collected by centrifugation supernatant, supernatant solution adds counter-balanced GlutathioneSepharose4B gel 3ml, and room temperature is in conjunction with 60min, loading, collects and penetrates liquid;
Wash pillar with 1 × PBS of ten times of column volumes, then use 15ml50mmol/LTris-HClpH8.0+10mmol/LGSH elutriant, point three wash-out target proteins, be purifying
e.colithe Flic protein extracellular fragment of O157:H7.
3. one kind
e.colio157:H7Flic protein extracellular fragment, it is by the gene fragment of chemosynthesis according to claim 1, adopts bacterium, yeast cell, insect cell, mammalian cell or genetically modified animals and plants to carry out expressing, preparing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310754311.2A CN103804474B (en) | 2013-12-31 | 2013-12-31 | E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310754311.2A CN103804474B (en) | 2013-12-31 | 2013-12-31 | E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103804474A CN103804474A (en) | 2014-05-21 |
| CN103804474B true CN103804474B (en) | 2016-01-27 |
Family
ID=50701903
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310754311.2A Active CN103804474B (en) | 2013-12-31 | 2013-12-31 | E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103804474B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586311A (en) * | 2012-03-15 | 2012-07-18 | 江苏省农业科学院 | Enterohemorrhage Escherichia coli (EHEC) O157:H7 multivalence fliC-hcpA-tir-eae recombinant strain and vaccine |
-
2013
- 2013-12-31 CN CN201310754311.2A patent/CN103804474B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586311A (en) * | 2012-03-15 | 2012-07-18 | 江苏省农业科学院 | Enterohemorrhage Escherichia coli (EHEC) O157:H7 multivalence fliC-hcpA-tir-eae recombinant strain and vaccine |
Non-Patent Citations (3)
| Title |
|---|
| An investigation of the expression and adhesin function of H7 flagella in the interaction of Escherichia coli O157 : H7 with bovine intestinal epithelium;Arvind Mahajan et al.;《Cellular Microbiology》;20090131;第11卷(第1期);第121-137页 * |
| Cloning of fimH and fliC and expression of the fusion protein FimH/FliC from Uropathogenic Escherichia coli (UPEC) isolated in Iran;Asadi Karam MR et al.;《Iran J Microbiol.》;20120630;第4卷(第2期);第55-62页 * |
| 肠出血性大肠杆菌O157：H7 rfbE与fliC基因的表达及鉴定;潘群兴等;《江苏农业学报》;20090630;第25卷(第3期);第568-571页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103804474A (en) | 2014-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101900731B (en) | ELISA kit for distinctively detecting antibodies of classical swine fever (CSF) vaccine immunity and wild virus infection and preparation method thereof | |
| CN103293306B (en) | Preparation method for African swine fever virus antibody detection colloidal gold immunochromatography test paper strip | |
| CN109254155A (en) | A kind of detection African swine fever virus antigen colloidal gold immune chromatography test paper and preparation method and application | |
| CN104316703A (en) | Mycoplasma bovis detection test strip and preparation method thereof | |
| CN104181301A (en) | Method and kit for performing quick co-detection on anti-human Hi (Haemophilus influenzae) IgM (Immunoglobulin M) and IgG (Immunoglobulin G) antibodies based on magnetic separation and multi-color quantum dot labeling | |
| CN105294843A (en) | Immunogenic polypeptide for enterovirus 71 type VP1 antigen as well as preparation method and application of immunogenic polypeptide | |
| Venkatesan et al. | Expression and evaluation of recombinant P32 protein based ELISA for sero-diagnostic potential of capripox in sheep and goats | |
| CN105884902A (en) | Fusion protein of mycoplasma pneumonia protein epitope and preparation and application thereof | |
| CN105348391A (en) | Enteric cytopathogenic human orphan virus 6-type VP1 protein specific epitope, fusion protein of enteric cytopathogenic human orphan virus 6-type VP1 protein specific epitope and preparation method and use of fusion protein | |
| CN103941020A (en) | Indirect ELISA (enzyme-linked immuno sorbent assay) kit for detecting haemophilus parasuis antibody | |
| CN106279378A (en) | Varicella zoster virus gE antigen and the purposes in detection varicella zoster virus antibody thereof | |
| CN102210860B (en) | Mycobacterium tuberculosis TB10.4-F1 fusion protein vaccine and preparation method thereof | |
| CN106589082A (en) | Screening and application of active tuberculosis diagnosis molecules | |
| CN1866023B (en) | Method for synchronous detection of multiple tubercle bacillus specific secretion antigens | |
| CN111621506B (en) | Mycoplasma bovis secretory protein Mbovp0145 and application thereof | |
| CN101747416A (en) | B-cell antigenic multi-epitope peptide linked in tandem in OmpU of vibrio mimicus, making method and application thereof | |
| CN104181302A (en) | Method and kit for performing quick co-detection on anti-Sp (Streptococcus pneumoniae) IgM (Immunoglobulin M) and IgG (Immunoglobulin G) antibodies based on magnetic separation and multi-color quantum dot labeling | |
| CN103725697A (en) | Chemically synthesized staphylococcus aureus surface protein FnBPA gene fragment and expression and application thereof | |
| CN103834667B (en) | The streptococcus pneumoniae PspA protein extracellular genetic fragment of chemosynthesis and expression, application | |
| CN103204936A (en) | Preparation method for polyclonal antibody to salmonella effect protein SopB | |
| CN103804474B (en) | E. the expression of coli O157:H7 flagellin H7 antigen fragment, purifying and application | |
| CN105949320A (en) | Preparation and application of echovirus type 1 VP1 protein specific antigen epitope and fusion protein thereof | |
| CN105906716B (en) | Preparation and application of echovirus 9 type VP1 protein specific epitope and fusion protein thereof | |
| CN109679970A (en) | The preparation method that feline herpesvirus I type virus quickly detects | |
| CN101955950A (en) | Method for preparing recombinant fibrin-related antigen of egg drop syndrome viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230928 Address after: 210002 No. 293 East Zhongshan Road, Jiangsu, Nanjing Patentee after: EASTERN THEATER DISEASE PREVENTION AND CONTROL CENTER OF PLA Address before: 210002 Military Medical Research Institute, Nanjing military area command, 293 East Zhongshan Road, Nanjing, Jiangsu Patentee before: Li Yuexi |
|
| TR01 | Transfer of patent right |