CN103755795A

CN103755795A - Saddletail grouper antimicrobial peptide LEAP-2 gene, vector, recombinant strain and protein, and application thereof

Info

Publication number: CN103755795A
Application number: CN201410027857.2A
Authority: CN
Inventors: 王维娜; 谢福星; 刘媛
Original assignee: South China Normal University
Current assignee: South China Normal University
Priority date: 2013-03-18
Filing date: 2014-01-21
Publication date: 2014-04-30
Anticipated expiration: 2034-01-21
Also published as: CN103755795B

Abstract

The invention discloses a Saddletail grouper antimicrobial peptide LEAP-2 gene, vector, recombinant strain and protein, and application thereof. The amino acid sequence of the Saddletail grouper antimicrobial peptide LEAP-2 precursor protein is disclosed as SEQ ID NO.2, or the Saddletail grouper antimicrobial peptide LEAP-2 precursor protein is a protein with identical or higher activity prepared by performing substitution, deletion and/or addition on one or more of amino acids and/or terminal modification on the amino acid sequence disclosed as SEQ ID NO.2. The invention also discloses a Saddletail grouper antimicrobial peptide LEAP-2 gene sequence and a LEAP-2 mature peptide gene mLEAP-2 nucleotide sequence subjected to code modification; and thus, the Saddletail grouper antimicrobial peptide LEAP-2 gene enriches the gene bank of grouper, can be used for preparing a recombinant protein, antimicrobial preparation, fish immune preparation or feed additive, and provides new theoretical and practical basis for physiologic immunity research of grouper.

Description

Epinephelus coioides antimicrobial petide LEAP-2 gene, carrier, recombinant bacterial strain and albumen and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to the gene of a kind of antibacterial peptide LEAP-2 precursor protein and this albumen of encoding, the carrier that contains this gene and application thereof; Also relate to the gene of a kind of LEAP-2 mature peptide albumen and this albumen of encoding, the carrier that contains this gene and application thereof.

Background technology

Antibacterial peptide is that the one producing in organism has bioactive natural micromolecule polypeptide, in multiple organism, extensively exists, and be the immune important component part of organism.After Steiner found the existence of antibacterial peptide first in 1981 in insect body, up to the present people have found thousands of kinds of antibacterial peptides in multiple species.Meanwhile, people have also found that antibacterial peptide can act on G ⁺and G ^-bacterium, fungi, parasite be virus even, and can not produce harm and produce resistance normal cell.

LEAP-2 full name is antibacterial peptide-2(liver-expressed antimicrobial peptides-2 of liver expression), belong to the one of antibacterial peptide.It is the discoveries first in human blood such as Krause in 2003.LEAP-2 is synthetic with the form of precursor in liver at first, is transported to afterwards in blood.In this process, LEAP-2 is modified and is processed to form mature peptide, relates generally to the excision of signal peptide and the formation of disulfide linkage.LEAP-2 precursor protein generally comprises 100 amino acid left and right, and mature peptide generally comprises approximately 40 amino acid.There is a great difference in the protein structure of LEAP-2 and other antimicrobial peptide protein structure, its topmost feature is in peptide sequence, to comprise four halfcystines, and these four halfcystines can form two disulfide linkage with the form of 1-3,2-4.By the effect of hydrogen bond, LEAP-2 mature peptide finally can form the higher structures such as β-pleated sheet structure again.In addition, research finds that LEAP-2 has the broad-spectrum antibacterial ability identical with general antibacterial peptide.

Ablen be subordinate to Perciformes ( perciformes) ， Sushi section ( serranidae), Epinephelinae ( epinephelinae), Epinephelus ( epinephelus), for the water warm reef fish that dwell, be distributed widely in the Indian Ocean and the Pacific torrid zone, subtropical seas.Cabrilla is one of famous and precious seafood fish renowned in the world, and its delicious meat is nutritious, is the first-class delicacies in dining table, by one of four your name fishes of Hong Kong and Macao Tui Wei China, is deeply subject to liking of various places human consumer, and economic worth is huge.But high pathogenicity rate and high mortality that current climatic scourge and environmental pollution cause, be that cabrilla is propagated insoluble problem in process artificially always.On market, also there is no a kind of fodder additives that can effectively strengthen cabrilla immunizing power or not produce resistance.

Yeast is the simplest eukaryote, has very large advantage: growth and breeding is fast using it as host expresses foreign protein, easily cultivates, simple to operate; Can translate post-treatment to the foreign protein of expressing and modify, as glycosylation, acetylize etc.; Safe, no pathogenicity.Pichia pastoris phaff is a kind of methyl alcohol nutritional type yeast, sole carbon source and the energy that can be using methyl alcohol as metabolism.Pichia yeast expression system has many good qualities in scientific research and widespread use in producing: use strong inducible promoters-AOX1 gene promoter; Foreign gene enters in genome with single copy or multiple copied site-directed integration, and genetic stability is good; Recombinant protein in protein free substratum almost, utilizes the purifying of expressing protein with high-level secretory; Easily carry out high density fermentation, be suitable for industrialization and produce.

Summary of the invention

One object of the present invention is to provide a kind of cabrilla antibacterial peptide LEAP-2 precursor protein.

Another object of the present invention is to provide the gene of the above-mentioned cabrilla antibacterial peptide LEAP-2 precursor protein of coding.

Another object of the present invention is to provide a kind of cabrilla antibacterial peptide LEAP-2 mature peptide albumen.

Another object of the present invention is to provide the wild type gene of the above-mentioned cabrilla antibacterial peptide LEAP-2 mature peptide albumen of coding and through the improved gene mLEAP-2 of codon preference.

Another object of the present invention is to provide the cloning vector or the expression vector that contain cabrilla antibacterial peptide LEAP-2 precursor protein gene or LEAP-2 mature peptide protein gene.

Another object of the present invention is to provide a kind of cabrilla antibacterial peptide LEAP-2 restructuring precursor protein and preparation method thereof.

Another object of the present invention is to provide the application of cabrilla LEAP-2 precursor protein and/or LEAP-2 mature peptide albumen.

The technical solution used in the present invention is:

Cabrilla antibacterial peptide LEAP-2 precursor protein, its aminoacid sequence is as shown in SEQ ID NO.2, or the aminoacid sequence shown in SEQ ID NO.2 is substituted, lacks and/or increases one or more amino acid and/or end modified and have equal or more highly active albumen.

The gene of coding cabrilla antibacterial peptide LEAP-2 precursor protein, it contains the nucleotide sequence shown in SEQ ID NO.1 262-561 bp.

Cabrilla antibacterial peptide LEAP-2 mature peptide albumen, its aminoacid sequence is as shown in SEQ ID NO.4, or the aminoacid sequence shown in SEQ ID NO.4 is substituted, lacks and/or increases one or more amino acid and/or end modified and have equal or more highly active albumen.

The gene of coding cabrilla antibacterial peptide LEAP-2 mature peptide albumen, it is the nucleotide sequence shown in SEQ ID NO.1 421-561 bp, or the nucleotide sequence shown in SEQ ID NO.3.

Carry cabrilla antibacterial peptide LEAP-2 precursor protein gene or/and the carrier of antibacterial peptide LEAP-2 mature peptide protein gene.

Contain cabrilla antibacterial peptide LEAP-2 precursor protein gene or/and the recombinant bacterial strain of antibacterial peptide LEAP-2 mature peptide protein gene.

Produce the method for cabrilla antibacterial peptide LEAP-2 precursor protein or cabrilla antibacterial peptide LEAP-2 mature peptide albumen, comprise the expression vector that carries antibacterial peptide LEAP-2 precursor protein gene or antibacterial peptide LEAP-2 mature peptide protein gene is imported in host cell, express and obtain LEAP-2 precursor protein or LEAP-2 mature peptide albumen.

Cabrilla antibacterial peptide LEAP-2 precursor protein or/and antibacterial peptide LEAP-2 mature peptide albumen in the application of preparing in antibiotic preparation.

Cabrilla antibacterial peptide LEAP-2 precursor protein is or/and antibacterial peptide LEAP-2 mature peptide albumen improves the application in aquatic animal immunizing power preparation in preparation.

Beneficial effect of the present invention is as follows:

1. the present invention has obtained antibacterial peptide LEAP-2 gene order and the LEAP-2 mature peptide gene mLEAP-2 nucleotide sequence of cabrilla first, not only enriched the gene pool of cabrilla, and can be applicable to prepare recombinant protein, fish immunity preparation or fodder additives, for the physiologic immunity research of cabrilla provides new theory and practice basis;

2. cabrilla antibacterial peptide LEAP-2 gene nucleotide series and mLEAP-2 gene order are expressed at pichia spp recombinant strain, can produce in a large number cabrilla LEAP-2 recombinant protein and mLEAP-2 antibacterial peptide section, greatly reduce production cost, there is very high economic worth;

3. cabrilla antibacterial peptide LEAP-2 recombinant protein provided by the present invention and mLEAP-2 antibacterial peptide, through bacteriostatic experiment, prove to have stronger bacteriostasis, can substitute traditional microbiotic or be applied to especially cabrilla immunological reagent or fodder additives of preparation fish for the preparation of antibiotic preparation, have broad application prospects.

accompanying drawing explanation

Fig. 1 is the agarose gel electrophoresis analysis chart of Epinephelus coioides antimicrobial petide LEAP-2 gene intermediate segment synthetic product;

Fig. 2 is the agarose gel electrophoresis analysis chart of Epinephelus coioides antimicrobial petide LEAP-2 gene 5 ' end fragment synthetic product;

Fig. 3 is the synthetic gel electrophoresis analysis of the PCR for the second time figure of Epinephelus coioides antimicrobial petide LEAP-2 gene 3 ' end fragment;

Fig. 4 is the electrophoresis evaluation figure of the pcr amplification product of LEAP-2 full length gene evaluation;

Fig. 5 is the gel electrophoresis analysis figure that takes turns pcr amplification product through the improved Epinephelus coioides antimicrobial petide LEAP-2 of codon preference mature peptide gene mLEAP-2 second;

Fig. 6 be cloning vector pMD18-T-mLEAP-2 double digestion ( ecoRI, xbaI) proof diagram;

Fig. 7 be expression vector pPICZ α A-mLEAP-2 double digestion ( ecoRI, xbaI) proof diagram;

Fig. 8 be Epinephelus coioide band restriction enzyme site ( ecoRI, xbaI) LEAP-2 gene synthetic product electrophoresis identify figure;

Fig. 9 be cloning vector pMD18-T-LEAP-2 double digestion ( ecoRI, xbaI) proof diagram;

Figure 10 be expression vector pPICZ α A-LEAP-2 double digestion ( ecoRI, xbaI) proof diagram;

Figure 11 is the SDS-PAGE electrophoretic analysis figure of recombinant strain pPICZ α A-LEAP-2-X-33 expression product LEAP-2 recombinant protein;

Figure 12 is the western-blot evaluation figure of recombinant strain pPICZaA-LEAP-2-X-33 expression product LEAP-2 recombinant protein;

Figure 13 is that pPICZ α A-LEAP-2 yeast expression vector builds schematic diagram;

Figure 14 is Epinephelus coioides antimicrobial petide LEAP-2 signal peptide prediction result;

Figure 15 is the aminoacid sequence of cabrilla antibacterial peptide LEAP-2 and the comparison diagram of other fish LEAP-2 aminoacid sequence;

Figure 16 is the analysis of mLEAP-2 Epitope prediction;

Figure 17 is that cabrilla antibacterial peptide LEAP-2 recombinant protein is to vibrio alginolyticus bacteriostatic experiment result;

Figure 18 is that cabrilla antibacterial peptide LEAP-2 recombinant protein is to Aeromonas veronii bacteriostatic experiment result;

Figure 19 is that cabrilla antibacterial peptide LEAP-2 recombinant protein is to intestinal bacteria bacteriostatic experiment result;

Figure 20 is the SDS-PAGE electrophoretic analysis figure of recombinant strain pPICZ α A-mLEAP-2-X-33 expression product mLEAP-2 recombinant protein;

Figure 21 is that Epinephelus coioides antimicrobial petide mLEAP-2 is to vibrio alginolyticus bacteriostatic experiment result.

Embodiment

Below in conjunction with embodiment, the present invention is further illustrated, but be not limited to this.

Embodiment

one, by the amplification of design degenerated primer, obtain Epinephelus coioides antimicrobial petide LEAP-2 gene intermediate segment

First at NCBI(http: //www.ncbi.nlm.nih.gov/) on search zebra fish, large yellow croaker, tilapia, lefteye flounder, rainbow trout antimicrobial peptide LEAP-2 gene order (sequence number is respectively: NM_001128777.1, JN991058.1, XM_003457723.1, EU586111.1, AY362186.1), then with ClustalX 2.0, carry out sequence alignment.According to comparison result design degenerated primer, wherein upstream primer LEAP-2-S is [5 '-TTCACCCAAAGGAAAGCAGC] (SEQ ID NO.6), and downstream primer LEAP-2-A is [5 '-GTCCCGTGGAGCATTCGTAG] (SEQ ID NO.7).Finally use the PCR Mix of Dongsheng bio tech ltd, Guangzhou with M-MLV reverse transcriptase kit (Invitrogen, USA) the Epinephelus coioide liver cDNA that reverse transcription obtains is that template amplification obtains Epinephelus coioides antimicrobial petide LEAP-2 gene intermediate segment, and in the middle of it, fragment length is 220bp(SEQ ID NO.5).The electrophoresis evaluation figure of pcr amplification product is shown in Fig. 1, wherein: M is molecular weight standard; The negative contrast of NC; 1 is pcr amplification product.

two, Epinephelus coioides antimicrobial petide LEAP-2 gene 5 ' end fragment is synthetic

Operation is carried out according to BD SMART RACE cDNA Ampli cation Kit (BD Bioscience Clontech, CA, USA) Protocol.According to the requirement of test kit, according to the sequences Design of the cabrilla antibacterial peptide LEAP-2 intermediate segment that checked order a downstream gene Auele Specific Primer carry out 5 ' RACE amplification.The sequence of this gene-specific primer LEAP2G-A is [5 '-CATCCGAGCGACCCTCTTCAGTGTG] (SEQ ID NO.9).

Amplification procedure is to be used BD SMART RACE cDNA Ampli cation Kit (BD Bioscience Clontech, CA, USA) the Epinephelus coioide liver cDNA Article 1 chain that reverse transcription obtains is template, through the 144th nucleotide sequence to 5 ' end of TaKaRa Taq Hot Start Version (TaKaRa Biotechnology, Japan) method amplification cabrilla antibacterial peptide LEAP-2 intermediate segment sequence.Wherein reaction conditions is: (1) 94 ℃ of sex change 30 seconds, and 72 ℃ are extended 3 minutes, totally 5 circulations; (2) 94 ℃ of sex change 30 seconds, 70 ℃ of annealing 30 seconds, 72 ℃ are extended 3 minutes, totally 5 circulations; (3) 94 ℃ of sex change 30 seconds, 68 ℃ of annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 25 circulations; Last 72 ℃ are extended 5 minutes.The electrophoresis evaluation figure of pcr amplification product is shown in Fig. 2, wherein: M is molecular weight standard; The negative contrast of NC; 1 is pcr amplification product.

The amplified production of 423bp is connected to and on pMD18-T carrier, obtains recombinant plasmid pMD18-T-LEAP2-5 '.Recombinant plasmid pMD18-T-LEAP2-5 ' is carried out to sequencing with a pair of universal primer of pMD18-T, and its sequence is as shown in SEQ ID NO.8.The sequence of sequencing result and Genebank compares, and result shows that the 423bp product that clone obtains is Epinephelus coioides antimicrobial petide LEAP-2 gene 5 ' terminal sequence.

three, Epinephelus coioides antimicrobial petide LEAP-2 gene 3 ' end fragment is synthetic

Operation is pressed BD SMART RACE cDNA Ampli cation Kit (BD Bioscience Clontech, CA, USA) Protocol and is carried out.According to the requirement of test kit, according to the sequences Design of the cabrilla antibacterial peptide LEAP-2 intermediate segment that checked order two upstream primer LEAP2G-S1 and LEAP2G-S2 to carry out nest-type PRC amplification.Article 1, upstream primer LEAP2G-S1 is [5 '-CTGGC TCAGCAGGTGTGTGCGGGTC] (SEQ ID NO.11), and Article 2 upstream primer LEAP2G-S2 is [5 '-CACACTGAAGAGGGTCGCTCGGATG] (SEQ ID NO.12).

PCR is with BD SMART RACE cDNA Ampli cation Kit (BD Bioscience Clontech for the first time, CA, USA) the Epinephelus coioide liver cDNA Article 1 chain that reverse transcription obtains is template, primer is LEAP2G-S1, through the 67th nucleotide sequence to 3 ' poly A end of sequence of touchdown PCR method amplification antibacterial peptide LEAP-2 intermediate segment.Wherein reaction conditions is: 94 ℃ of denaturations 3 minutes; (1) 94 ℃ of sex change 30 seconds, 70 ℃ of (cycle annealing temperature of every increase reduces 1 ℃) annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; (2) 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; Last 72 ℃ are extended 5 minutes.PCR is take 5 times of later products of PCR product dilution for the first time as template, through the 120th nucleotide sequence to 3 ' poly A end of sequence of touchdown PCR method amplification antibacterial peptide LEAP-2 intermediate segment for the second time.Wherein reaction conditions is: 94 ℃ of denaturations 3 minutes; (1) 94 ℃ of sex change 30 seconds, 70 ℃ of (cycle annealing temperature of every increase reduces 1 ℃) annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; (2) 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; Last 72 ℃ are extended 5 minutes.PCR fails to detect band on sepharose for the first time, and the electrophoresis evaluation figure of pcr amplification product is shown in Fig. 3 for the second time, wherein: M is molecular weight standard; The negative contrast of NC; 1 is pcr amplification product.

The amplified production of 471bp is connected to and on pMD18-T carrier, obtains recombinant plasmid pMD18-T-LEAP2-3 '.Recombinant plasmid pMD18-T-LEAP2-3 ' is carried out to sequencing with a pair of universal primer of pMD18-T, and its sequence is as shown in SEQ ID NO.10.The sequence of sequencing result and Genebank compares, and result shows that clone's 471bp product is 3 ' terminal sequence of Epinephelus coioides antimicrobial petide LEAP-2 gene.

four, the splicing of Epinephelus coioides antimicrobial petide LEAP-2 full length gene sequence

The cabrilla antibacterial peptide LEAP-2 gene intermediate segment, 5 ' RACE fragment and 3 ' the RACE fragment that have checked order are spliced, and obtaining total length is the Epinephelus coioides antimicrobial petide LEAP-2 gene cDNA complete sequence (SEQ ID NO.1) of 869bp.Its ORF total length, i.e. 262nd-the 561bp of Epinephelus coioides antimicrobial petide LEAP-2 cDNA complete sequence (SEQ ID NO.1), overall length is 300bp, and infers and its aminoacid sequence (SEQ ID NO.2).

LEAP-2 gene ORF total length design primer the LEAP2FL-S[5 '-TGGTAGAGTCCTCCAGTAAGTGT obtaining according to splicing] (SEQ ID NO.13), LEAP2FL-A[5 '-GCATAATCCCAGTAATGACAACC] (SEQ ID NO.14).Reaction is with M-MLV reverse transcriptase kit (Invitrogen, USA) the Epinephelus coioide liver cDNA that reverse transcription obtains is template, through the antibacterial peptide LEAP-2 ORF full length sequence of touchdown PCR method amplification cabrilla, the product length of amplification is 440bp.PCR reaction conditions is: (1) 94 ℃ of denaturation 3 minutes; (2) 94 ℃ of sex change 30 seconds, 55 ℃ of (cycle annealing temperature of every increase declines 1 ℃) annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; (3) 94 ℃ of sex change 30 seconds, 43 ℃ of annealing 30 seconds, 72 ℃ are extended 2 minutes, totally 15 circulations; Last 72 ℃ are extended 5 minutes.The electrophoresis evaluation figure of pcr amplification product is shown in Fig. 4, wherein: M is molecular weight standard; The negative contrast of NC; 1 is pcr amplification product.PCR product is sent to the order-checking of Hua Da genome company, and sequencing result is consistent with splicing result.

five, bioinformatics method is analyzed Epinephelus coioides antimicrobial petide LEAP-2 mature peptide sequence

Through literature survey and NCBI(http: //www.ncbi.nlm.nih.gov/) site search, obtained the aminoacid sequence of large yellow croaker, tilapia and lefteye flounder LEAP-2 mature peptide.Then use SignalP 4.0 Server(http: //www.cbs.dtu.dk/services/SignalP/) on-line prediction Epinephelus coioides antimicrobial petide LEAP-2 signal peptide sequence (Figure 14).Re-use two sequence analysis softwares of clustalx and GeneDoc, the amino acid of large yellow croaker, tilapia and lefteye flounder LEAP-2 mature peptide and Epinephelus coioides antimicrobial petide LEAP-2 aminoacid sequence are carried out to sequence alignment, prediction obtains the aminoacid sequence (Figure 15) of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide, as shown in SEQ ID NO.4.In addition, by the epitope (Figure 16) of DNAstar software analysis Epinephelus coioides antimicrobial petide LEAP-2 gene, further determine the mature peptide gene order (160bp-300bp of LEAP-2 ORF, altogether 141bp) of the Epinephelus coioides antimicrobial petide LEAP-2 that comprises maximum binding sites.Finally, the RNA secondary facility of this function fragment of having used RNAstructure 5.3 software analysis, finds not have complicated secondary structure.

six, the codon preference of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide gene mLEAP-2 transformation

By analysis, compare the former sequence of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide cDNA and Pichia anomala expression preference password sublist, find to exist in the former sequence of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide cDNA the rare codon of the low efficient expression of pichia spp.Still on the basis that does not change LEAP-2 mature peptide aminoacid sequence, designed 4 transformation primer P1, P2, P3, P4 and used primer bypass method to revise 29 codons; totally 35 Nucleotide; obtain amended LEAP-2 mature peptide gene mLEAP-2 sequence 141bp(SEQ ID NO.3), add protection base, ecoR Iwith xba Ienzyme is cut recognition site, terminator codon and 6 × his label and is total to 176bp(as Fig. 5).Wherein primer P1 contain protection base and ecoR Irestriction enzyme digestion recognition site, primer P4 contain protection base, xba Ienzyme is cut recognition site, terminator codon and 6 × his label.Article four, primer sequence is respectively: P1[5 '-GCTGAATTCATGACCCCATTGTGGAGAAT CATGAACTCCAAGCCATTCGGTGCTTACTG] (SEQ ID NO.15), P2[5 '-GCTC TACACAAACCGGTGGAACACTCGTAGTTGTTTTGACAGTAAGCACCGAAG GCTTG] (SEQ ID NO.16), P3[5 '-TTCCACCGGTTTGTGTAGAGCTG GTCACTGTTCCACCTCCCAAAGATCCTTGTCCGAGCC] (SEQ ID NO.17), P4[5 '-GCTCTAGACTAATGATGATGATGATGATGGTAGTTGACTGGCTCGG ACAAGGATCTTTGG] (SEQ ID NO.18).First round reaction mixes primer P2 with P3, add the PCR Mix of Dongsheng bio tech ltd, Guangzhou, obtains the PCR product of about 99bp, conforms to expection product size.Reaction is carried out according to following condition: 94 ℃ of denaturations 3 minutes; (1) 94 ℃ of sex change 30 seconds, 64 ℃ of (cycle annealing temperature of every increase reduces 1 ℃) annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; (2) 94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; Last 72 ℃ are extended 5 minutes.After first round PCR product dilutes 5 times, as template, take P1 and P4, as primer carries out second, take turns amplification, result obtains the band of about 176bp, conforms to expection size.Reaction conditions is: 94 ℃ of denaturations 3 minutes; (1) 94 ℃ of sex change 30 seconds, 64 ℃ of (cycle annealing temperature of every increase reduces 1 ℃) annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; (2) 94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; Last 72 ℃ are extended 5 minutes.Agarose electrophoresis the results are shown in Figure 5, wherein: M is molecular weight standard; The negative contrast of NC; 1 is pcr amplification product.

seven, contain the cloning vector of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide gene mLEAP-2 sequence

Step 6 is obtained to the separation and purification of goal gene fragment, then with pMD18-T(TAKARA) 4 ℃ of the systems that provide according to this test kit of carrier are connected spend the night (about 16h), to connect product and transform bacillus coli DH 5 alpha, through Amp+ resistance and blue hickie, filter out positive colony, by plasmid extraction kit, extract plasmid, plasmid is through double digestion checking and sequence verification, prove that Epinephelus coioide LEAP-2 mature peptide gene mLEAP-2 is cloned in carrier, called after pMD18-T-mLEAP-2, cloning vector transforms the recombinant bacterial strain called after pMD18-T-mLEAP-2-DH5 α that bacillus coli DH 5 alpha obtains.Use ecoRI, XbaIcloning vector pMD18-T-mLEAP-2 is carried out to double digestion, and restriction enzyme mapping is shown in Fig. 6, wherein M:marker, and NC is pMD18-T-mLEAP-2,1:pMD18-T-mLEAP-2's ecoRI, XbaIdouble digestion product.

eight, contain the expression vector pPICZ of Epinephelus coioides antimicrobial petide LEAP-2 mature peptide gene mLEAP-2 sequenceα the structure of A-mLEAP-2

Cloning vector pMD18-T-mLEAP-2 restriction enzyme ecoRIwith xbaIafter double digestion ,enzyme is cut product E.Z.N.A. gel Extraction Kit reclaims.Reclaim product and carry out agarose gel electrophoresis, separation and purification obtains the Epinephelus coioide mature peptide gene mLEAP-2 sequence of 176bp;

Vector plasmid pPICZ α A is through restriction enzyme ecoRIwith xbaIthe large fragment of separation and purification 3.6kb after double digestion, mix by 1:3 with the Epinephelus coioide LEAP-2 mature peptide mLEAP-2 gene fragment of about 176bp, after connecting 16 hours with 16 ℃ of T4 ligase enzymes, with standard calcium chloride transformation, proceed in escherichia coli DH5a, with the transformant of less salt LB plate screening tool Zeocin resistance, with standard method, extract plasmid, screen the recombinant plasmid of big or small about 3.8kb, use restriction enzyme ecoRIwith xbaIdouble digestion recombinant plasmid, obtain two fragments of about 176bp and 3.6kb, size is identical with expression vector pPICZ α A size with the gene fragment of Epinephelus coioide LEAP-2 mature peptide mLEAP-2 respectively, the gene fragment that proves Epinephelus coioide LEAP-2 mature peptide mLEAP-2 has been cloned in yeast expression vector pPICZ α A, recombinant plasmid called after pPICZ α A-mLEAP-2.Plasmid construction schema is shown in Figure 13.Use ecoRI, XbaIexpression vector pPICZ α A-mLEAP-2 is carried out to double digestion, and restriction analysis figure is shown in Fig. 7, wherein M:marker, and 1:pPICZ α A-mLEAP-2 double digestion product, NC is pPICZ α A double digestion product.

nine, the structure of pichia spp recombinant strain pPICZ α A-mLEAP-2-X-33 of the high efficient expression Epinephelus coioides antimicrobial petide mLEAP-2 of energy

According to the The Easyselect of Invitrogen company ^tM pichiaexpression Kit specification sheets is prepared pichia pastoris X-33 competent cell, and recombinant plasmid pPICZ alpha A-mLEAP-2 uses sacIafter linearization, gel reclaims, and with standard method electric shock conversion pichia pastoris X-33 competent cell, is containing 28 ℃ of constant temperature culture on the YPDS flat board of Zeocin 400 μ g/ml.After about 3d, grow mono-clonal, picking mono-clonal goes out pichia spp recombinant strain pPICZ α A-mLEAP-2-X-33 of the high efficient expression Epinephelus coioides antimicrobial petide mLEAP-2 of energy through inducing culture and evaluation and screening.

ten, utilize pichia yeast genetic engineering bacteria pPICZ α A-mLEAP-2-X-33 Restruction Epinephelus coioides antimicrobial petide mLEAP-2

The mono-clonal of the various engineering bacterias of picking, is inoculated in BMGY respectively, and 28 ℃, 200rpm cultivates OD600 to 2-6, changes BMMY substratum dilution OD600 to 1.0, and every 24h adds 0.5% methyl alcohol in substratum, and 2000rpm after cultivation 24h-96h collects supernatants for 4 ℃.Get 1ml supernatant DOC-TCA-acetone precipitation concentrated after, add 5 × electrophoresis sample-loading buffer, boil after 10 minutes and run Tricine-SDS-PAGE gel electrophoresis by standard method, get negative control simultaneously and process rear electrophoresis by same method.Negative control is that unloaded plasmid pPICZ α A transforms the upper white protein after the mono-clonal growing after X-33 is cultivated.The results are shown in Figure 20, wherein: M: molecular weight of albumen standard; The negative contrast of NC; 1 induces respectively the expression product after 96h for restructuring yeast strains pPICZ α A-mLEAP-2-X-33.Result shows compared with negative control, and recombinant bacterial strain pPICZ α A-mLEAP-2-X-33 expression product exists 10KDaa near new protein band of appearance.

11, Epinephelus coioides antimicrobial petide mLEAP-2 antigenic activity identification experiment

The Epinephelus coioides antimicrobial petide mLEAP-2 that will recombinate adopts immunoblotting (Western blot) method to carry out immunological identification.Primary antibodie is mouse source 6xhis tag monoclonal antibody (Novagen), and two resist the company for sheep anti-mouse igg-HRP(Ding Guo).Result demonstration 6xhis tag monoclonal antibody can be identified the restructuring Epinephelus coioides antimicrobial petide mLEAP-2 of Pichia anomala expression, consistent with Tricine-SDS-PAGE result, proves that the albumen obtaining is Epinephelus coioides antimicrobial petide mLEAP-2.

12, the antibacterial peptide LEAP-2 gene ORF sequence of Epinephelus coioide band restriction enzyme site is synthetic

The cDNA sequence (SEQ ID NO.1) of the Epinephelus coioides antimicrobial petide LEAP-2 obtaining according to splicing, the synthetic two sections of primers of design: upstream primer be the 1st of this fragment to add before the 25th bit base protection base and ecoRIrestriction enzyme enzyme recognition site [5 '-GCTGAATTCATGCAGGAGACAGGCTACTTCACCC] (SEQ ID NO.19), altogether 34bp; Downstream primer is that the 4th at this fragment complementation chain adds to the 19th bit base xbaIenzyme cut recognition site, protection base, 6 × his label and terminator codon [5 '-GCTCTAGCTAATGATGATGATGATGATGGTAGTTCACAGGCTCT] (SEQ ID NO.20), altogether 45bp.With M-MLV reverse transcriptase kit (Invitrogen, USA) the Epinephelus coioide liver cDNA that reverse transcription obtains is template, the ORF sequence that obtains Epinephelus coioides antimicrobial petide LEAP-2 gene through PCR method amplification, PCR reaction conditions is: 94 ℃ of denaturations 3 minutes; (1) 94 ℃ of sex change 30 seconds, 63 ℃ of (cycle annealing temperature of every increase reduces 1 ℃) annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; (2) 94 ℃ of sex change 30 seconds, 49 ℃ of annealing 30 seconds, 72 ℃ are extended 1 minute, totally 15 circulations; Last 72 ℃ are extended 5 minutes.The electrophoresis evaluation figure of pcr amplification product is shown in Fig. 8, wherein: M:marker, 1 is pcr amplification product, the negative contrast of NC.Pcr amplification product size is about 335bp as seen from Figure 8.

13, contain the cloning vector of Epinephelus coioides antimicrobial petide LEAP-2 gene order

Step 9 is obtained to the separation and purification of goal gene fragment, then with pMD18-T(TAKARA) 4 ℃ of the systems that provide according to this test kit of carrier are connected spend the night (about 16h), to connect product and transform bacillus coli DH 5 alpha, through Amp+ resistance and blue hickie, filter out positive colony, by plasmid extraction kit, extract plasmid, plasmid is through double digestion checking and sequence verification, prove that Epinephelus coioide LEAP-2 precursor protein gene ORF sequence clone is in carrier, called after pMD18-T-LEAP-2, cloning vector transforms the recombinant bacterial strain called after pMD18-T-LEAP-2-DH5 α that bacillus coli DH 5 alpha obtains.Use ecoRI, XbaIcloning vector pMD18-T-LEAP-2 is carried out to double digestion, and restriction enzyme mapping is shown in Fig. 9, wherein M:marker, and NC is pMD18-T-LEAP-2,1:pMD18-T-LEAP-2's ecoRI, XbaIdouble digestion product.

14, contain the expression vector pPICZ of Epinephelus coioides antimicrobial petide LEAP-2 gene orderα the structure of A-LEAP-2

Cloning vector pMD18-T-LEAP-2 restriction enzyme ecoRIwith xbaIafter double digestion ,enzyme is cut product E.Z.N.A. gel Extraction Kit reclaims, and carries out agarose gel electrophoresis, and separation and purification obtains the Epinephelus coioide LEAP-2 precursor protein ORF gene order of 335bp;

Vector plasmid pPICZ α A is through restriction enzyme ecoRIwith xbaIthe large fragment of separation and purification 3.6kb after double digestion, mix by 1:3 with the Epinephelus coioide LEAP-2 precursor protein ORF gene fragment of about 335bp, after connecting 16 hours with 16 ℃ of T4 ligase enzymes, with standard calcium chloride transformation, proceed in bacillus coli DH 5 alpha, with the transformant of less salt LB plate screening tool Zeocin resistance, with standard method, extract plasmid, the recombinant plasmid of screening size approximately 4.0 kb, uses restriction enzyme ecoRIwith xbaIdouble digestion recombinant plasmid, obtain two fragments of 335bp and 3.6kb, size is identical with expression vector pPICZ α A size with Epinephelus coioide LEAP-2 precursor protein ORF gene fragment respectively, prove that Epinephelus coioide LEAP-2 precursor protein ORF gene fragment has been cloned in yeast expression vector pPICZ α A, recombinant plasmid called after pPICZ α A-LEAP-2.Plasmid construction schema is shown in Figure 13.Use ecoRI, XbaIexpression vector pPICZ α A-LEAP-2 is carried out to double digestion, and restriction analysis figure is shown in Figure 10, wherein M:marker, 1:pPICZ α A-LEAP-2 double digestion product, NC:pPICZ α A double digestion product.

15, pichia spp recombinant strain pPICZ α A-LEAP-2-X-33 of the high efficient expression Epinephelus coioides antimicrobial petide LEAP-2 precursor protein of energy builds

According to the The Easyselect of Invitrogen company ^tM pichiaexpression Kit specification sheets is prepared pichia pastoris X-33 competent cell, and recombinant plasmid pPICZ alpha A-LEAP-2 uses sacIafter linearization, gel reclaims, and with standard method electric shock conversion pichia pastoris X-33 competent cell, is containing 28 ℃ of constant temperature culture on the YPDS flat board of Zeocin 400 μ g/ml.After about 3d, grow mono-clonal, picking mono-clonal goes out the pichia spp recombinant strain pPICZ α A-LEAP-2-X-33 of the high efficient expression Epinephelus coioides antimicrobial petide LEAP-2 recombinant protein of energy through inducing culture and evaluation and screening.

16, utilize pichia yeast genetic engineering bacteria pPICZ α A-LEAP-2-X-33 Restruction Epinephelus coioides antimicrobial petide LEAP-2 precursor protein

The mono-clonal of the various engineering bacterias of picking, is inoculated in BMGY respectively, and 28 ℃, 200rpm cultivates OD600 to 2-6, changes BMMY substratum dilution OD600 to 1.0, and every 24h adds 0.5% methyl alcohol in substratum, and 2000rpm after cultivation 24h-96h collects supernatants for 4 ℃.Get 1ml supernatant DOC-TCA-acetone precipitation concentrated after, add 5 × electrophoresis sample-loading buffer, boil after 10 minutes and run Tricine-SDS-PAGE gel electrophoresis by standard method, get negative control simultaneously and process rear electrophoresis by same method.Negative control is that unloaded plasmid pPICZ α A transforms the upper white protein after the mono-clonal growing after X-33 is cultivated.The results are shown in Figure 11, wherein: M: molecular weight of albumen standard; The negative contrast of NC; 1,2,3,4: restructuring yeast strains pPICZ α A-LEAP-2-X-33 induces respectively the expression product after 24h, 48h, 72h, 96h.Result shows compared with negative control, and a new protein band appears in recombinant bacterial strain pPICZ α A-LEAP-2-X-33 expression product near 12KDa, and after induction 48h, the expression amount of bacterial strain is the highest.

17, Epinephelus coioides antimicrobial petide LEAP-2 precursor protein antigenic activity identification experiment

The Epinephelus coioides antimicrobial petide LEAP-2 precursor protein of recombinating adopts immunoblotting (Western blot) method to carry out immunological identification.Primary antibodie is mouse source 6xhis tag monoclonal antibody (Novagen), and two resist the company for sheep anti-mouse igg-HRP(Ding Guo).The results are shown in Figure 12, wherein: M: molecular weight of albumen standard; The negative contrast of NC; 1,2,3,4: restructuring yeast strains pPICZ α A-LEAP-2-X-33 expression product Western blot identifies collection of illustrative plates.Result demonstration 6xhis tag monoclonal antibody can be identified the restructuring Epinephelus coioides antimicrobial petide LEAP-2 precursor protein of Pichia anomala expression, consistent with Tricine-SDS-PAGE result, prove that the albumen obtaining is Epinephelus coioides antimicrobial petide LEAP-2 restructuring precursor protein.

18, Epinephelus coioides antimicrobial petide LEAP-2 restructuring precursor protein anti-microbial activity test experience

The main Kirby-Bauer method (being K-B agar diffusion method of the paper) that adopts of experiment detects Epinephelus coioides antimicrobial petide LEAP-2 restructuring precursor protein anti-microbial activity.For totally 3 kinds, the bacterium detecting, vibrio alginolyticus ( vibrioalginolyticus) E259, by Chinese Academy of Science Nanhai Ocean Research Institute, be so kind as to give; Aeromonas veronii ( vickers aeromonas bacillus) B565, by the preservation of the healthy and safe cultivation of Guangdong Province's aquatic products key lab; Bacillus coli DH 5 alpha, buys in microbial strains preservation center, Guangdong Province; Three kinds are gram negative bacterium.Prepare first respectively LB solid medium (tryptone 10g, NaCl 10g, yeast extract 5g, Agar 15g, adds H ₂o to 1000ml, regulate pH=7.2), TCBS solid medium (yeast powder 5.0g, peptone 10.0g, Sulfothiorine 10.0g, Sodium Citrate 10.0g, bilein 5.0g, Glycocholate sodium 3.0g, sucrose 20.0g, sodium-chlor 10.0g, ironic citrate 1.0g, thymol blue 0.04g, agar 15.0g, add water to 1L, pH=8.6 ± 0.1) and artificial seawater solid medium (yeast powder 1g, extractum carnis 3g, Tryptones 5g, agarose 15g, adds 15 ‰ seawater to 1L) standby.Then getting 10 μ l intestinal bacteria original bacteria liquids joins 20ml LB substratum (yeast extract 5g, adds H for tryptone 10g, NaCl 10g ₂o to 1000ml, regulate pH=7.2), get 10 μ l vibrio alginolyticus and Aeromonas veronii original bacteria liquid joins 20ml artificial seawater substratum (yeast powder 1g, extractum carnis 3g, Tryptones 5g, add 15 ‰ seawater to 1L) middle activation, make its OD600 value reach respectively 0.5-1.0.To proceed to the yeast liquid (unloaded) of pPICZ α A and pPICZ α A-LEAP-2-X-33 recombinant yeast pichia pastoris bacterium liquid of abduction delivering is in 4 ℃, the centrifugal 5min of 10000rpm, obtains supernatant standby.Get cleer and peaceful 100 μ l Ampicillin on 100 μ l (0.005 μ g/ μ L) solution and be added to respectively diameter and be on 5mm, sterilized filter paper, it is again dry to filter paper that room temperature is placed 30min.Intestinal bacteria, vibrio alginolyticus and the Aeromonas veronii bacterium liquid of getting 50 μ l activation are added to respectively on LB, TCBS and artificial seawater solid medium, evenly coating.The filter paper that is added with upper cleer and peaceful Ampicillin is placed on the substratum that scribbles bacterium liquid, every plate is placed 5 filter papers altogether.Finally intestinal bacteria flat board is positioned in the incubator of 37 ℃, vibrio alginolyticus, Aeromonas veronii is placed in the incubator of 28 ℃, cultivate the size of observing inhibition zone after 24h.Figure 17 shows is cabrilla antibacterial peptide LEAP-2 recombinant protein to vibrio alginolyticus bacteriostatic experiment result: 1 for being added with the filter paper of Ampicillin, 2 for being added with the filter paper of the yeast liquid supernatant that proceeds to pPICZ α A, and 3 for being added with the filter paper of pPICZ α A-LEAP-2-X-33 recombinant yeast pichia pastoris bacterium liquid supernatant of abduction delivering.Figure 18 shows is cabrilla antibacterial peptide LEAP-2 recombinant protein to Vickers gas pseudomonas bacillus bacteriostatic experiment result: 1 for being added with the filter paper of Ampicillin, 2 for being added with the filter paper of the yeast liquid supernatant that proceeds to pPICZ α A, and 3 for being added with the filter paper of pPICZ α A-LEAP-2-X-33 recombinant yeast pichia pastoris bacterium liquid supernatant of abduction delivering.Figure 19 shows is cabrilla antibacterial peptide LEAP-2 recombinant protein to intestinal bacteria bacteriostatic experiment result: 1 for being added with the filter paper of Ampicillin, 2 for being added with the filter paper of the yeast liquid supernatant that proceeds to pPICZ α A, and 3 for being added with the filter paper of pPICZ α A-LEAP-2-X-33 recombinant yeast pichia pastoris bacterium liquid supernatant of abduction delivering.Experiment arranges 5 supernatant protein concentration gradients altogether, is respectively (2c) ⁰, (2c) ^-1, (2c) ^-2, (2c) ^-3, (2c) ^-4, 3 repetitions of each concentration gradient.Experimental result shows, LEAP-2 recombinant protein is respectively (2c) to vibrio alginolyticus, Aeromonas veronii and colibacillary MIC ^-4, (2c) ^-3, (2c) ^-1.This data declaration LEAP-2 restructuring precursor protein is comparatively obvious to the inhibition of vibrio alginolyticus and Aeromonas veronii, and not too obvious to intestinal bacteria inhibition.

19, Epinephelus coioides antimicrobial petide mLEAP-2 anti-microbial activity test experience

According to method above, detect the fungistatic effect of LEAP-2 mature peptide to vibrio alginolyticus, experimental result is shown in Figure 21.1 for being added with ddH ₂the filter paper of O, 2 for being added with the filter paper of the yeast liquid supernatant that proceeds to pPICZ α A, and 3 for being added with the filter paper of pPICZ α A-mLEAP-2-X-33 recombinant yeast pichia pastoris bacterium liquid supernatant of abduction delivering, and 4 for being added with the filter paper of Ampicillin.Experimental result shows, antibacterial peptide mLEAP-2 has obvious inhibition to vibrio alginolyticus.

Above embodiment is only for introducing preferred case of the present invention, and to those skilled in the art, any apparent changes and improvements of carrying out in the scope that does not deviate from spirit of the present invention, all should be regarded as a part of the present invention.

<110> South China Normal University

<120> Epinephelus coioides antimicrobial petide LEAP-2 gene, carrier, recombinant bacterial strain and albumen and application thereof

<130>

<150> 201310087298.X

<151> 2013-03-18

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 869

<212> DNA

<213> Epinepheluscoioides

<400> 1

acatgggggt cacaactgag ttcgctgagt caggctgact tcaagcaaca ctgcaactaa 60

tgaacatctg acgccacgca aactcagaga ctcacgacgt ggattcaaga tccgtaaagc 120

tgacctggta gagtcctcca gtaagtgttg gacatcaggg agcaaagctg gttgagatca 180

ggtttactca agactgagga gcagcaggtc tataagaaga actttctact gttactggca 240

aataagtgaa actgtgcaaa gatgcaggag acaggctact tcacccaaag gaaagcagca 300

gtggcactgt gcattgtgct gctagtcttg gctcagcagg tgtgtgcagg accgttggtc 360

cagtccagct ctgaccagaa ggcagattca ggcgtccaca cactgaagag ggtcgctcgg 420

atgaccccgc tgtggaggat catgaacagt aaaccgtttg gagcttactg ccagaacaac 480

tacgaatgct ccacgggact ctgcagggcg ggacattgct ccaccagcca gcgctcgctc 540

tcagagcctg tgaactacta gacgtcccag gaaagcaacc agcgtgttta catgagtgca 600

cagccgtaat cctaatgaaa ggttgtcatt actgggatta tgcacatatc caggcttttt 660

ttaaaaatca attttatatt tatatgtgcc aatacgttgc tgatgatatc taaatgtttc 720

tatgaattta cacagtagtt atatcaaaga gaaagcatgt aactgctcca cttggtgtat 780

ttcagacgtg agaatacagg tggtgggctg aggcaacagg gtcaagtgca aaaatgtgag 840

gaaaaaaaaa aaaaaaaaaa aaaaaaaaa 869

<210> 2

<211> 99

<212> PRT

<213> Epinepheluscoioides

<400> 2

Met Gln Glu Thr Gly Tyr Phe Thr Gln Arg Lys Ala Ala Val Ala Leu

1 5 10 15

Cys Ile Val Leu Leu Val Leu Ala Gln Gln Val Cys Ala Gly Pro Leu

20 25 30

Val Gln Ser Ser Ser Asp Gln Lys Ala Asp Ser Gly Val His Thr Leu

35 40 45

Lys Arg Val Ala Arg Met Thr Pro Leu Trp Arg Ile Met Asn Ser Lys

50 55 60

Pro Phe Gly Ala Tyr Cys Gln Asn Asn Tyr Glu Cys Ser Thr Gly Leu

65 70 75 80

Cys Arg Ala Gly His Cys Ser Thr Ser Gln Arg Ser Leu Ser Glu Pro

85 90 95

Val Asn Tyr

<210> 3

<211> 141

<212> DNA

<213> Epinepheluscoioides

<400> 3

atgaccccat tgtggagaat catgaactcc aagccattcg gtgcttactg tcaaaacaac 60

tacgagtgtt ccaccggttt gtgtagagct ggtcactgtt ccacctccca aagatccttg 120

tccgagccag tcaactacta g 141

<210> 4

<211> 46

<212> PRT

<213> Epinepheluscoioides

<400> 4

Met Thr Pro Leu Trp Arg Ile Met Asn Ser Lys Pro Phe Gly Ala Tyr

1 5 10 15

Cys Gln Asn Asn Tyr Glu Cys Ser Thr Gly Leu Cys Arg Ala Gly His

20 25 30

Cys Ser Thr Ser Gln Arg Ser Leu Ser Glu Pro Val Asn Tyr

35 40 45

<210> 5

<211> 220

<212> DNA

<213> Epinepheluscoioides

<400> 5

ttcacccaaa ggaaagcagc agtggcactg tgcattgtgc tgctagtctt ggctcagcag 60

gtgtgtgcag gaccgttggt ccagtccagc tctgaccaga aggcagattc aggcgtccac 120

acactgaaga gggtcgctcg gatgaccccg ctgtggagga tcatgaacag taaaccgttt 180

ggagcttact gccagaacaa ctacgaatgc tccacgggac 220

<210> 6

<211> 20

<212> DNA

<213> artificial sequence

<400> 6

ttcacccaaa ggaaagcagc 20

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

gtcccgtgga gcattcgtag 20

<210> 8

<211> 423

<212> DNA

<213> Epinepheluscoioides

<400> 8

acatgggggt cacaactgag ttcgctgagt caggctgact tcaagcaaca ctgcaactaa 60

tgaacatctg acgccacgca aactcagaga ctcacgacgt ggattcaaga tccgtaaagc 120

tgacctggta gagtcctcca gtaagtgttg gacatcaggg agcaaagctg gttgagatca 180

ggtttactca agactgagga gcagcaggtc tataagaaga actttctact gttactggca 240

aataagtgaa actgtgcaaa gatgcaggag acaggctact tcacccagag gagagcagca 300

gtggcactgt gcattgtgct gctagtcttg gctcagcagg tgtgtgcagg accgttggtc 360

cagtccagct ctgaccagaa ggcagattca ggcgtccaca cactgaagag ggtcgctcgg 420

atg 423

<210> 9

<211> 25

<212> DNA

<213> artificial sequence

<400> 9

catccgagcg accctcttca gtgtg 25

<210> 10

<211> 471

<212> DNA

<213> Epinepheluscoioides

<400> 10

cacactgaag agggtcgctc ggatgacccc gctgtggagg atcatgaaca gtaaaccgtt 60

tggagcttac tgccagaaca actatgagtg ctccacggga ctctgcaggg cgggacattg 120

ctccaccagc cagcgctcgc tctcagagcc tgtgaactac tagacgtccc aggaaagcaa 180

ccagcgtgtt tacatgagtg cacagccgta atcctaatga aaggttgtca ttactgggat 240

tatgcacata tccaggcttt ttttaaaaat caattttata tttatatgtg ccaatacgtt 300

gctgatgata tctaaatgtt tctatgaatt tacacagtag ttatatcaaa gagaaagcat 360

gtaactgctc cacttggtgt atttcagacg tgagaataca ggtggtgggc tgaggcaaca 420

gggtcaagtg caaaaatgtg aggaaaaaaa aaaaaaaaaa aaaaaaaaaa a 471

<210> 11

<211> 25

<212> DNA

<213> artificial sequence

<400> 11

ctggctcagc aggtgtgtgc gggtc 25

<210> 12

<211> 25

<212> DNA

<213> artificial sequence

<400> 12

cacactgaag agggtcgctc ggatg 25

<210> 13

<211> 23

<212> DNA

<213> artificial sequence

<400> 13

tggtagagtc ctccagtaag tgt 23

<210> 14

<211> 23

<212> DNA

<213> artificial sequence

<400> 14

gcataatccc agtaatgaca acc 23

<210> 15

<211> 59

<212> DNA

<213> artificial sequence

<400> 15

gctgaattca tgaccccatt gtggagaatc atgaactcca agccattcgg tgcttactg 59

<210> 16

<211> 60

<212> DNA

<213> artificial sequence

<400> 16

gctctacaca aaccggtgga acactcgtag ttgttttgac agtaagcacc gaatggcttg 60

<210> 17

<211> 60

<212> DNA

<213> artificial sequence

<400> 17

ttccaccggt ttgtgtagag ctggtcactg ttccacctcc caaagatcct tgtccgagcc 60

<210> 18

<211> 60

<212> DNA

<213> artificial sequence

<400> 18

gctctagact aatgatgatg atgatgatgg tagttgactg gctcggacaa ggatctttgg 60

<210> 19

<211> 34

<212> DNA

<213> artificial sequence

<400> 19

gctgaattca tgcaggagac aggctacttc accc 34

<210> 20

<211> 44

<212> DNA

<213> artificial sequence

<400> 20

gctctagcta atgatgatga tgatgatggt agttcacagg ctct 44

Claims

1. cabrilla antibacterial peptide LEAP-2 precursor protein, its aminoacid sequence is as shown in SEQ ID NO.2, or the aminoacid sequence shown in SEQ ID NO.2 is substituted, lacks and/or increases one or more amino acid and/or end modified and have equal or more highly active albumen.

2. the gene of cabrilla antibacterial peptide LEAP-2 precursor protein described in coding claim 1.

3. gene according to claim 2, it contains the nucleotide sequence shown in SEQ ID NO.1 262-561 bp.

4. cabrilla antibacterial peptide LEAP-2 mature peptide albumen, its aminoacid sequence is as shown in SEQ ID NO.4, or the aminoacid sequence shown in SEQ ID NO.4 is substituted, lacks and/or increases one or more amino acid and/or end modified and have equal or more highly active albumen.

5. the gene of cabrilla antibacterial peptide LEAP-2 mature peptide albumen described in coding claim 4.

6. gene according to claim 5, it is the nucleotide sequence shown in SEQ ID NO.1 421-561 bp, or the nucleotide sequence shown in SEQ ID NO.3.

7. carry the carrier of gene described in claim 2,3,5 or 6.

8. contain the recombinant bacterial strain of gene described in claim 2,3,5 or 6.

9. produce the method for cabrilla antibacterial peptide LEAP-2 precursor protein or cabrilla antibacterial peptide LEAP-2 mature peptide albumen, comprise the expression vector that carries gene described in claim 2,3,5 or 6 is imported in host cell, express and obtain LEAP-2 precursor protein or LEAP-2 mature peptide albumen.

10. the albumen described in claim 1 or 4 is in the application of preparing in antibiotic preparation or raising aquatic animal immunizing power preparation.