CN103788211A - Bifunctional peptide, composite formed by the bifunctional peptide and nucleic acid molecule, and pharmaceutical composite used for treating tumor - Google Patents
Bifunctional peptide, composite formed by the bifunctional peptide and nucleic acid molecule, and pharmaceutical composite used for treating tumor Download PDFInfo
- Publication number
- CN103788211A CN103788211A CN201210432105.5A CN201210432105A CN103788211A CN 103788211 A CN103788211 A CN 103788211A CN 201210432105 A CN201210432105 A CN 201210432105A CN 103788211 A CN103788211 A CN 103788211A
- Authority
- CN
- China
- Prior art keywords
- peptide
- difunctional
- tumor
- difunctional peptide
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a bifunctional peptide. The bifunctional peptide comprises a tumor-cell apoptosis peptide and a cell-penetrating peptide. The invention also relates to a composite formed by the bifunctional peptide and a nucleic acid molecule and applications of the composite in treating tumor. The invention also relates to a pharmaceutical composite which comprises the bifunctional peptide, a tumor treating gene and a chemotherapeutic medicine and is used for treating tumor and tumor multidrug resistance, and applications of the pharmaceutical composite. The bifunctional peptide can induce tumor-cell apoptosis and promote the peptide and the composites thereof to penetrate through cytomembranes. The pharmaceutical composite combines the bifunctional peptide, the tumor treating gene and the chemotherapeutic medicine, and is capable of reducing the dosage of the chemotherapeutic medicine so as to significantly reduce toxic and side effects on organisms, inhibiting growth of tumor cells and effectively resisting the tumor multidrug resistance.
Description
Technical field
The invention belongs to biomedicine field, more specifically, the present invention relates to a kind of difunctional peptide, described difunctional peptide can cancer cell specific induction of apoptosis and promotion peptide and mixture leap cytolemma thereof.Meanwhile, the composition that the invention still further relates to a kind of mixture being formed by described difunctional peptide and nucleic acid molecule, comprises described mixture and anticancer chemotherapeutic agent, and their purposes.
Background technology
Malignant tumour is all threatening the mankind's life all the time.According to the World Health Organization, the sickness rate of cancer raises year by year, and presents rejuvenation trend.But, in clinical tumor chemotherapy process, although new chemotherapeutics constantly occur, chemotherapy regimen is updated, and still has to exceed 90% cancer patients and die from tumor drug resistance in various degree; On the other hand, in the time that malignant tumor patient is carried out to chemotherapy, the drug dose giving is generally " maximal dose that can tolerate " clinically, and most antitumor drug lacks the selectivity to tumour cell, in killing tumor cell, also produce serious systemic adverse reactions.Therefore; how in guaranteeing the effective killing off tumor cells of chemotherapeutics; pass through variety of way; reduce the consumption of chemotherapeutics; reduce toxic side effects; normal cell, tissue and organ with protection body avoid the infringement of cell toxicity medicament, are one of important topics of studying of current Medical Research Work persons.
Meanwhile, tumor tissues is very complicated, includes each group, each phase and various tumour cell.For example, tumour is by proliferating-cell population (stem cell), and non-proliferating-cell population (G0 phase cell), forms without multiplication capacity cell mass; In addition also has the mdr cell group who produces after chemotherapy.Wherein, proliferating-cell population (stem cell) is made up of G1 phase (pre-synthesis phase of DNA), S phase (DNA synthesis phase), G2 phase (prophase of cell division) and M phase (cell division phase) again.And the mechanism of action of tumor chemotherapeutic drug is single mostly, so be difficult to suppress and kill tumour with a kind of medicine.
National cancer institute proposes, and the treatment of cancer can be used for reference acquired immune deficiency syndrome (AIDS), uses separately a kind of effect of drugs very poor, and the effect while use of combining is very likely enhanced, and therefore for the treatment of cancer, also can take therapeuticcocktail of anti-retrovirals.In published document, Thierry Conroy etc. has studied the patient of 342 cancer of pancreas primary stages and has found, with oxaliplatin (Oxaliplatin), irinotecan (Irinotecan), Calciumlevofolinate (Leucovorin) and four kinds of chemotherapy drugs in combination medications of Fluracil (fluorouracil) are compared with single use gemcitabine (Gemcitabine), can improve the average survival rate of cancer of pancreas patient up to 6 one-tenth (referring to document Conroy T, Desseigne F, Ychou M, et al.FOLFIRINOX versus gemcitabine for metastatic pancreatic cancer.The New England Journal of Medicine 2011, 364:1817-1825), the people such as Massague study discovery and have suppressed four simultaneously and cause mammary cancer cancer metastasis can more effectively stop cancer metastasis (referring to document Gupta GP compared with once only suppressing a gene to the gene of lung, Nguyen DX, Chiang AC, Bos PD, Kim JY, Nadal C, Gomis RR, Manova-Todorova K, Massagu é J.Mediators of vascular remodelling co-opted for sequential steps in lung metastasis.Nature 2007,446:765-770), van Vlerken etc. can be apoptosis-induced ceramide and the coupling of chemotherapeutic taxol (referring to document van Vlerken LE, Duan Z, Little SR, Seiden M, Amiji MM.Augmentation of therapeutic efficacy in drug-resistant tumor models using ceramide coadministration in temporal-controlled polymer-blend nanoparticle delivery systems.The AAPS journal 2010,12:171-180), traditional Chinese medicine ingredients TANSHINONES is introduced Zorubicin multidrug resistance cell by Lee etc., can strengthen mdr cell engulfing (referring to document Lee WYW Zorubicin, Cheung CCM, Liu KWK, Fung KP, Wong J, Lai PBS, Yeung JHK.Cytotoxic effects of tanshinones from salvia miltiorrhiza on doxorubicin-resistant human liver cancer cells.Journal ofnatural products 2010,73:854-859).These therapeuticcocktail of anti-retrovirals, combine two kinds and above pharmacological agent malignant tumour, rely on the drug action between medicine complement one another and strengthen, and oneself embodies obvious effect clinically.
But, also studies have reported that, " cocktail " system being all made up of chemotherapeutic drug has the danger that increases side effect, the patient who accepts this therapy has produced more various side effect, comprise: pain, peripheral nerve imperception, there is no appetite, suffer from diarrhoea and lose weight etc., this indicating cancer therapy from now on developing direction will from by chemotherapeutic drug direct killing cancer cells to by chemicals, genomic medicine, molecular biology targeted drug, natural plant extracts etc. join together to carry out therapeuticcocktail of anti-retrovirals, control the development of propagation and the tumour of cancer cells, the even generation of prophylaxis of tumours.
Summary of the invention
For solving the technical problem existing in prior art, the inventor has carried out research extensively and profoundly, finally obtains the present invention.
An object of the present invention is to provide a kind of difunctional peptide, described difunctional peptide is the recombinant polypeptide that contains cancer cell-apoptosis peptide and wear film peptide, it can cross over cytolemma with promotion peptide and mixture thereof by cancer cell specific induction of apoptosis, wherein, the positively charged film peptide moiety of wearing not only can be used as non-viral gene vector parcel therapeutic gene, thereby but also can promote whole polypeptide and mixture enters tenuigenin in conjunction with the negative charge on microbial film phosphoric acid salt end group.In difunctional peptide of the present invention, described cancer cell-apoptosis peptide is positioned at the N end of described difunctional peptide, described in wear film peptide and be positioned at the C end of described difunctional peptide.
Another object of the present invention is to provide the purposes of described difunctional peptide as non-viral gene vector.
Another object of the present invention is to provide the mixture being formed by described difunctional peptide and nucleic acid molecule.
Another object of the present invention is to provide the purposes of the mixture of described difunctional peptide and nucleic acid molecule formation.
An also object of the present invention is to provide a kind of pharmaceutical composition for the treatment of tumour, thereby this pharmaceutical composition not only can reduce the dosage of chemotherapeutics and obviously reduce its toxic side effect to organism, can suppress the growth of tumour cell better simultaneously, and according to the theory of " resistance is that apoptosis suppresses ", also more effectively to antineoplastic multidrug resistance.
In to the research of tumour mechanism, find the albumen that some have effect of crucial importance in apoptotic approach.Verhagen AM and Du C etc. have found Smac albumen (second mitochondrial derived activator of caspase).When body is accepted after apoptotic stimulus, Smac albumen discharges into tenuigenin from plastosome intermembranous space, by with multiple IAP(IAP) interact, remove the aspartic acid proteolytic ferment containing halfcystine to caspase(of IAP IAP mediation) start the inhibition of enzyme and effect enzyme.Ripe Smac albumen is only exercised its apoptosis-promoting effect and is not caused the apoptosis of healthy cell in apoptosis is subject to the tumour cell of abnormal retardance.Meanwhile, the aminoterminal tetrapeptide of Smac (Ala-Val-Pro-IIe, AVPI) can be brought into play the functionally active of most of combination and inhibition IAPs.It is contemplated that, use from Smac protein derived, can neutralize and weaken the restraining effect of IAPs for caspases containing the peptide molecule of AVPI, reach the effect similar to Smac, make tumour cell become responsive and be more prone to be killed for apoptosis.
Along with the development and improvement of oncomolecularbiology and Immunology and technology, people recognize that cancer is the genopathy of the multiple front oncogene activation in a kind of inherence and cancer suppressor gene inactivation.Therefore, gene therapy is significant for thorough radical cure tumour.The type of Journal of Gene Medicine to used carrier in clinical gene therapy in 2011 and the situation of each phase gene clinical trial are investigated, in the gene of all application, gene for oncotherapy has accounted for very large ratio, as suicide gene (suicide gene), tumor suppressor gene (tumor supressor gene) etc.According to the literature, p53 gene (human P 53 encoder block is:Catggaggag, ccgcagtcag, atcctagcgt, cgagccccct, ctgagtcaggaaacattttcagacctatgg, aaactacttc, ctgaaaacaa, cgttctgtcc, cccttgccgt, cccaagcaat, ggatgatttg, atgctgtccc, cggacgatat, tgaacaatgg, ttcactgaag, acccaggtcc, agatgaagct, cccagaatgccagaggctgc, tccccgcgtg, gcccctgcac, cagcagctcc, tacaccggcg, gcccctgcac, cagccccctcctggcccctg, tcatcttctg, tcccttccca, gaaaacctac, cagggcagct, acggtttccg, tctgggcttcttgcattctg, ggacagccaa, gtctgtgact, tgcacgtact, cccctgccct, caacaagatg, ttttgccaactggccaagac, ctgccctgtg, cagctgtggg, ttgattccac, acccccgccc, ggcacccgcg, tccgcgccatggccatctac, aagcagtcac, agcacatgac, ggaggttgtg, aggcgctgcc, cccaccatga, gcgctgctcagatagcgatg, gtctggcccc, tcctcagcat, cttatccgag, tggaaggaaa, tttgcgtgtg, gagtatttggatgacagaaa, cacttttcga, catagtgtgg, tggtgcccta, tgagccgcct, gaggttggct, ctgactgtaccaccatccac, tacaactaca, tgtgtaacag, ttcctgcatg, ggcggcatga, accggaggcc, catcctcaccatcatcacac, tggaagactc, cagtggtaat, ctactgggac, ggaacagctt, tgaggtgcgt, gtttgtgcctgtcctgggag, agaccggcgc, acagaggaag, agaatctccg, caagaaaggg, gagcctcacc, acgagctgcccccagggagc, actaagcgag,Cactgcccaa caacaccagc tcctctcccc agccaaagaa gaaaccactggatggagaat atttcaccct tcagatccgt gggcgtgagc gcttcgagat gttccgagag ctgaatgaggccttggaact caaggatgcc caggctggga aggagccagg ggggagcagg gctcactcca gccacctgaagtccaaaaag ggtcagtcta cctcccgcca taaaaaactc atgttcaaga cagaagggcc tgactcagactga) mutation rate very high (>50%) in the people source tumours such as colon cancer, breast cancer and liver cancer.With the p53 gene of normal p53 gene substitution sudden change, can recover the DNA reparation of tumour cell or the ability of repairing failure startup apoptosis, current, in the treatment of the people source tumours such as colorectal carcinoma, mammary cancer, liver cancer, p53 has obtained good effect.
The present invention introduces cancer cell-apoptosis peptide AVPI and therapeutic gene p53 by research in chemotherapeutics unitary system, obtains a kind of littlely to ordinary cells toxicity, and tumour and multidrug-resistant carcinoma cell is had to the therapy system of high efficiency cell toxic action.Inventor's discovery, single AVPI peptide fragment is difficult for permeates cell membranes, is difficult to arrive in cell play a role.Therefore, strengthening mdr cell is the key of apoptosis peptide being introduced to oncotherapy system to the phagocytic activity of AVPI.
Therefore, according to an aspect, the invention provides a kind of difunctional peptide, described difunctional peptide comprises cancer cell-apoptosis peptide and wears film peptide.
All there is the effect that can promote peptide chain to pass cytolemma owing to thering is the bioactive film peptide of wearing, therefore the film peptide of wearing described in the application includes but not limited to, be rich in cationic eight poly arginines, this is that the two can promote cell engulfing apoptosis peptide because having the bioactive film peptide of wearing can comprise and be rich in wearing film peptide and having the amphipathic film peptide of wearing of basic aminoacids.But wear film peptide sequence for what make this section of peptide chain there is the effect of parcel, compression, transhipment foreign DNA, can choose to be rich in basic aminoacids simultaneously.
In the present invention, preferably, described cancer cell-apoptosis peptide can be the N terminal sequence AVPI of smac albumen; The described film peptide of wearing can be poly arginine R
n(n=5-12).
In the present invention, more preferably, the aminoacid sequence of described difunctional peptide can be AVPIRRRRRRRR.
In the present invention, above-mentioned difunctional peptide can pass through the ordinary skill in the art (for example, solid-phase synthesis) preparation.Be specifically as follows: the amino acid dry DMF of 9-fluorenylmethyloxycarbonyl (Fmoc) protection is dissolved, add catalyzer, with resin-phase mutual effect, it is fully fixed on resin.Seal reactive chlorine, slough Fmoc protecting group.Amino acid, 2-(7-azo benzotriazole)-tetramethyl-urea phosphofluoric acid ester (HBTU), I-hydroxybenzotriazole (HOBt) and the appropriate DIPEA (DIEA) of getting a certain amount of Fmoc protection carry out condensation.After check amino acid reacts completely, slough Fmoc protecting group.Repeating step, completes amino acid needed condensation successively.After synthetic, washing resin, vacuum-drying.With cutting peptide reagent, peptide is cut, collect filtrate, concentrated by rotary evaporation, precipitation, suction filtration, washing, dry, obtain product.
Therefore, the present invention, in the bioactive situation of not destroying apoptosis peptide, provides a kind of use to wear the modifying method that film peptide is modified.What be rich in alkaline amino acid residue wears film peptide fragment easily and cytolemma effect help whole peptide chain to enter cell, can improve thus the intake of cell to tumor death peptide.
Therefore, the peptide sequence of difunctional peptide of the present invention can, simultaneously as the ornamental equivalent of genophore and apoptosis peptide, make therapeutic gene and apoptosis Toplink enter same cell, collaborative playing a role simultaneously.
According to another aspect, the invention provides the purposes of described difunctional peptide as non-viral gene vector.
According to another aspect, the invention provides the mixture being formed by above-mentioned difunctional peptide and nucleic acid molecule.Described nucleic acid molecule comprises DNA, antisense oligonucleotide, RNA etc.For example, reporter gene, oncotherapy gene (for example, p53 gene, tumor suicide gene, tumor-inhibiting factor gene, Angiostatin gene etc.), small molecules interference RNA etc.
The preparation method of above-mentioned mixture comprises the following steps: above-mentioned difunctional peptide and nucleic acid molecule are dissolved respectively, then mix, leave standstill, make the mixture being formed by difunctional peptide and nucleic acid molecule.
