CN103757004B - A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s - Google Patents
A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s Download PDFInfo
- Publication number
- CN103757004B CN103757004B CN201310727912.4A CN201310727912A CN103757004B CN 103757004 B CN103757004 B CN 103757004B CN 201310727912 A CN201310727912 A CN 201310727912A CN 103757004 B CN103757004 B CN 103757004B
- Authority
- CN
- China
- Prior art keywords
- pig
- chr10
- site
- litter size
- molecule marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the molecule marker relevant to pig number born character, to be specifically related on pig No. 10 karyomit(e)s a molecule marker relevant to litter size and primer thereof, to belong to biological technical field.Does is this molecule marker site genome version NCBI Build Sscrofa 10.2 Chr10:16018894; The allelotrope in this site is T and C, has C/C, T/C and T/T tri-kinds of genotype, be this site and flanking sequence thereof as SEQ ID shown in NO:1.Increase this molecule marker site primer and extend primer be: Chr10-PCRU:5 '-TGC CAA ACC TGT GTC ACC-3 '; Chr10-PCRL:5 '-GGC TGG AGA GGA AAA GGG-3 '; Chr10-SNPU:5 '-TGA CTA GAA GCA GCC ATG GGG CCC TGC AGA-3 '.With the genotypic litter size of pig of T/T higher than T/C and C/C genotype.Beneficial effect of the present invention is: use the heavy sequence measurement of full-length genome, can screen the molecule marker relevant to proterties or candidate gene fast, in bulk, this site of Chr10:16018894 can educate for the heredity of pig the litter size improving sow as genetic marker.
Description
Technical field:
The present invention relates to the molecule marker relevant to pig number born character, to be specifically related on pig No. 10 karyomit(e)s a molecule marker relevant to litter size and primer thereof, to belong to biological technical field.
Background technology:
The characters of number born of pig is the chief component of pig reproductive trait, improves litter size of pig significant to the overall economic benefit improving pig industry.But litter size belongs to the very low quantitative character of heritability, be difficult to carry out genetic improvement with traditional breeding method.The Taihu pigs of China is well-known with high yield, and nest litter size is than nest litter size many 4-5 head (" Chinese pig breeds will " Zhang Zhongge edits, Science and Technology of Shanghai press, 1986) of other Chinese native pig breed of great majority and external pig kind.Erhualian is the one of Taihu pigs, is the pig kind that reproductivity is the highest in the world.Polymorphic site relevant to high litter size in Taihu pigs, can as genetic marker for improving the litter size of sow.
Domestic and international researchist adopts the method for genome-wide screening and candidate gene to carry out the research of QTL location and candidate gene to characters of number born.The people such as Li (Li, K., J.Ren, utilization cover pig 19 chromosomal 183 microsatellite markers pair to litter size of pig relevant total yield coefficient etal.AnimGenet.2009.40 (6): 963-966), number born alive, produce dead young number and carry out QTL(QuantitativeTraitLocus, quantitative trait locus) location.They have studied the F that 299 durocs and Chinese Erhualian are hybridized
2in generation, 6,7,8 and No. 15 karyomit(e)s located and total yield coefficient, the QTL that number born alive is relevant with producing dead young number.
(the Rothischild such as Rothschild, M., Jacobson, pass through candidate gene approach D.etal.ProcNatlAcadSciUSA.1996.93 (1): 201-205), utilize two the extreme mixing breeds comprising Prunus mume in China mountain system Taihu pigs, find that a gene (ESR) at estrogen receptor seat on No. 1 karyomit(e) and high litter size major gene are chain.Analyzed by the RFLPs at female hormone receptor gene seat, think the homozygous sow (BB type) with 3.7kb band than when there is homozygous sow (AA type) primiparity of 4.3kb band and want many 2.3 (P<0.01), average voluminous 1.5 (P<0.01) of every tire.Report that the gene relevant to litter size also has OPN (US6410227B1) at present, PRLR (Tomas, A., J.Casellas, etal.JAnimSci.2006.84 (8): 1991-1998), FSH β (Zhao, Y.LiN, and RBP4 (Spotter etal.SciChinaCLifeSci.1998.41 (6): 664-668), A., S.Muller, etal.ReprodDomestAnim.2009.44 (1): 100-105) etc.
Application QTL localization method can locate the closely linked region with proterties, but needs a lot of individualities studying several generations family, and the cycle is long, wastes time and energy, and cannot complete in general laboratory, and some QTL locates very wide in range.Utilize candidate gene approach to study proterties, comparatively speaking simple directly, but what utilize candidate gene approach mainly to study is the sudden change of exon region, and the sudden change much playing critical function is probably at intron or other functional area; Some complex character is subject to polygene regulation and control; Can not detect all QTL, and some does not find the location of QTL with the gene of candidate gene approach research.
Along with development and the maturation of technology, genome and gene annotation more and more perfect.Due to the fast development of sequencing technologies, the reduction of order-checking cost, can utilize genome sequencing or transcript profile order-checking to carry out batch screening to trait related gene or mutational site.The present invention selects Erhualian (one of Taihu pigs), hides pig, BaMa miniature pig, Laiwu Pigs, and 5 Chinese native pig breeds such as the southern regions of the Yunnan Province microtia pig and wild boar have carried out full-length genome and to have resurveyed sequence.Wish therefrom to filter out the SNPs(singlenucleotidepolymorphisms relevant to high litter size, single nucleotide polymorphism) site is used for the genetic breeding of pig, to improve the litter size of sow as genetic marker.
Summary of the invention:
To the object of this invention is to provide on pig No. 10 karyomit(e)s a molecule marker relevant to litter size and primer thereof.
The present invention have selected Erhualian (one of Taihu pigs), hides pig, BaMa miniature pig, Laiwu Pigs, and the southern regions of the Yunnan Province microtia pig 5 Chinese native pig breeds and wild boar have carried out full-length genome and to resurvey sequence.The sequence number of individuals of resurveying of 6 pig kinds is respectively 11,11,9,10,10 and 10.Order sequenced data of resurveying is compared with reference to genome (NCBIBuildSscrofa10.2), utilizes SAMTools software to carry out the extraction in SNPs site.Contriver compares Erhualian and other 5 pig kinds, No. 10 karyomit(e)s finds a SNP site (Chr10:16018894 of genome version NCBIBuildSscrofa10.2) is relevant to the litter size of pig.The allelotrope in this site is T and C, has C/C, T/C and T/T tri-kinds of genotype.This site and flanking sequence (SEQIDNO:1) thereof are:
After screening this site, contriver comprises the nucleotide sequence fragment in this site with the DNA of pig for template amplification and checks order, and verifies and correlation analysis this site.The individuality that wherein contriver selects is the F of white Duroc × Erhualian (one of Taihu pigs)
2offspring.Found that this site and litter size of pig have significant correlation.
Beneficial effect of the present invention is: use the heavy sequence measurement of full-length genome, can screen the molecule marker relevant to proterties or candidate gene fast, in bulk, this SNP site of Chr10:16018894 of genome version NCBIBuildSscrofa10.2 can be used for the litter size of the genetic breeding raising sow of pig as genetic marker.
Accompanying drawing illustrates:
Fig. 1 is white Duroc × Erhualian F
2in godmother pig resource population, the genotypic litter size in 3 kinds, Chr10:16018894 site compares (in figure
*when representing that two kinds of genotype litter sizes compare, 0.01≤P≤0.05;
*represent P < 0.01).
Specific embodiments:
(1) the population distribution feature of SNP site
The present invention have selected Erhualian (one of Taihu pigs), hides pig, BaMa miniature pig, Laiwu Pigs, and 5 Chinese native pig breeds such as the southern regions of the Yunnan Province microtia pig and wild boar have carried out full-length genome and to have resurveyed sequence.The sequence number of individuals of resurveying of 6 pig kinds is respectively 11,11,9,10,10 and 10.Order sequenced data of resurveying is compared with reference to genome (NCBIBuildSscrofa10.2), utilizes SAMTools software to carry out the extraction in SNPs site.Contriver compares Erhualian and other 5 pig kinds, No. 10 karyomit(e)s finds a SNP site (Chr10:16018894 of genome version NCBIBuildSscrofa10.2) is relevant to the litter size of pig.From the analytical results of sequence of resurveying, in other 3 Chinese native pig breeds and wild boar, the frequency averaging of this site allele C is more than 60%, and in BaMa miniature pig, the frequency of this site allele C is 29%, and is 100% in the frequency of Erhualian allelic T.
(2) qualification of SNP site
At design of primers website design SNAPSHOT primer, comprise a pair pcr amplification primer (Chr10-PCRU:5 '-TGCCAAACCTGTGTCACC-3 '; Chr10-PCRL:5 '-GGCTGGAGAGGAAAAGGG-3 ') and extension primer (Chr10-SNPU:5 '-TGACTAGAAGCAGCCATGGGGCCCTGCAGA-3 ').This site and totally 24, other 11 sites (12 to) primer is respectively got 1 μ l and is mixed into new multiple PCR primer pond.First carry out 12 heavy PCR reactions, reaction system agents useful for same is: multiple PCR primer pond (6.25 μMs of each) 8 μ l, dNTP (10mMeach) 8 μ l, 10 × PCRBufferII116 μ l, MgCl
2(25mMStock) 234 μ l, FastStartTaq (5U/ μ l) 24 μ l and ddH
2o460 μ l, the 10 μ l systems that are mixed into by above reagent mixed liquor 8.5 μ l and 1.5 μ lDNA (50ng/ μ l) carry out 12 heavy pcr amplification reactions.Amplification reaction condition is: 94 DEG C of 4min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, totally 40 circulations.Next step carries out PCR reaction purification, and required reagent is: ExoI (10U/ μ l) 60 μ l, SAP (1U/ μ l) 130 μ l, 10 × SAPBuffer35 μ l and ddH
2o125 μ l, add in the PCR primer of each sample 3.5 μ l above-mentioned purifying mixed solution centrifugal after react by following program: 37 DEG C of 40min, 96 DEG C of 10min.Then single base extension is carried out, required reagent is: SNAPSHOTMultiplexreadyreactionMix100 μ l, extension primer pond (6.25 μMs of each, 12 extension primers are respectively got 1 μ l and mixed) 8 μ l, 5 × SequencingBuffer200 μ l and ddH
2o300 μ l, is mixed into 10 μ l systems by the purified product of above reagent mixed liquor 6 μ l and 4 μ l and carries out extension.Extension condition is: 96 DEG C of 10s, 50 DEG C of 5s, 60 DEG C of 30s, totally 25 circulations.Then carry out the purifying of extension product, required reagent is: SAP (1U/ μ l) 120 μ l, 10 × SAPBuffer70 μ l and ddH
2o140 μ l, add in the extension product of each sample above-mentioned 3.3 μ l purifying mixed solutions centrifugal after react by following program: 37 DEG C of 40min, 75 DEG C of 20min, 4 DEG C save backup.SNAPSHOT reaction product after the above-mentioned purifying of 5-4 μ l got by each sample and high-purity methane amide (Hi-DiFormamide) of 5-6 μ l be mixed into 10 μ l systems centrifugal after be splined on ABI3730XL sequenator and carry out gene type, use GeneMarker software analysis genotyping result.
(note: the reaction reagent mixed solution consumption of above 4 steps is amount of reagent needed for 100 samples, from single base extension, needs lucifuge to carry out.)
(3) white Duroc × painted face in Beijing opera reproductive performance hybridization resource population builds
Follow-up confirmatory experiment used resource group's individual sample and trait data thereof are provided by Animal Biotechnology National Key Laboratory of Agricultural University Of Jiangxi cultivation base.
In December, 1998, on Agricultural University Of Jiangxi's scientific research pig farm, the Erhualian sow of 3 Erhualian conservation field purchases from Jiangsu Province is carried out the intersection breeding of blood relationship between field.January calendar year 2001, according to parent's Farrowing Traits, have selected maternal for generations as sources group of 17 Erhualian sows from the pure breeding offspring of 3 boars and 11 sows.2 high-qualitys white Duroc boars that SygenPIC company is so kind as to give are as the male parent for generations of Resource family.By the F that these 2 white Durocs and 17 Erhualian hybridization produce
1breed for individuality, avoid full, and every boar usually with same head insemination of sows, to obtain the F of large sample
2family half sibs.In January, 2003, March and June, project team is respectively by the 1st crowd and the 2nd crowd of F
2sow is sent to Jiangxi Province's Yichun City herding seed multiplication farm (59), state-run Red Star kind pig farm, Jiangxi Province (52) and quaternionic breeding pig farm, Shangyou County, Jiangxi (118) for the mensuration of sow reproductive trait.
(4) SNP site is at hybridization resource population F
2the gene type of godmother swinery body
According to the method described in above-mentioned steps (2), with 192 white Durocs × Erhualian hybridization resource population F
2the individual DNA of godmother pig is the genotype of this SNP site of template detection.F
2for there being 186 successful somatotypes of individuality in resource population individuality, the number of individuals of 3 kinds of genotype C/C, T/C and T/T is 56,92 and 38 respectively.
(5) SNP site is to the regulating effect of characters of number born
At F
2for in resource population individuality, the average litter size with C/C genotype individuals is 10.5431, and standard deviation is 0.9222; Average litter size with T/C genotype individuals is 10.6266, and standard deviation is 0.9031; Average litter size with T/T genotype individuals is 11.9091, and standard deviation is 0.9554.
The present invention adopts general linear model (GLM) to analyze the impact of SNP site on pig total yield coefficient, number born alive.Whole statistical study adopts SAS software to carry out.Model is as follows:
Y
ijklm=u+A
i+G
j+B
k+P
l+e
ijklm
Wherein Y
ijklmfor pig total yield coefficient or number born alive, u is colony's average, A
ibe i-th individual additive effect, G
jfor the genotypic fixed effect of a jth SNP site, B
kfor a batch effect (k=1,2,3,4), P
lfor stochastic effect (l=1,2,3).
Analytical results finds that this SNP site of Chr10:16018894 has significant correlation (as shown in Figure 1) with litter size.With the genotypic F of T/T
2the litter size of godmother pig is than with the average many 1.36(P=0.0204 of the genotypic sow of C/C), with the genotypic F of T/T
2the litter size of godmother pig is than with the average many 1.28(P=0.0149 of the genotypic sow of T/C), as can be seen from Figure 1, minimum with the genotypic number born of sow of C/C.T is the useful allelotrope improving litter size of pig.
Find out from SNP site and litter size correlation analysis, this SNP site of Chr10:16018894 can be applied to as molecule marker the litter size that molecular marker assisted selection (MAS) improves sow.
SEQUENCELISTING
<110> Kunming Institute of Zoology, Chinese Academy of Sciences
Agricultural University Of Jiangxi
A molecule marker relevant to litter size and primer thereof on <120> pig No. 10 karyomit(e)s
<130>7
<160>1
<170>PatentInversion3.5
<210>1
<211>601
<212>DNA
<213>Susscrofa
<400>1
ttttcttttcagggaggcacctgtggcatttggagctacagctgctggccacagctgcag60
ccacggccatccaggatcctagccacgtctgcgacctacaccacagctgacggttatgcc120
agctccttaatccactgagtgaggccagggatagaacctgcgtcctcatggatgctagct180
agggttcttaacccactgagccacagtgggaactcctggggcatttttatttaccagctg240
gccagcgtgcctcctgccaaacctgtgtcaccccaagaagcagccatggggccctgcaga300
cacccctttccttcagcacaggacaccccttttcctctccagcctgggaactgctgaaca360
ggtgaaccccctcccctgactccagactgcggggcccacactccaggaggaaatatgcat420
ttgggacctaatgctggagcctgaggcctgtggactccggaaagccccacatcctcctgg480
ccctgccagccccttgggcccttgtctcctggcactgggttccctcggcctggcctgtgt540
cccggggccctccatgtccgcccactgggtgtgcttcccactgctcccccactcacctgc600
c601
SEQUENCELISTING
<110> Kunming Institute of Zoology, Chinese Academy of Sciences
Agricultural University Of Jiangxi
A molecule marker relevant to litter size and primer thereof on <120> pig No. 10 karyomit(e)s
<130>7
<160>3
<170>PatentInversion3.5
<210>1
<211>18
<212>DNA
<213>Susscrofa
<400>1
tgccaaacctgtgtcacc18
<210>2
<211>18
<212>DNA
<213>Susscrofa
<400>2
ggctggagaggaaaaggg18
<210>3
<211>30
<212>DNA
<213>Susscrofa
<400>3
tgactagaagcagccatggggccctgcaga30
Claims (1)
1. the primer detecting on pig No. 10 karyomit(e)s a molecule marker site relevant to litter size is improving the application in white Duroc × Erhualian hybridization resource population F2 godmother litter size of pig genetic breeding, it is characterized in that: the nucleotide sequence of described primer is as follows:
Chr10-PCRU：5’-TGCCAAACCTGTGTCACC-3’，
Chr10-PCRL：5’-GGCTGGAGAGGAAAAGGG-3’，
Chr10-SNPU:5 '-TGACTAGAAGCAGCCATGGGGCCCTGCAGA-3 ', described molecule marker site is the Chr10:16018894 of genome version NCBIBuildSscrofa10.2, the nucleotide sequence of described molecule marker site and flanking sequence thereof is as shown in SEQIDNO:1, the allelotrope in this site is T and C, there are C/C, T/C and T/T tri-kinds of genotype, described molecule marker site is with the genotypic litter size of pig of T/T higher than with the genotypic pig of T/C and C/C, and its allelic T is the useful allelotrope improving litter size of pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310727912.4A CN103757004B (en) | 2013-12-26 | 2013-12-26 | A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310727912.4A CN103757004B (en) | 2013-12-26 | 2013-12-26 | A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103757004A CN103757004A (en) | 2014-04-30 |
| CN103757004B true CN103757004B (en) | 2016-02-24 |
Family
ID=50524323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310727912.4A Expired - Fee Related CN103757004B (en) | 2013-12-26 | 2013-12-26 | A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103757004B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046442A (en) * | 2019-12-26 | 2021-06-29 | 广西扬翔股份有限公司 | SNP molecular marker related to pig litter size trait and application thereof |
-
2013
- 2013-12-26 CN CN201310727912.4A patent/CN103757004B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| CM000821.4;Genbank;《Genbank》;20110907;全文 * |
| 登录号：rs336014538;NCBI，dbSNP数据;《NCBI，dbSNP数据》;20130315;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103757004A (en) | 2014-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103757003B (en) | The SNP site relevant to litter size and primer thereof on pig No. 13 karyomit(e)s | |
| CN103757010B (en) | A molecule marker relevant to litter size and primer thereof on pig No. 8 karyomit(e)s | |
| CN110004236A (en) | SNP marker relevant to the more lamb characters of sheep and its detection ESR1 genotyping primer group, kit and application | |
| CN105483259B (en) | SNP site relevant to nest litter size on No. 12 chromosomes of pig | |
| CN107447000B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN103757005B (en) | A molecule marker relevant to litter size and primer thereof on pig No. 11 karyomit(e)s | |
| CN108676899A (en) | A kind of and the relevant SNP marker of Erhualian sow litter trait and its detection method | |
| CN109706231B (en) | High-throughput SNP (single nucleotide polymorphism) typing method for molecular breeding of litopenaeus vannamei | |
| CN109182559B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection kit and application thereof | |
| Bian et al. | Development of a multiplex PCR assay for parentage assignment of the redclaw crayfish (Cherax quadricarinatus) | |
| CN103421797B (en) | Genetic marker for character of litter size of pig utilizing SLA-11 gene | |
| CN103757009B (en) | A molecular marker relevant to litter size and primer thereof on No. 13 chromosomes of pig | |
| CN103757008B (en) | A molecule marker relevant to litter size and primer thereof on pig No. 6 karyomit(e)s | |
| CN103757011B (en) | A molecule marker relevant to litter size and primer thereof on pig No. 5 karyomit(e)s | |
| CN116837112B (en) | SNP molecular marker related to yak growth traits and application thereof | |
| CN105543356B (en) | SNP site relevant to nest litter size on No. 9 chromosomes of pig | |
| CN105543358A (en) | SNP (single nucleotide polymorphism) locus relevant to litter size on sow chromosome 3 | |
| CN105567816B (en) | SNP site relevant to nest litter size on No. 8 chromosomes of pig | |
| CN103757004B (en) | A molecule marker relevant to litter size and primer thereof on pig No. 10 karyomit(e)s | |
| CN103757002B (en) | A molecular marker relevant to litter size on No. 6 chromosomes of pig | |
| WO2016061711A1 (en) | Method for identifying wuzhishan miniature pig inbred line by using 145 snp | |
| CN105543359B (en) | SNP site relevant to nest litter size on No. 5 chromosomes of pig | |
| CN103757007B (en) | A SNP site relevant to litter size and primer thereof on No. 5 chromosomes of pig | |
| CN103757006B (en) | A SNP site relevant to litter size and primer thereof on No. 6 chromosomes of pig | |
| CN105603065B (en) | SNP site relevant to nest litter size and its primer on No. 3 chromosomes of pig |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160224 Termination date: 20171226 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |