CN103789278A - Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof - Google Patents
Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof Download PDFInfo
- Publication number
- CN103789278A CN103789278A CN201310317554.XA CN201310317554A CN103789278A CN 103789278 A CN103789278 A CN 103789278A CN 201310317554 A CN201310317554 A CN 201310317554A CN 103789278 A CN103789278 A CN 103789278A
- Authority
- CN
- China
- Prior art keywords
- sod
- ptd4
- fusion rotein
- novel
- pet16b
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0089—Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
- C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
- C12Y115/01001—Superoxide dismutase (1.15.1.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
Abstract
The invention discloses a novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and a preparation method thereof. The novel PTD4-Cu and Zn-SOD fusion protein is high in efficiency of penetrating a cell membrane, so that the Cu, Zn-SOD which cannot pass through the cell membrane in the past is transduced to the cell membrane to play the biological function. Thus, the efficiency of the SOD for catalyzing disproportionated reaction of superoxide anion free radicals (O2<->.) is greatly improved, and the cell is prevented from being damaged by oxidation of O2<->.; meanwhile, the method for improving the penetration rate of the Cu, Zn-SOD through the cell membrane by the PTD4-Cu and Zn-SOD fusion protein by using the PTD4 with high penetration action is simple, efficient and safe, not only is the biological activity of the Cu and Zn-SOD not affected, but also the natural protein structure and generated new function can be optimized by the fusion protein; compared with natural protein, the fusion protein disclosed by the invention has a plurality of advantages.
Description
Technical field
The present invention relates to a kind of fusion rotein, be specifically related to a kind of novel PTD4-Cu, Zn-SOD fusion rotein; The invention still further relates to this novel PTD4-Cu, the preparation method of Zn-SOD fusion rotein.
Background technology
Oxyradical is the by product producing in cell eubolism process, under normal circumstances, the generation of oxyradical and remove in a basic balance, in the time that body oxyradical generates showed increased or Function of Antioxidant System obstacle, a large amount of oxyradicals of piling up in vivo can be attacked body, cause response to oxidative stress.Superoxide-dismutase (SOD) can catalysis superoxide anion radical (O
2 -) there is disproportionation reaction, thus effectively remove O
2 -, make cell avoid O
2 -oxidative damage.But because generation and the effect of free radical are mainly carried out in born of the same parents, the antioxidant of any external source all needs first to enter cell, its effect of competence exertion.So SOD must enter in cell or even just can play the effect of anti-oxidative damage in plastosome.But SOD molecule does not have specific receptors, be difficult to directly pass cytolemma, its clinical effect is very restricted.Nexin transduction domain (PTD) in the trans-activator (TAT) of HIV-1 coding is a kind ofly the material that can not enter cells play biological effect under physiological status can be brought into intracellular carrier instrument.Now prove PTD and other protein fusion expressions, can make biomacromolecule enter cell in non-acceptor dependence mode, and there is transducer wide spectrum and the advantage such as exogenous protein biological activity is unaffected.But there is the defects such as the relatively low and potential cytotoxicity of transduction efficiency in existing PTD.For this problem, a kind of novel nexin transduction domain PTD4 has been found in now research, its by chemical synthesis 3 arginine wherein, 2 Methionins and 1 glycine all use L-Ala (Ala) to replace, make its a-spirane structure more stable, core sequence is YARAAARQARA, PTD4 peptide is an amphiphilic structure in secondary structure, the hydrophilic segment of amphiphilic structure is conducive to guanidine radicals positively charged in arginine and cell surface combination, its hydrophobic part is more conducive to permeates cell membranes, be proved to be the translocator matter having higher than 32 times of TAT-PTD and enter intracellular efficiency.Simultaneously existing PTD-Cu, Zn-SOD fusion rotein preparation method is also immature and perfect, the structure of fusion gene, the separation of albumen and purifying process process complexity, opinions vary especially to induce the condition of fusion rotein great expression, do not grope clear.
Summary of the invention
Main purpose of the present invention is to provide a kind of novel PTD4-Cu, Zn-SOD fusion rotein, utilize the height of PTD4 to wear film function and low cytotoxicity by originally can not be by the Cu of cytolemma, Zn-SOD transduces to cytolemma performance biological function, solve existing PTD-Cu, the relatively low and potential cytotoxicity problem of transduction efficiency that Zn-SOD fusion rotein exists.
Another object of the present invention is to provide described novel PTD4-Cu, the preparation method of Zn-SOD fusion rotein, solve existing PTD-Cu, the structure of Zn-SOD fusion rotein preparation method fusion gene, the separation of albumen and purifying process process complexity and the few defect of induction fusion protein expression.
The present invention builds PTD4-Cu, Zn-SOD recombination, and this recombination is by PTD4 gene, Cu, and Zn-SOD gene design is synthetic.
PTD4 gene order is as shown in SEQID NO:1, and concrete sequence is as follows:
tatgcgcgtg cggcagcgcg tcaggctcgt gcc 33
Cu, Zn-SOD gene order is as shown in SEQID NO:2, and concrete sequence is as follows:
atggcgacga aggccgtgtg cgtgctgaag ggcgatggcc cagtgcaggg catcatcaat 60
ttcgagcaga aggaaagtaa tggaccagtg aaggtgtggg gaagcattaa aggactgact 120
gaaggcctgc atggattcca tgttcatgag tttggagata atacagcagg ctgtaccagt 180
gcaggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaagagagg 240
catgttggag acttgggcaa tgtgactgct gacaaagatg gtgtggccga tgtgtctatt 300
gaagattctg tgatctcact ctcaggagac cattgcatca ttggccgcac actggtggtc 360
catgaaaaag cagatgactt gggcaaaggt ggaaatgaag aaagtacaaa gacaggaaac 420
gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aataa 465
The PTD4-Cu that the present invention builds, Zn-SOD antigen-4 fusion protein gene has the nucleotide sequence as shown in SEQ ID NO:3, total length 513bp, concrete sequence is as follows:
Nde I Xho I
tgcgtgctgaagggcgatggcccagtgcagggcatcatcaatttcgagcagaaggaaagt
aatggaccagtgaaggtgtggggaagcattaaaggactgactgaaggcctgcatggattc
catgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaat
cctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggc
aatgtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctca
ctctcaggagaccattgcatcattggccgcacactggtggtccatgaaaaagcagatgac
ttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggct
tgtggtgtaattgggatcgcccaataa
BamH I
Another object of the present invention is achieved in that described novel PTD4-Cu, and the preparation method of Zn-SOD fusion rotein, includes following steps:
1) design respectively Cu, Zn-SOD Auele Specific Primer and PTD4 oligonucleotide sequence;
2) react amplification Cu, Zn-SOD cDNA fragment by PCR;
3) PCR reaction product and pET16b carrier carry out ligation through double digestion, glue after reclaiming respectively;
4) connect product and be transformed into DH10B intestinal bacteria and extract plasmid, cut, check order through enzyme and identify called after pET16b-Cu, Zn-SOD plasmid;
5) two oligonucleotide chains of PTD4 are boiled to renaturation;
6) difference double digestion pET16b-Cu, Zn-SOD plasmid and boil two oligonucleotide chains of PTD4 of renaturation, glue carries out ligation after reclaiming, and connects product and is transformed into DH10B intestinal bacteria and extracts plasmid, cut, check order through enzyme and identify called after pET16b-PTD4-Cu, Zn-SOD plasmid;
7) by pET16b-PTD4-Cu, Zn-SOD recombinant plasmid transformed is in E.coli BL21 (DE3) intestinal bacteria, then add sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) to carry out shaking table shaking culture, induction PTD4-Cu, Zn-SOD expressing fusion protein;
8) N,O-Diacetylmuramidase of learning from else's experience adds ultrasonic degradation method and processes the supernatant solution of thalline after abduction delivering, utilize Ni-NTA affinity column under natural condition, add successively imidazoles binding buffer liquid, imidazoles rinsing damping fluid to relax imidazoles elution buffer, purifying PTD4-Cu, Zn-SOD fusion rotein.
Described Cu, Zn-SOD Auele Specific Primer comprises the upstream primer as shown in SEQ ID NO:4 and the downstream primer as shown in SEQ ID NO:5, wherein upstream primer 5 ' end is added with Xho I restriction endonuclease sites, downstream primer 5 ' end is added with BamH I restriction enzyme and cuts site, and containing terminator codon TTA.
Described PTD4 oligonucleotide sequence comprises the normal chain as shown in SEQ ID NO:6 and the minus strand as shown in SEQ ID NO:7, wherein 5 of normal chain ' end is added with Nde I restriction endonuclease sites, and containing initiator codon ATG, 5 of minus strand ' end is added with Xho I restriction endonuclease sites.
The described Cu through PCR reaction amplification, Zn-SOD cDNA fragment and pET16b carrier are cut site through Xho I and BamH I restriction enzyme respectively and are carried out double digestion.
Described pET16b-Cu, Zn-SOD plasmid carries out double digestion through Nde I and two restriction endonuclease sites of Xho I respectively with two oligonucleotide chains of PTD4 that boil renaturation.
Described pET16b-PTD4-Cu, Zn-SOD recombinant plasmid transformed is when adding sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) induction expressing fusion protein in E.coli BL21 (DE3), shaking table concussion frequency is 160-220rpm/min, temperature 20-37 ℃, IPTG final concentration is 0.2-1.0mM, induction time 1-6 hour.
Described binding buffer liquid imidazole concentration is 10mM, and rinsing damping fluid imidazole concentration is 20mM, and elution buffer imidazole concentration is 50-500mM.
The invention has the beneficial effects as follows:
1) novel PTD4-Cu of the present invention, the efficiency of Zn-SOD fusion rotein permeates cell membranes is very high, thereby can not be by the Cu of cytolemma by script, Zn-SOD transduces to cytolemma performance biological function, has greatly improved SOD catalysis superoxide anion radical (O
2 -) there is the efficiency of disproportionation reaction, make cell avoid O
2 -oxidative damage;
2) novel PTD4-Cu of the present invention, the PTD4 that the utilization of Zn-SOD fusion rotein has high membrane penetration effect improves Cu, the method of Zn-SOD permeates cell membranes is simple, efficient, safety, not only can not affect Cu, the biological activity of Zn-SOD, and fusion rotein can optimize native protein structure, produce new function, compare and there is lot of superiority with native protein;
3) novel PTD4-Cu of the present invention, the preparation method of Zn-SOD fusion rotein, building pET16b-PTD4-Cu, when Zn-SOD recombinant vectors, utilize transition vector pET16b-Cu, Zn-SOD is directly by PTD4 and Cu, and Zn-SOD two goal gene merge together, have greatly simplified the structure flow process of fusion gene;
4) novel PTD4-Cu of the present invention, the preparation method of Zn-SOD fusion rotein, has selected containing 6 histidine-tagged pET16b as expression vector, is conducive to make the pET16b-PTD4-Cu recombinating out, Zn-SOD gives expression to and 6 histidine-tagged target proteins that merge mutually, utilizes Ni
2+hold 6 histidine residues, can pass through Ni to target protein
2+post affinity chromatography carries out purifying, thereby has simplified separation and the purifying process of this albumen;
5) novel PTD4-Cu of the present invention, the preparation method of Zn-SOD fusion rotein is with respect to existing PTD-Cu, and the expression amount of Zn-SOD fusion rotein preparation method fusion rotein increases greatly.
Accompanying drawing explanation
Fig. 1 is pET16b-PTD4-Cu of the present invention, the structure schematic diagram of Zn-SOD RT-PCR expression vector;
Fig. 2 is pET16b-PTD4-Cu of the present invention, the design of graphics of Zn-SOD RT-PCR expression vector;
Fig. 3 is pET16b-PTD4-Cu of the present invention, the sequential analysis figure of Zn-SOD RT-PCR expression vector;
Fig. 4 is the PTD4-Cu after abduction delivering of the present invention, and the SDS-PAGE of Zn-SOD fusion rotein identifies figure;
Fig. 5 is the PTD4-Cu after purifying, and the Western blot of Zn-SOD fusion rotein identifies figure.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is described in detail.
Embodiment 1: a kind of novel PTD4-Cu, Zn-SOD fusion rotein, its nucleotide sequence as shown in SEQ ID NO:3, this novel PTD4-Cu, preparation method's concrete steps of Zn-SOD fusion rotein are as follows:
1) design Cu, Zn-SOD Auele Specific Primer and PTD4 oligonucleotide sequence:
Cu, Zn-SOD Auele Specific Primer comprises the upstream primer as shown in SEQ ID NO:4 and the downstream primer as shown in SEQ ID NO:5, wherein upstream primer 5 ' end is added with Xho I restriction endonuclease sites, downstream primer 5 ' end is added with BamH I restriction enzyme and cuts site, and containing terminator codon TTA.
PTD4 oligonucleotide sequence comprises the normal chain as shown in SEQ ID NO:6 and the minus strand as shown in SEQ ID NO:7, and wherein 5 of normal chain ' end is added with Nde I restriction endonuclease sites, and containing initiator codon ATG; 5 of minus strand ' end is added with Xho I restriction endonuclease sites.
2) react amplification Cu, Zn-SOD cDNA fragment by PCR;
3) choose the pcr amplification product of purifying and pET16b carrier respectively after Xho I and BamH I double digestion, glue reclaim by Cu, Zn-SOD gene directly inserts and in linearized vector pET16b, carries out ligation;
4) connect product be transformed into DH10B and extract plasmid, through enzyme cut, checking order is accredited as pET16b-Cu, Zn-SOD plasmid;
5) two oligonucleotide chains of PTD4 are boiled to renaturation;
6) respectively through Nde I and Xho I double digestion pET16b-Cu, Zn-SOD plasmid and boil two oligonucleotide chains of PTD4 of renaturation, glue directly inserts linearized vector pET16b-Cu by PTD4 gene after reclaiming, in Zn-SOD, carry out ligation, connecting product is transformed into DH10B and extracts plasmid, cut, check order through enzyme and identify called after pET16b-PTD4-Cu, Zn-SOD plasmid.
Be illustrated in figure 1 pET16b-PTD4-Cu, the structure schematic diagram of Zn-SOD RT-PCR expression vector, Fig. 2 is pET16b-PTD4-Cu, the design of graphics of Zn-SOD RT-PCR expression vector.This construction process utilizes transition vector directly by PTD4 and Cu, and Zn-SOD two goal gene merge together, have greatly simplified the structure flow process of fusion gene.The pET16b-PTD4-Cu building, Zn-SOD plasmid is convenient to again enzyme and is cut and evaluations of checking order, and reduces order-checking evaluation work, contains again Amp resistant gene simultaneously, can conveniently utilize Amp resistant panel to screen mono-clonal bacterium colony.Select containing 6 histidine-tagged pET16b as expression vector simultaneously, be conducive to make the pET16b-PTD4-Cu that recombinates out, Zn-SOD gives expression to and 6 histidine-tagged target proteins that merge mutually, utilizes Ni
2+hold 6 histidine residues, can be to the His-tag-PTD4-Cu expressing, Zn-SOD target protein passes through Ni
2+post affinity chromatography carries out purifying, thereby has simplified separation and the purifying process of this albumen.Be illustrated in figure 3 pET16b-PTD4-Cu, the sequential analysis figure of Zn-SOD RT-PCR expression vector.
7) by pET16b-PTD4-Cu, Zn-SOD recombinant plasmid transformed is in E.coli BL21 (DE3), then add sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) to carry out shaking table shaking culture, induction PTD4-Cu, Zn-SOD expressing fusion protein, shaking table concussion frequency is 30 ℃ of 200rpm/min, temperature, IPTG final concentration is 0.84mM, induction time 4 hours, be illustrated in figure 4 the PTD4-Cu after abduction delivering, the SDS-PAGE of Zn-SOD fusion rotein identifies figure.
8) N,O-Diacetylmuramidase of learning from else's experience adds ultrasonic degradation method and processes the supernatant solution of thalline after abduction delivering, utilize Ni-NTA affinity column under natural condition, adding successively imidazole concentration is the elution buffer that the binding buffer liquid of 10mM, rinsing damping fluid that imidazole concentration is 20mM and imidazole concentration are 250mM, purifying PTD4-Cu, Zn-SOD fusion rotein.In treating processes, thalline and lysate remain 0-4 ℃ of low temperature and add proteinase inhibitor PMSF, prevent proteolytic degradation, add Benzonase nuclease degradation nucleic acid, reduce lysate viscosity, prevent from stopping up nickel post, improve protein purification efficiency.Be illustrated in figure 5 the PTD4-Cu after purifying, the Western blot of Zn-SOD fusion rotein identifies figure.
Embodiment 2: a kind of novel PTD4-Cu, the preparation method of Zn-SOD fusion rotein, referring to embodiment 1, as different from Example 1 step 7) in shaking table concussion frequency be 160rpm/min, 20 ℃ of temperature, IPTG final concentration is 0.2mM, induction time 6 hours.Step 8) in elution buffer imidazole concentration be 50mM.
Embodiment 3: a kind of novel PTD4-Cu, the preparation method of Zn-SOD fusion rotein, referring to embodiment 1, as different from Example 1 step 7) in shaking table concussion frequency be 220rpm/min, 37 ℃ of temperature, IPTG final concentration is 1.0mM, induction time 2 hours.Step 8) in elution buffer imidazole concentration be 500mM.
In above three kinds of embodiment, embodiment 1 is preferred embodiment, proving by experiment, is that 200rpm/min, temperature are that 30 ℃, IPTG final concentration are 0.84mM, induction time PTD4-Cu while being 4h in shaking table concussion frequency, 7n-SOD fusion protein expression maximum; When elution buffer imidazole concentration is 250mM, target protein purification effect the best.
Extracorporeal biology experiment shows PTD4-Cu, Zn-SOD fusion rotein can be by cannot be by the Cu of cytolemma, Zn-SOD protein transduction is brought into play anti-oxidant function to cell, not only transduction efficiency is far away higher than PTD-Cu, Zn-SOD fusion rotein, and effect is obviously better than PTD-Cu, Zn-SOD fusion rotein.
More than show and described ultimate principle of the present invention, principal character and advantage of the present invention; above-mentioned embodiment and specification sheets are principle of the present invention; the present invention also has various changes and modifications without departing from the spirit and scope of the present invention, and these changes and improvements all fall in claimed scope of the present invention.The protection domain that the present invention requires is defined by claims and equivalent thereof.
Sequence table
Claims (8)
1. a novel PTD4-Cu, Zn-SOD fusion rotein, is characterized in that, the gene of this fusion rotein of encoding has the nucleotide sequence as shown in SEQ ID NO:3.
2. the novel PTD4-Cu of one as claimed in claim 1, the preparation method of Zn-SOD fusion rotein, is characterized in that, includes following steps:
1) design respectively Cu, Zn-SOD Auele Specific Primer and PTD4 oligonucleotide sequence;
2) react amplification Cu, Zn-SOD cDNA fragment by PCR;
3) PCR reaction product and pET16b carrier carry out ligation through double digestion, glue after reclaiming respectively;
4) connect product and be transformed into DH10B intestinal bacteria and extract plasmid, cut, check order through enzyme and identify called after pET16b-Cu, Zn-SOD plasmid;
5) two oligonucleotide chains of PTD4 are boiled to renaturation;
6) difference double digestion pET16b-Cu, Zn-SOD plasmid and boil two oligonucleotide chains of PTD4 of renaturation, glue carries out ligation after reclaiming, and connects product and is transformed into DH10B intestinal bacteria and extracts plasmid, cut, check order through enzyme and identify called after pET16b-PTD4-Cu, Zn-SOD plasmid;
7) by pET16b-PTD4-Cu, Zn-SOD recombinant plasmid transformed is in E.coli BL21 (DE3) intestinal bacteria, then add sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) to carry out shaking table shaking culture, induction PTD4-Cu, Zn-SOD expressing fusion protein;
8) N,O-Diacetylmuramidase of learning from else's experience adds ultrasonic degradation method and processes the supernatant solution of thalline after abduction delivering, utilize Ni-NTA affinity column under natural condition, add successively imidazoles binding buffer liquid, imidazoles rinsing damping fluid to relax imidazoles elution buffer, purifying PTD4-Cu, Zn-SOD fusion rotein.
3. the novel PTD4-Cu of one as claimed in claim 2, the preparation method of Zn-SOD fusion rotein, it is characterized in that, described Cu, Zn-SOD Auele Specific Primer comprises the upstream primer as shown in SEQ ID NO:4 and the downstream primer as shown in SEQ ID NO:5, wherein upstream primer 5 ' end is added with Xho I restriction endonuclease sites, and downstream primer 5 ' end is added with BamH I restriction enzyme and cuts site, and containing terminator codon TTA.
4. the novel PTD4-Cu of one as claimed in claim 2, Zn-SOD fusion rotein, it is characterized in that, described PTD4 oligonucleotide sequence comprises the normal chain as shown in SEQ ID NO:6 and the minus strand as shown in SEQ ID NO:7, wherein 5 of normal chain ' end is added with Nde I restriction endonuclease sites, and containing initiator codon ATG, 5 of minus strand ' end is added with Xho I restriction endonuclease sites.
5. the novel PTD4-Cu of one as claimed in claim 3, the preparation method of Zn-SOD fusion rotein, it is characterized in that, the described Cu through PCR reaction amplification, Zn-SOD cDNA fragment and pET16b carrier are cut site through Xho I and BamH I restriction enzyme respectively and are carried out double digestion.
6. the novel PTD4-Cu of one as claimed in claim 4, the preparation method of Zn-SOD fusion rotein, it is characterized in that, described pET16b-Cu, Zn-SOD plasmid carries out double digestion through Nde I and two restriction endonuclease sites of Xho I respectively with two oligonucleotide chains of PTD4 that boil renaturation.
7. the novel PTD4-Cu of the one as described in claim 5 or 6, the preparation method of Zn-SOD fusion rotein, it is characterized in that, described pET16b-PTD4-Cu, Zn-SOD recombinant plasmid transformed is when adding sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) induction expressing fusion protein in E.coli BL21 (DE3), shaking table concussion frequency is 160-220rpm/min, temperature 20-37 ℃, and IPTG final concentration is 0.2-1.0mM, induction time 1-6 hour.
8. the novel PTD4-Cu of one as claimed in claim 7, the preparation method of Zn-SOD fusion rotein, is characterized in that, and described binding buffer liquid imidazole concentration is 10mM, and rinsing damping fluid imidazole concentration is 20mM, and elution buffer imidazole concentration is 50-500mM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310317554.XA CN103789278A (en) | 2013-07-26 | 2013-07-26 | Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310317554.XA CN103789278A (en) | 2013-07-26 | 2013-07-26 | Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103789278A true CN103789278A (en) | 2014-05-14 |
Family
ID=50665337
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310317554.XA Pending CN103789278A (en) | 2013-07-26 | 2013-07-26 | Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103789278A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004039846A1 (en) * | 2002-10-31 | 2004-05-13 | Hallym University | Advanced cell-transducing transport domain-target protein-transport domain fusion protein and uses thereof |
| CN1712415A (en) * | 2005-05-20 | 2005-12-28 | 福州大学 | Connexin transduction structural domain and bioactive protein of auxiliary protein, its production and use |
| CN1908016A (en) * | 2006-08-24 | 2007-02-07 | 复旦大学 | Fusion protein with protein transduction structure field TAT-PTD and application thereof |
-
2013
- 2013-07-26 CN CN201310317554.XA patent/CN103789278A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004039846A1 (en) * | 2002-10-31 | 2004-05-13 | Hallym University | Advanced cell-transducing transport domain-target protein-transport domain fusion protein and uses thereof |
| CN1712415A (en) * | 2005-05-20 | 2005-12-28 | 福州大学 | Connexin transduction structural domain and bioactive protein of auxiliary protein, its production and use |
| CN1908016A (en) * | 2006-08-24 | 2007-02-07 | 复旦大学 | Fusion protein with protein transduction structure field TAT-PTD and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| FUKUHARA, R.等: "Pan troglodytes mRNA for Cu,Zu-superoxide dismutase, complete cds.", 《GENBANK登录号：AB087266.1》 * |
| H.Y. KWON，等: "Transduction of Cu,Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into mammalian cells", 《FEBS LETTERS》 * |
| 刘红，等: "酶解-超声法破碎大肠杆菌提纯包含体", 《重庆大学学报》 * |
| 陈庆，等: "分泌型PTD4－Apoptin融合蛋白诱导HepG2细胞凋亡", 《华中科技大学学报（医学版）》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brouillette et al. | TIM-1 mediates dystroglycan-independent entry of Lassa virus | |
| Dube et al. | The primed ebolavirus glycoprotein (19-kilodalton GP1, 2): sequence and residues critical for host cell binding | |
| Eschli et al. | Identification of an N-terminal trimeric coiled-coil core within arenavirus glycoprotein 2 permits assignment to class I viral fusion proteins | |
| Lavillette et al. | A proline-rich motif downstream of the receptor binding domain modulates conformation and fusogenicity of murine retroviral envelopes | |
| Bhattacharya et al. | Gag regulates association of human immunodeficiency virus type 1 envelope with detergent-resistant membranes | |
| JP5868999B2 (en) | Cost-effective method for expressing and purifying recombinant proteins in plants | |
| Vishwanathan et al. | Importance of the membrane-perturbing properties of the membrane-proximal external region of human immunodeficiency virus type 1 gp41 to viral fusion | |
| Usami et al. | The Nef-like effect of murine leukemia virus glycosylated gag on HIV-1 infectivity is mediated by its cytoplasmic domain and depends on the AP-2 adaptor complex | |
| WO2003093417A3 (en) | Lentiviral vector particles resistant to complement inactivation | |
| CN107286249A (en) | A kind of restructuring apoferritin nanocages of oligomerization polylysine modification and its preparation | |
| WO2007030803A3 (en) | Method for preparing trimeric proteins | |
| US20240076690A1 (en) | Viral vectors and uses thereof | |
| CA2839633A1 (en) | Peptides with viral infection enhancing properties and their use | |
| Vabret et al. | Large-scale nucleotide optimization of simian immunodeficiency virus reduces its capacity to stimulate type I interferon in vitro | |
| Poumbourios et al. | Functional evolution of the HIV-1 envelope glycoprotein 120 association site of glycoprotein 41 | |
| Pace et al. | R5 HIV env and vesicular stomatitis virus G protein cooperate to mediate fusion to naive CD4+ T Cells | |
| WO2009087110A1 (en) | Secretable hiv entry inhibitory peptides for therapy of hiv infection | |
| CN103194477B (en) | Fused type prokaryotic expression vector and construction method and application thereof | |
| Kiefer et al. | Production and secretion of functional SARS-CoV-2 spike protein in Chlamydomonas reinhardtii | |
| CN105018507A (en) | Phage vector for dual-epitope display and construction method thereof | |
| Palermo et al. | Fusion promotion by a paramyxovirus hemagglutinin-neuraminidase protein: pH modulation of receptor avidity of binding sites I and II | |
| CN102250952A (en) | Vector for mediating high-efficiency expression of exogenous gene in cells of mammal and use thereof | |
| CN103789278A (en) | Novel protein transduction domain (PTD)4-Cu and Zn-superoxide dismutase (SOD) fusion protein and preparation method thereof | |
| EP2558128A2 (en) | Methods and compositions for treating hiv | |
| CN110734930A (en) | recombinant lentivirus vectors and recombinant lentiviruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140514 |
|
| RJ01 | Rejection of invention patent application after publication |