Particularly, the first Tris-HCl damping fluid dilution with 40mM by nucleic acid molecule, is dissolved in difunctional peptide in NaCl solution (150mM, pH 7.4) filtration sterilization.Then this solution is directly mixed with nucleic acid solution weight ratio (w/w) as required, use NaCl solution dilution, vortex concussion 5s mixes, be prepared into required complex solution, this complex solution is left standstill under 37 ℃ of environment to half an hour, obtain the mixture that difunctional peptide and nucleic acid molecule form.In the present invention, the mass ratio of described difunctional peptide and nucleic acid molecule is preferably 10:1-50:1, more preferably 30:1.
In addition, the present invention also provides a kind of difunctional peptide with long alkyl chain, and it can be used as amphipathic micella and comes the anticancer chemotherapeutic agent of load and/or nucleic acid molecule.
In the present invention, the described difunctional peptide with long alkyl chain can be the difunctional peptide that increases the linear alkyl chain (being preferably dodecyl) of C12 ~ C18 on the C end of the peptide chain of above-mentioned difunctional peptide.
In the present invention, the described difunctional peptide with long alkyl chain can spontaneously form micella in the aqueous solution, and wherein, the hydrophobic core of aliphatic chain composition micella, can carry anticancer chemotherapeutic agent for bag.
In the present invention, described anticancer chemotherapeutic agent includes but not limited to, Zorubicin, taxol, 5 FU 5 fluorouracil etc.
In the present invention, the preparation method of the described difunctional peptide with long alkyl chain can reference standard " polypeptide solid-state reaction method " manually synthetic (reference: Fields, G.B., and Noble, R.L. (1990) Solid phase peptide synthesis utilizing 9-fluorenylmethoxycarbonyl amino acids.Int.J.Pept.Res.35,161-214).Can be specifically that polypeptide chain is on the chloro-trityl chloride resin of 2-, extends to aminoterminal from carboxyl terminal.The DMF solution that is dissolved with Fmoc-ADDA-OH by adding carries out condensation reaction, and adds DIEA for catalyzed reaction, and first amino acid/11 2-aminoundecane-earboxylic acid of peptide chain is fixed on resin.After this in the time connecting amino-acid residue prolongation peptide chain, all adopt the amino acid of Fmoc protection.
Therefore, the invention provides and a kind ofly can wrap the difunctional peptide micella that carries anticancer chemotherapeutic agent, it comprises the above-mentioned difunctional peptide with long alkyl chain and anticancer chemotherapeutic agent.
In the present invention, the described preparation method that can wrap the difunctional peptide micella that carries anticancer chemotherapeutic agent can be: the above-mentioned difunctional peptide with long alkyl chain and anticancer chemotherapeutic agent are dissolved in dimethyl sulfoxide (DMSO) (DMSO), make by dialysis.
Therefore, the invention provides and a kind ofly carry the difunctional peptide micella of anticancer chemotherapeutic agent and the mixture that nucleic acid molecule forms by above-mentioned can bag.
Therefore, difunctional peptide of the present invention is the peptide class that a kind of sequence comes from nature, good biocompatibility, as novel non-viral gene vector, can wrap up, compresses and transport oncotherapy gene.
According to another aspect, the invention provides above-mentioned difunctional peptide and nucleic acid molecule and the anticancer chemotherapeutic agent purposes in the medicine for the preparation for the treatment of tumour.
In the present invention, described tumour comprises all solid tumors, and preferably, described tumour comprises melanoma, mammary cancer, cervical cancer etc., but is not limited to above-mentioned tumour.
In the present invention, described anticancer chemotherapeutic agent includes but not limited to, Zorubicin, taxol, 5 FU 5 fluorouracil etc.
According to another aspect, the invention provides a kind ofly for to pharmaceutical composition antitumor and/or tumor multi-medicine drug-resistant phenomenon, described pharmaceutical composition comprises: above-mentioned difunctional peptide, oncotherapy gene and anticancer chemotherapeutic agent.Wherein, preferably, in pharmaceutical composition, the shared mass percent of described difunctional peptide can be 20%-85%.
In the present invention, described difunctional peptide can reach tumor death peptide and oncotherapy gene are effectively transported to the object in cell simultaneously; With chemotherapeutics coupling, reach increase curative effect, reduce the effect of chemotherapeutic consumption minimizing toxic side effect simultaneously.
Meanwhile, the invention provides a kind of above-mentioned method for the pharmaceutical composition to antitumor and/or tumor multi-medicine drug-resistant phenomenon of preparing, comprise the following steps:
(a) synthetic described difunctional peptide;
(b) the C end of the difunctional peptide optionally, obtaining in step (a) is introduced targeting peptides;
(c) using the difunctional peptide of gained as carrier, form mixture with nucleic acid molecule, wherein, the mass ratio of difunctional peptide and nucleic acid molecule is 50:1-10:1, preferably 30:1;
(d) in the mixture obtaining in step (c), introduce anticancer chemotherapeutic agent, the weight percent that chemotherapeutic agent accounts for described pharmaceutical composition is 20%-80%.
In the present invention, preferably, described in step (b), the sequential structure of targeting peptides comprises RGD, CREKA, SMSIARL etc.
In the present invention, preferably, chemotherapeutic agent can be to be widely used in clinical therapy of tumor, but toxic side effect is very strong, and the Zorubicin of existing numerous cancer cells to its generation resistance, but is not limited to Zorubicin.
In addition, it is a kind of for to pharmaceutical composition antitumor and/or tumor multi-medicine drug-resistant phenomenon that the present invention also provides, and described pharmaceutical composition comprises: the above-mentioned difunctional peptide with long alkyl chain, oncotherapy gene and anticancer chemotherapeutic agent.
Meanwhile, the invention provides a kind of above-mentioned method for the pharmaceutical composition to antitumor and/or tumor multi-medicine drug-resistant phenomenon of preparing, comprise the following steps:
(a) prepare the above-mentioned difunctional peptide with long alkyl chain, form difunctional peptide micella;
(b) the difunctional peptide micella by blank micelle medicine carrying method or dialysis method, step (a) being obtained is prepared into the medicine carrying polypeptide micella that carries anticancer chemotherapeutic agent;
(c) medicine carrying polypeptide micella step (b) being obtained and oncotherapy gene are compound obtains described pharmaceutical composition.
The sequence of the difunctional peptide micella that preferably, step (a) obtains is AVPIRRRRRRRRC
12.
Of the present invention for to pharmaceutical composition antitumor and/or tumor multi-medicine drug-resistant phenomenon, have the following advantages: on the one hand, the difunctional peptide class carrier of Novel non-toxic can be transported to apoptosis peptide and therapeutic gene in tumour cell simultaneously; On the other hand, after apoptosis peptide and therapeutic gene are introduced, start tumor death program, and increase the susceptibility of tumour cell to chemotherapeutic, now combine the chemotherapeutics of low dosage, may reach the effect of efficacy enhancing and toxicity reducing completely.
(1) block the synthetic chemotherapeutic drug Zorubicin of nucleic acid and the apoptosis peptide combined utilization of cancer cell specific induction of apoptosis, can make cell more responsive to chemotherapeutic agent by apoptosis peptide, can play synergistic antitumor effect.From preliminary experiment, this synergy especially shows in the mdr cell of height adriamycin-resistant.
(2) utilize the cation amino acid sequence electrostatical binding therapeutic gene of modifying apoptosis peptide to enter after cell, by revising mutator gene, cancer cell specific induction of apoptosis, can reach the collaborative effect that suppresses tumor propagation of medicine and gene.The treatment of gene may become one of method of radical cure malignant tumour at last.
(3) the basic aminoacids sequence (R in difunctional peptide
8) in this individual system, bring into play triple role: 1., as wearing film peptide, carry apoptosis peptide sequence and enter cell; 2. as cationic peptide, the therapeutic gene p53 of composite band negative charge; 3. as wearing film peptide, it enters one of mechanism of cytolemma is the destruction that the charge effect between polypeptide and film bilayer causes bilayer, Zorubicin likely enters in cell by temporary transient hole, offsets P-gp albumen pump the pumping Zorubicin of mdr cell.
(4) in whole pharmaceutical composition, apoptosis peptide and therapeutic gene are all to ordinary cells nontoxicity, simultaneously due to the synergy of the two and Zorubicin coupling, Zorubicin can be issued to better effect at less dosage, thereby has reduced the toxic side effect of chemotherapeutics and the possibility of cell generation multidrug resistance.
(5) when Zorubicin enters this individual system by the mode of physical blending, the ratio of three kinds of compositions and the sequencing adding and interval time in the easier hierarchy of control.
(6), when Zorubicin enters this individual system by carrier micelle, can guarantee chemotherapeutics, therapeutic gene, apoptosis peptide enters same cell simultaneously, and can resist better tumor drug resistance phenomenon.
The present invention also provides for the purposes at the medicine for the preparation for the treatment of tumour to the pharmaceutical composition of antitumor and tumor multi-medicine drug-resistant phenomenon.
Wherein, described tumour comprises normal tumour and drug-resistant tumor.
Wherein, described tumour comprises all solid tumors, and preferably, described tumour comprises melanoma, mammary cancer, cervical cancer etc., but is not limited to above-mentioned tumour.
Simultaneously, our research shows, theory for popular in recent years " resistance is that apoptosis suppresses " is come antineoplastic resistance, by polypeptide as carrier, transhipment apoptosis peptide and therapeutic gene, the apoptosis mechanism of regulation and control cancer cells self is not only effective, more importantly can not cause new toxic side effects, also have the possibility of certain prophylaxis of tumours multidrug resistance.
Accompanying drawing explanation
Fig. 1 is the structure iron of the AVPIRRRRRRRR in embodiment 1 produced according to the present invention.
Fig. 2 is the preparation figure of the 12－aminolauric acid of the Fmoc protection in embodiment 2 produced according to the present invention.
Fig. 3 uses the mechanism figure of pharmaceutical composition according to the present invention to antitumor and tumor multi-medicine drug-resistant.
Fig. 4 is the grain-size graph of the AVPIRRRRRRRR/p53 in EXPERIMENTAL EXAMPLE 1 according to the present invention.
Fig. 5 is the potential ph diagram ph of the AVPIRRRRRRRR/p53 in EXPERIMENTAL EXAMPLE 1 according to the present invention.
Fig. 6 is the gene transfection result figure of the AVPIRRRRRRRR/pGL-3 in EXPERIMENTAL EXAMPLE 1 according to the present invention.
Fig. 7 be according to the present invention the difunctional peptide AVPIRRRRRRRR in EXPERIMENTAL EXAMPLE 2 to ordinary cells 293T, the inhibition of cancer cells HeLa, MCF-7 and resistance cancer cells MCF-7/ADR propagation.
Fig. 8 is the inhibition to resistance cancer cells MCF-7/ADR propagation when the AVPI in EXPERIMENTAL EXAMPLE 2 and chemotherapeutics DOX coupling according to the present invention.
Fig. 9 is the difunctional peptide AVPIRRRRRRRR in EXPERIMENTAL EXAMPLE 2 and the inhibition of chemotherapeutics to resistance cancer cells MCF-7/ADR propagation according to the present invention.
Figure 10 is the difunctional peptide in EXPERIMENTAL EXAMPLE 2 and the mixture of therapeutic gene, the i.e. inhibition of AVPIRRRRRRRR/p53 to common cancer cells and resistance cancer cell multiplication according to the present invention.
Figure 11 is the in vitro effects of the pharmaceutical composition in EXPERIMENTAL EXAMPLE 2 according to the present invention.The inhibition of the pharmaceutical composition that comprises apoptosis peptide AVPIRRRRRRRR, therapeutic gene and chemotherapeutics to ordinary cells 293T cell proliferation.
Figure 12 is the in vitro effects of the pharmaceutical composition in EXPERIMENTAL EXAMPLE 2 according to the present invention.The inhibition of the pharmaceutical composition that comprises difunctional peptide AVPIRRRRRRRR, therapeutic gene and chemotherapeutics to cancer cells HeLa cell proliferation.
Figure 13 is the AVPIRRRRRRRRC in EXPERIMENTAL EXAMPLE 2 according to the present invention
12the result figure of micelle-forming concentration.
Figure 14 is the in vitro effects of the pharmaceutical composition in EXPERIMENTAL EXAMPLE 2 according to the present invention.Comprise and contain C
12the difunctional peptide AVPIRRRRRRRRC of long linear alkyl chain
12, therapeutic gene and chemotherapeutics the inhibition of pharmaceutical composition to cancer cells HeLa cell proliferation.
Figure 15 is that the pharmaceutical composition that comprises difunctional peptide AVPIRRRRRRRR, therapeutic gene and chemotherapeutics in EXPERIMENTAL EXAMPLE 3 is (wherein according to the present invention, the dosage of Zorubicin is 0.5mg/kg, administering mode be every two days intratumor injections once) tumor suppression situation to lotus B16 solid tumor C57 mouse.
Figure 16 is the pharmaceutical composition in EXPERIMENTAL EXAMPLE 3 according to the present invention, comprises and contains C
12the difunctional peptide AVPIRRRRRRRRC of long linear alkyl chain
12, therapeutic gene and chemotherapeutics (wherein, the dosage of Zorubicin is 0.5mg/kg, administering mode be every two days intratumor injections once) the inhibition situation of gross tumor volume to lotus B16 solid tumor C57 mouse.
Figure 17 is the tumour photo of the each group of the pharmaceutical composition in EXPERIMENTAL EXAMPLE 3 according to the present invention.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated, below embodiment the present invention is only described by way of example.But these embodiment also do not mean that any restriction in addition to the present invention.Clearly, those of ordinary skills can, in scope of the present invention and essence, carry out various accommodations and modification to the present invention.Need to be appreciated that, this invention is intended to be encompassed in the flexible and modification that appended claims comprises.
Reagent and medicine
Amino each seed amino acid, the benzotriazole-N being protected by 9-fluorenylmethyloxycarbonyl; N; the chloro-trityl chloride resin of N ' N '-tetramethyl-urea hexafluorophosphate (HBTU) and 2-(2-Chlorotrityl chloride resin; 100 ~ 200 orders; substitution value 0.4mmol/g; 1%DVB) be purchased from the biochemical company limited of Shanghai gill, directly use.Piperidines (Piperidine), trifluoroacetic acid (TFA), 1，2-ethandithiol (EDT), phenol, stearic acid, all purchased from chemical reagents corporation of traditional Chinese medicines group (Shanghai), directly use.Thioanisole (Thioanisole) is buied in Acros.Diisopropylethylamine (DIEA), DMF (DMF) and methylene dichloride (DCM), purchased from Solution on Chemical Reagents in Shanghai company, add anhydrous magnesium sulfate drying, after heavily steaming, use.Zorubicin (Doxorubicin, DOX) is purchased from Zhejiang Haizheng Pharmaceutical Co company.People source cervical cancer cell (HeLa), human embryos nephrocyte (293T), mouse melanin tumor cell (B16) is purchased from Chinese Typical Representative culture collection center (Wuhan).DMEM cell culture medium dry powder, tetrazolium bromide (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide, MTT), trypsin Trypsin), foetal calf serum (FBS), dual anti-(penicillin-streptomycin) buys from Gibco and Invitrogen respectively.
Preparation Example 1
Difunctional peptide AVPIRRRRRRRR's is synthetic
A: get the dichloro trityl chloride resin (2-chlorotrityl chloride resin) of 1g to polypeptide synthesizer (Aldrich fritted filter funnel), add dry dimethyl formamide (DMF) to soak resin half an hour, make it fully swelling, finally discharge solvent DMF.
B: Fmoc-Arg (the pbf)-OH DMF that takes two equivalents dissolves, then this solution is transferred in the polypeptide synthesizer that upper step contains the resin of processing, add again catalyzer diisopropylethylamine (DIEA (M=129.25), >6eq.), under room temperature, allow Fmoc-Arg (pbf)-OH and resin-phase mutual effect 1.5 hours, it is fully fixed on resin.
C: use DMF washing resin.
D: methyl alcohol sealing reactive chlorine: methyl alcohol/DMF (volume ratio 1:4) reacts 30-40min with the DIEA of 6 equivalents.DMF washes resin.
E: add 20% piperidines/DMF (V/V) solution of 20mL in the resin of previous step, reaction 30min, sloughs Fmoc protecting group.
F: use DMF washing resin, whether out exposed with triketohydrindene hydrate check amino.
G: Fmoc-Arg (the pbf)-OH that takes 2 equivalents, benzotriazole-N, N, N ', N '-tetramethyl-urea hexafluorophosphate (HBTU), I-hydroxybenzotriazole (HOBt) is in weighing bottle, dissolve with DMF, this solution is transferred in upper step polypeptide synthesizer after treatment, then adds appropriate DIEA(>4eq.), condensation reaction 1.5 hours.
H: use DMF washing resin.Whether react completely with triketohydrindene hydrate check amino, colourlessly show that condensation can carry out next operation completely if aobvious; If aobvious blue, be condensed to again to verify as and colourlessly can carry out next operation.
I: the 20% piperidines/DMF(V/V=1/4 that adds 20ml) solution is in the resin of previous step, and reaction 30min, sloughs Fmoc protecting group.
J: use DMF washing resin, examine look with triketohydrindene hydrate.
K: repeat e, f, g, h operation completes Fmoc-Arg (pbf)-OH successively, Fmoc-Arg (pbf)-OH, Fmoc-Arg (pbf)-OH, Fmoc-Arg (pbf)-OH, Fmoc-Arg (pbf)-OH, Fmoc-Arg (pbf)-OH, Fmoc-Ile-OH, Fmoc-Pro-OH, Fmoc-Val-OH, the condensation of Fmoc-Ala-OH.
L: use DMF washing resin, whether react completely with triketohydrindene hydrate check amino, colourlessly show that condensation can carry out next operation completely if aobvious; If aobvious blue, be condensed to again to verify as and colourlessly can carry out next operation.
M: first use methyl alcohol (MeOH) washing resin, then use methylene dichloride (DCM) washing, fully wash dry, in vacuum drying oven dry 24 hours.
N: cut peptide: will contain trifluoroacetic acid (TFA) (83%), phenol (6.3%), thioanisole (4.3%), H
2o(4.3%) mixing solutions and EDT(2.1%) adds in pillar, and reaction 20min, collects filtrate, washes resin with a small amount of DCM, collection washing lotion, and merging filtrate and washing lotion, repeat to cut more than 10 times.
O: by all filtrate concentrated by rotary evaporations, precipitate with appropriate anhydrous diethyl ether, leave standstill.After precipitation is abundant, suction filtration, washing, dry, obtain AVPIRRRRRRRR product.Structural formula as shown in Figure 1.
Preparation Example 2
AVPIRRRRRRRRC
12the preparation of/DOX carrier micelle
AVPIRRRRRRRRC
12preparation:
Manually synthetic with reference to polypeptide solid-state reaction method.Polypeptide chain is all on the chloro-trityl chloride resin of 2-, extends to aminoterminal from carboxyl terminal, specific as follows described in.First take the chloro-trityl chloride resin of a certain amount of 2-, with DMF fully soak swelling after, remove DMF.According to the synthetic method shown in Fig. 2, first amino acid/11 2-aminoundecane-earboxylic acid of peptide chain is fixed on resin, the DMF solution that is dissolved with 4 equivalent Fmoc-ADDA-OH by adding carries out condensation reaction, and add 6 equivalent DIEA for catalyzed reaction, absorb hydrochloric acid, after reaction 2h, with DMF washing several, then seal unreacted reactive chlorine group with methyl alcohol, then with DMF washing for several times.The Fmoc blocking group removing on peptide chain terminal amino group all uses 20% piperidines/DMF(v/v) solution, 15min × 2 time, then with DMF washing several.After this in the time connecting amino-acid residue prolongation peptide chain; all adopt the amino acid of 4 equivalent Fmoc protections, and be dissolved in activated carboxyl in DMF with 4 equivalent HBTU and 6 equivalent DIEA, then join and be above-mentionedly connected with peptide chain and removed in the resin that Fmoc protects; carry out condensation reaction, reaction 4h.React complete; whether condensation is complete to verify amino with the methanol solution (10mg/ml) of triketohydrindene hydrate; if solution turns blue or rubescent expression condensation is incomplete; repeat condensation step; if solution is bright yellow or not variable color; represent that this step condensation reaction completes, continue to remove Fmoc protecting group, extend peptide chain by aminoacid sequence.Treat peptide chain end of synthesis, use successively DMF, DCM washing resin for several times.Cut agent polypeptide is cut from resin, collect filtrate, rotary evaporation is concentrated, then uses ice ether sedimentation, and repetitive scrubbing several times, filters and collects, vacuum-drying.
AVPIRRRRRRRRC
12the preparation of/DOX carrier micelle:
Directly by polypeptide A VPIRRRRRRRRC
12be dissolved in the water, in the time of 5.2mg/L, can self-assembly form micellar structure, the formation of micella, by fluorescence spectrum, is confirmed take hydrophobic pyrene as probe.As can see from Figure 13, as shown in (a) figure, the peak intensity of fluorescence excitation spectrum increases with the increase of peptide concentration, and there is obvious red shift, climax is from 338nm(I1) move to 342nm(I3), this explanation micellar structure forms, and pyrene has entered micella hydrophobic cores from outer hydrophilic environment.As shown in (b) figure, the micelle-forming concentration (CMC) that after definition curve level direction tangent line and sudden change, the intersection point at lower concentration of the tangent line crossing with flex point is polypeptide, and the CMC of the polypeptide micella of measuring is 5.2mg/L.Because CMC value is lower, thus be expected to by this peptide species in the environment diluting as human body fluid and so on for drug encapsulation transmission.
The preparation method of carrier micelle is mainly as described below: be dissolved in 5ml dimethyl sulfoxide (DMSO) (DMSO) by polypeptide (10mg) and DOX(2mg), afterwards solution is placed in to the dialysis tubing that molecular weight cut-off is 1000Da, put it in the beaker that 2000ml redistilled water (pH 7.0) is housed the water about 24h that dialyses, change the once medicine to remove DMSO and not carried by micella bag of water every 4h.
Preparation Example 3
The preparation of the pharmaceutical composition that AVPIRRRRRRRR/p53/DOX forms
The TE solution (200ng/ μ L) that measures 5 μ L p53 adds in the aseptic centrifuge tube of 1.5mL, according to different w/w ratios, add corresponding AVPIRRRRRRRR solution to mix with DNA, finally add NaCl solution (150mM) to 100 μ L, after mixing concussion 5s, at 37 ℃, hatch 30min, obtain AVPIRRRRRRRR/p53 mixture.Again by the NaCl solution blending of this mixture and a certain amount of chemotherapeutics DOX.
Preparation Example 4
The preparation of the pharmaceutical composition that AVPIRRRRRRRRC12/DOX/p53 forms
Bag is loaded with to the polypeptide micella lyophilize of medicine, and a certain amount of carrier micelle is dissolved in NaCl solution, with the method for Preparation Example 3, form pharmaceutical composition with p53, comprise the pharmaceutical composition of difunctional peptide, therapeutic gene, chemotherapeutic.
EXPERIMENTAL EXAMPLE 1
The in-vitro transfection experiment of AVPIRRRRRRRR
(1) plasmid extraction
PGL-3 plasmid is the gene of coding fluorescence element enzyme, makes to use it as reporter gene in the present embodiment.P53 is the therapeutic gene adopting in the present embodiment.PC53-SN3(addgene.org) be the plasmid vector of p53 gene.PGL-3 and pC53-SN3 transform in JM109 intestinal bacteria, and in LB substratum, with 37 ℃, in the incubator of 250rpm, incubated overnight increases.The extraction of plasmid and purifying are to use Qiagen endotoxin-free plasmid Gigaprep test kit, by going intracellular toxin plasmid purification process to complete.Plasmid DNA after purifying is at the de-post of TE buffered soln and be diluted to 0.2mg/ml, is stored in-20 ℃.Plasmid is by agarose gel electrophoresis and ultraviolet 260nm, and the absorption ratio of 280nm is verified purity and output.
(2) preparation of difunctional peptide carrier/DNA mixture
The TE solution (200ng/ μ L) that measures 5 μ L DNA adds in the aseptic centrifuge tube of 1.5mL, according to different w/w ratios, add corresponding polypeptide solution to mix with DNA, finally add NaCl solution (150mM) to 100 μ L, after mixing concussion 5s, at 37 ℃, hatch 30min, obtain polypeptide/DNA mixture.
(3) mensuration of difunctional peptide/DNA mixture particle diameter and zeta-potential
The particle diameter of mixture and zeta-potential are produced by nano-particle size analysis instrument Nano-ZS ZEN3600(Malvern Instruments company) measure.Each composite sample is added 900 μ LNaCl solution (150mM) makes cumulative volume to 1mL, is added to and in sample pool, carries out particle diameter test after mixing.Result as shown in Figure 4.Meanwhile, separately get each composite sample and add 900 μ L deionized waters and make cumulative volume to 1mL, after mixing, be added to and in sample pool, carry out zeta-potential mensuration.Result as shown in Figure 5.
(4) in-vitro transfection of mixture experiment
It is experimental subjects that 293T cell and two kinds of cells of HeLa cell are mainly taked in this experiment, uses exogenous plasmid dna pGL-3 transfection, has studied AVPIRRRRRRRR/DNA mixture transfection efficiency in vitro, jetPEI
tM(linear PEI25kDa, PolyPlus-transfection company) is contrast.The outer transfection method of composite body is as follows: by two kinds of clones respectively with 6 × 10
4the density in individual/hole is inoculated in 24 orifice plates, at incubator (37 ℃, 5%CO
2) the middle 24h that cultivates.Method according to (2) in EXPERIMENTAL EXAMPLE 1 is prepared mixture, and the DMEM substratum of finally mending the serum-free DMEM substratum of 900 μ L or containing 10% serum is to cumulative volume 1mL.Old substratum in hole is inhaled and abandoned before transfection experiment, add above-mentioned several mixture and serum-free or have the mixed solution of blood serum medium, with cell co-culture 4h.Then by the substratum sucking-off containing mixture, rejoin the DMEM substratum containing 10%FBS that 1mL is fresh and continue to cultivate 48h.After experiment finishes, move and abandon substratum, then use PBS(0.1M, pH 7.4) rinse cell gently.Every hole adds 200 μ L lysate (Promega) multigelation three times, and fully blows and beats with lysing cell.Cell pyrolysis liquid after piping and druming is with 1 × 10
5rpm is centrifugal, gets 20 μ L supernatants and luciferase substrate (Promega) 100 μ L and mixes concussion 30s, in the upper activity of measuring luciferase of Chemiluminescence Apparatus (LumatLB9507, Berthold).Protein concentration in cell pyrolysis liquid, by supernatant being added to 96 orifice plates, with protein determination reagent (Pierce) detection, OD value reads under microplate reader (Thermo, USA) 570nm.Each sample does 3 Duplicate Samples measurements and averages, and is expressed as mean value ± standard deviation (SD).The uciferase activity of cells represents with RLU/mg albumen.The results are shown in Figure shown in 6.When best transfection efficiency appears at AVPIRRRRRRRR:pGL-3 and is 30:1.
EXPERIMENTAL EXAMPLE 2
MTT(3-(4,5-dimethylthiazole-2)-2,5-phenylbenzene tetrazole bromine indigo plant, trade(brand)name: tetrazolium bromide) method measures respectively difunctional peptide (AVPIRRRRRRRR), difunctional peptide and therapeutic gene mixture (AVPIRRRRRRRR/p53), difunctional peptide and chemotherapeutic combined utilization (AVPIRRRRRRRR+DOX), and extracorporeal anti-tumor effect and the AVPIRRRRRRRRC of the pharmaceutical composition that comprises difunctional peptide, therapeutic gene, chemotherapeutic (AVPIRRRRRRRR/p53+DOX)
12with the pharmaceutical composition (AVPIRRRRRRRRC forming with therapeutic gene after chemotherapeutic formation micella
12/ DOX/p53) extracorporeal anti-tumor effect
The 293T of logarithmic phase, Hela, MCF-7, MCF-7/ADR cell are diluted to density after digesting be respectively 1.5 × 10
4the cell suspension of individual cell/mL, transfers in the 96 cell cultures orifice plates of Corning, and every hole adds 200 μ L cell suspensions, with the 1640 perfect mediums cultivation 24h(37 ℃ containing 10% calf serum, 5%CO
2).
Determine optimum medicine concentration scope by preliminary experiment, add the solution of different concns, each concentration is done 6 multiple holes.Cultivate 48 hours, add MTT(5mg/mL, purchased from Amresco company of the U.S.) 20 μ L, cultivate 4h, add DMSO 200 μ L, concussion makes crystallisate fully dissolve and mix.Measure each group of OD value by microplate reader (model: 51119300FI, Fisher), predominant wavelength is 570nm, and reference wavelength is 490nm.Calculate the cell proliferation inhibition rate of each group: proliferation inhibition rate (%)=(control group OD value-experimental group OD value)/control group OD value × 100%.
Result is as follows:
(1) difunctional peptide AVPIRRRRRRRR is to ordinary cells 293T, cancer cells HeLa, MCF-7, the impact of resistance cancer cells MCF-7/ADR proliferation rate: as shown in Figure 7, at concentration 0.2mg/mL between 1mg/mL, to the almost non-toxic property of ordinary cells; Cancer cells HeLa, MCF-7 are all had to obvious toxicity, in the time of concentration 0.8mg/mL, cancer cells HeLa, MCF-7 survival rate less than 50%; Resistance cancer cells is also had to certain toxicity.
(2) single AVPI and chemotherapeutic DOX(Zorubicin) impact of combined utilization on resistance cancer cells MCF-7/ADR proliferation rate: as shown in Figure 8, in whole experimentation, under very high AVPI concentration (1mg/mL), coordinate Zorubicin (2-20mg/L), to drug-resistant tumor cell also without obvious kill capability.This should be because single AVPI is difficult for permeates cell membranes, is difficult to arrive in cell play a role.
(3) impact of the difunctional peptide AVPIRRRRRRRR obtaining according to Preparation Example 1 on resistance cancer cells MCF-7/ADR proliferation rate: as shown in Figure 9, wherein, AVPIRRRRRRRR concentration is 1mg/mL, the concentration of Zorubicin is followed successively by 2-20mg/L, under each doxorubicin concentration, the introducing of AVPIRRRRRRRR has the effect of obvious enhancing DOX to mdr cell kill capability.This has illustrated that wearing film peptide can carry apoptosis peptide permeates cell membranes, brings into play its apoptosis-promoting effect, increases its susceptibility to chemotherapeutic.
(4) difunctional peptide and the therapeutic gene mixture AVPIRRRRRRRR/p53 impact on common cancer cells HeLa and resistance cancer cells MCF-7/ADR proliferation rate: as shown in figure 10, in this case, the concentration of fixing p53 is 5 μ g/ holes, when AVPIRRRRRRRR concentration is more than or equal to 0.8mg/mL, the equal less than 50% of the survival rate of two kinds of cells.
(5) pharmaceutical composition (difunctional peptide and the therapeutic gene mixture AVPIRRRRRRRR/p53 that obtain according to Preparation Example 3, the pharmaceutical composition forming with DOX) impact on ordinary cells 293T and cancer cells Hela: as shown in Figure 11 and Figure 12, pharmaceutical composition does not have obvious toxicity for ordinary cells, the toxicity causing while being equal to chemotherapeutic wherein of independent use; There is the significantly collaborative effect that strengthens lethality for cancer cells.
(6) pharmaceutical composition obtaining according to Preparation Example 4 is (containing the difunctional peptide AVPIRRRRRRRRC of long alkyl chain
12the pharmaceutical composition that the micella forming with chemotherapeutics and therapeutic gene AVPIRRRRRRRR form) impact on cancer cells Hela: as Figure 14 result shows, polypeptide packaging medicine has stronger kill capability to tumour cell HeLa after forming micella, and the pharmaceutical composition lethality forming after parcel therapeutic gene p53 strengthens.
EXPERIMENTAL EXAMPLE 3
The anti-tumor in vivo experiment of the pharmaceutical composition that comprises difunctional peptide, therapeutic gene, chemotherapeutic combination
(1) foundation of B16 mouse source melanochrome model of nude mice bearing tumor
By the B16 cell of logarithmic phase, after 0.25% trysinization disperses, cell counting is adjusted concentration and is prepared 5 × 10
6the cell suspension of individual cell/ml.Get weight and be 35 of the C57 mouse (purchased from Shanghai Si Laike laboratory animal company limited) of 18-22g, at nude mice back subcutaneous injection cell suspension 100 μ l/ only.Observe the growth of B16 cell in C57 Mice Body and become knurl situation.
(2) tumor bearing nude mice AgNP anti-tumour effect
When gross tumor volume is 100mm
3it is divided into 7 groups at random when the left and right:
DOX (0.5mg/kg.2d) group, DOX (0.5mg/kg.2d)+AVPIRRRRRRRR group, DOX (0.5mg/kg.2d)+AVPIRRRRRRRRC
12group, DOX (0.5mg/kg.2d)+AVPIRRRRRRRR/p53 group, DOX (0.5mg/kg.2d)+AVPIRRRRRRRRC
12/ p53 group, with the negative control group of physiological saline group, with the positive control group of DOX (2.5mg/kg.d).Each group all uses the injection system administration of knurl week, and each dosage is 200 μ L/, within every two days, is administered once.During administration, measure major diameter (L), the minor axis (S) of knurl every day, calculate gross tumor volume: V=L × S
2/ 2.After administration 21 days, nude mice dislocation is put to death, takes off tumour, carefully remove bloodstain and coating that knurl shows, weigh, calculate according to the following equation tumour inhibiting rate:
Tumour inhibiting rate (%)=(1-T/C) × 100%
Wherein, T: the average knurl weight for the treatment of group; C: the average knurl weight of negative control group.
Figure 15,16 is the gross tumor volume rate of increase figure in administration process.As can be seen from the figure,, with respect to Zorubicin (0.5mg/kg/2d) group, the tumour that can see medicinal composition administration group has significantly and reduces.Can also find, the group that contains therapeutic gene p53 onset time in the time suppressing tumor growth is more late simultaneously, and the initial stage does not have obvious advantage, has quite significantly inhibition during to the later stage.This should be because p53 is in the in-house expression of animal tumor and the process of needs that plays a role.Figure 16, compared with Figure 15, can see the AVPIR that contains long alkyl chain
8c
12in experiment, there is better effect compared to AVPIR8 in vivo.Figure 17 shown intuitively administration complete after the tumour photo of each group.As can be seen from the figure, the mouse tumor of injecting normal saline group is obviously larger, and medicinal composition group has significantly and reduces.
In whole experimentation, can observe, the toxicity of medicinal composition drug delivery system of the present invention is lower, the situation that does not have animal dead and the weight of animals obviously to decline in whole experimentation.
To sum up, difunctional peptide of the present invention wear film peptide effectively mediated apoptosis peptide penetrate into cell interior, more compound with therapeutic gene, as two important component parts in pharmaceutical composition, can significantly strengthen the antitumous effect of chemotherapeutic.Growth-inhibiting effect in the external body of tumour cell has all been shown to obvious effect.Meanwhile, pharmaceutical composition of the present invention also has significant effect to drug-resistant tumor cell.
Claims (13)
1. a difunctional peptide, is characterized in that: described difunctional peptide comprises cancer cell-apoptosis peptide and wears film peptide.
2. difunctional peptide according to claim 1, is characterized in that: the N terminal sequence AVPI that described cancer cell-apoptosis peptide is smac albumen; The described film peptide of wearing is poly arginine R
n, wherein n=5-12.
3. difunctional peptide according to claim 1 and 2, is characterized in that: the aminoacid sequence of described difunctional peptide is AVPIRRRRRRRR.
4. according to the difunctional peptide described in any one in claim 1-3, it is characterized in that: described difunctional peptide is the difunctional peptide with long alkyl chain, wherein, the described difunctional peptide with long alkyl chain is the difunctional peptide that increases the linear alkyl chain of C12 ~ C18 on the C end of the peptide chain of described difunctional peptide.
5. one kind by the mixture forming according to the difunctional peptide described in any one in claim 1-4 and nucleic acid molecule.
6. mixture according to claim 5, it is characterized in that: described nucleic acid molecule comprises DNA, antisense oligonucleotide and RNA, preferably, described nucleic acid molecule is selected from reporter gene, oncotherapy gene and small molecules interference RNA, more preferably, described nucleic acid molecule is to be selected from one or more in p53 gene, tumor suicide gene and Angiostatin.
7. the purposes of the mixture described in claim 5 or 6 in the medicine of preparation treatment tumour.
8. for to antitumor and pharmaceutical composition tumor multi-medicine drug-resistant phenomenon, it is characterized in that: comprise the difunctional peptide described in any one, oncotherapy gene and chemotherapeutic agent in claim 1-3.
9. according to claim 8ly it is characterized in that for to antitumor and pharmaceutical composition tumor multi-medicine drug-resistant phenomenon, prepared by following steps:
(a) synthetic difunctional peptide as described in any one in claim 1-3;
(b) the C end of the difunctional peptide optionally, obtaining in step (a) is introduced targeting peptides;
(c) using obtained difunctional peptide as carrier, form mixture with nucleic acid molecule, wherein, the mass ratio of described difunctional peptide and described nucleic acid molecule is 50:1-10:1, is preferably 30:1;
(d) in the mixture obtaining in step (c), introduce anticancer chemotherapeutic agent, wherein, the weight percent of the shared pharmaceutical composition of chemotherapeutic agent is 20-80%.
10. as claimed in claim 9 for to antitumor and pharmaceutical composition tumor multi-medicine drug-resistant phenomenon, it is characterized in that: described in step (b), the sequential structure of targeting peptides comprises RGD, CREKA or SMSIARL.
11. 1 kinds for to antitumor and pharmaceutical composition tumor multi-medicine drug-resistant phenomenon, it is characterized in that, prepared by following steps:
(a) prepare difunctional peptide as claimed in claim 4, form difunctional peptide micella;
(b) the difunctional peptide micella by blank micelle medicine carrying method or dialysis method, step (a) being obtained is prepared into the medicine carrying polypeptide micella that carries anticancer chemotherapeutic agent;
(c) medicine carrying polypeptide micella step (b) being obtained and oncotherapy gene are compound obtains described pharmaceutical composition.
Difunctional peptide in 12. claim 1-4 described in any one, nucleic acid molecule and anticancer chemotherapeutic agent are for the preparation of the purposes of the pharmaceutical composition to antitumor and tumor multi-medicine drug-resistant phenomenon.
13. purposes according to claim 12, it is characterized in that: described tumour comprises normal tumour and drug-resistant tumor, preferably, described tumour comprises malignant melanoma solid tumor and cervical cancer solid tumor, more preferably, described tumour comprises melanoma, mammary cancer, cervical cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210432105.5A CN103788211B (en) | 2012-11-01 | 2012-11-01 | Bifunctional peptide, the compound of the bifunctional peptide and nucleic acid molecules formation and the pharmaceutical composition for treating tumour |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210432105.5A CN103788211B (en) | 2012-11-01 | 2012-11-01 | Bifunctional peptide, the compound of the bifunctional peptide and nucleic acid molecules formation and the pharmaceutical composition for treating tumour |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103788211A true CN103788211A (en) | 2014-05-14 |
| CN103788211B CN103788211B (en) | 2017-09-01 |
Family
ID=50664304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210432105.5A Active CN103788211B (en) | 2012-11-01 | 2012-11-01 | Bifunctional peptide, the compound of the bifunctional peptide and nucleic acid molecules formation and the pharmaceutical composition for treating tumour |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103788211B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107827953A (en) * | 2017-11-08 | 2018-03-23 | 哈尔滨商业大学 | It is a kind of to target cell-penetrating peptide, the medicine with it and application |
| CN108478528A (en) * | 2018-04-20 | 2018-09-04 | 西北大学 | A kind of targeting polymer medicament carrying micelle and preparation method thereof |
| CN111154002A (en) * | 2020-01-10 | 2020-05-15 | 上海海洋大学 | Bifunctional peptide K14, gene vector and co-drug delivery system |
| CN111388741A (en) * | 2020-04-01 | 2020-07-10 | 东华大学 | Injectable self-repairing antibacterial hydrogel dressing preloaded with polypeptide and preparation method thereof |
| CN112074287A (en) * | 2018-04-06 | 2020-12-11 | 阿玛治疗公司 | Compositions for controlled release of therapeutic agents |
| CN113549132A (en) * | 2021-07-20 | 2021-10-26 | 安徽师范大学 | Non-viral vector formed by covalent assembly of terpyridine ruthenium catalysis short peptide and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003011898A2 (en) * | 2001-07-27 | 2003-02-13 | Institut Pasteur | Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses |
| WO2004011595A2 (en) * | 2002-07-26 | 2004-02-05 | Institut Pasteur | Vectors for transferring molecules of interest in target cells |
| WO2010112471A1 (en) * | 2009-03-30 | 2010-10-07 | Universite Pierre Et Marie Curie (Paris 6) | Pro-apoptotic peptides |
-
2012
- 2012-11-01 CN CN201210432105.5A patent/CN103788211B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003011898A2 (en) * | 2001-07-27 | 2003-02-13 | Institut Pasteur | Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses |
| WO2004011595A2 (en) * | 2002-07-26 | 2004-02-05 | Institut Pasteur | Vectors for transferring molecules of interest in target cells |
| WO2010112471A1 (en) * | 2009-03-30 | 2010-10-07 | Universite Pierre Et Marie Curie (Paris 6) | Pro-apoptotic peptides |
Non-Patent Citations (3)
| Title |
|---|
| 于丽等: "穿膜肽11R在携带P53基因的溶瘤腺病毒中抗肿瘤作用的研究", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
| 林立国等: "应用Smac/DIABLO治疗肿瘤的研究进展", 《国外医学泌尿系统分册》 * |
| 王竞等: "人工合成拟Smac多肽增强膀胱癌细胞化疗敏感性的实验研究", 《中国癌症杂志》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107827953A (en) * | 2017-11-08 | 2018-03-23 | 哈尔滨商业大学 | It is a kind of to target cell-penetrating peptide, the medicine with it and application |
| CN112074287A (en) * | 2018-04-06 | 2020-12-11 | 阿玛治疗公司 | Compositions for controlled release of therapeutic agents |
| CN108478528A (en) * | 2018-04-20 | 2018-09-04 | 西北大学 | A kind of targeting polymer medicament carrying micelle and preparation method thereof |
| CN108478528B (en) * | 2018-04-20 | 2020-11-10 | 西北大学 | Targeting polymer drug-loaded micelle and preparation method thereof |
| CN111154002A (en) * | 2020-01-10 | 2020-05-15 | 上海海洋大学 | Bifunctional peptide K14, gene vector and co-drug delivery system |
| CN111154002B (en) * | 2020-01-10 | 2022-11-22 | 上海海洋大学 | Bifunctional peptide K14, gene vector and co-drug delivery system |
| CN111388741A (en) * | 2020-04-01 | 2020-07-10 | 东华大学 | Injectable self-repairing antibacterial hydrogel dressing preloaded with polypeptide and preparation method thereof |
| CN111388741B (en) * | 2020-04-01 | 2021-09-07 | 东华大学 | Injectable self-repairing antibacterial hydrogel dressing preloaded with polypeptide and preparation method thereof |
| CN113549132A (en) * | 2021-07-20 | 2021-10-26 | 安徽师范大学 | Non-viral vector formed by covalent assembly of terpyridine ruthenium catalysis short peptide and preparation method and application thereof |
| CN113549132B (en) * | 2021-07-20 | 2023-11-24 | 安徽师范大学 | Non-viral vector formed by covalent assembly of catalytic short peptide based on terpyridine, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103788211B (en) | 2017-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Effective co-delivery of doxorubicin and dasatinib using a PEG-Fmoc nanocarrier for combination cancer chemotherapy | |
| Liu et al. | Development of a hypoxia-triggered and hypoxic radiosensitized liposome as a doxorubicin carrier to promote synergetic chemo-/radio-therapy for glioma | |
| Chen et al. | Supramolecular polymeric chemotherapy based on cucurbit [7] uril-PEG copolymer | |
| Wang et al. | Self-assembling peptide-based nanodrug delivery systems | |
| CN103788211A (en) | Bifunctional peptide, composite formed by the bifunctional peptide and nucleic acid molecule, and pharmaceutical composite used for treating tumor | |
| CN101401941B (en) | Preparation and uses of tumor-targeted carrier material RGD-fatty alcohol series of compounds | |
| CN102091036A (en) | Compound liposome containing anti-tumor drugs and preparation method and application thereof | |
| Bao et al. | Cancer-targeted PEDF-DNA therapy for metastatic colorectal cancer | |
| Wan et al. | Multifunctional peptide-lipid nanocomplexes for efficient targeted delivery of DNA and siRNA into breast cancer cells | |
| Shi et al. | Oxidative stress-driven DR5 upregulation restores TRAIL/Apo2L sensitivity induced by iron oxide nanoparticles in colorectal cancer | |
| CN105294831A (en) | Tumor-targeting novel polypeptide | |
| Hao et al. | Covalent self-assembled nanoparticles with pH-dependent enhanced tumor retention and drug release for improving tumor therapeutic efficiency | |
| She et al. | De novo supraparticle construction by a self-assembled Janus cyclopeptide to tame hydrophilic microRNA and hydrophobic molecule for anti-tumor cocktail therapy and augmented immunity | |
| Salimifard et al. | Codelivery of BV6 and anti-IL6 siRNA by hyaluronate-conjugated PEG-chitosan-lactate nanoparticles inhibits tumor progression | |
| Jiang et al. | Molecular mechanism of anti-cancer activity of the nano-drug C-PC/CMC-CD59sp NPs in cervical cancer | |
| Liang et al. | Specific activation of cGAS-STING pathway by nanotherapeutics-mediated ferroptosis evoked endogenous signaling for boosting systemic tumor immunotherapy | |
| Liang et al. | Mitochondria-targeted vitamin E succinate delivery for reversal of multidrug resistance | |
| Wang et al. | An enhanced anti-tumor effect of apoptin-cecropin B on human hepatoma cells by using bacterial magnetic particle gene delivery system | |
| Huang et al. | Enzyme responsiveness enhances the specificity and effectiveness of nanoparticles for the treatment of B16F10 melanoma | |
| Patel et al. | Development of amino acid-modified biodegradable lipid nanoparticles for siRNA delivery | |
| Hou et al. | iRGD-grafted N-trimethyl chitosan-coated protein nanotubes enhanced the anticancer efficacy of curcumin and melittin | |
| Wang et al. | Charge-conversional click polyprodrug nanomedicine for targeted and synergistic cancer therapy | |
| Wang et al. | Co‐delivery of Cell‐permeable Chimeric Apoptosis AVPIR8 Peptide/p53 DNA for Cocktail Therapy | |
| CN108743964A (en) | A kind of Brain targeting nucleic acid delivery vector of rabies virus glycoprotein-derived peptide modification and its application | |
| CN114452397A (en) | Drug delivery vehicle and pharmaceutical formulation for co-delivery of multiple therapeutic agents using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |