CN103740771B - Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol - Google Patents
Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol Download PDFInfo
- Publication number
- CN103740771B CN103740771B CN201410046736.2A CN201410046736A CN103740771B CN 103740771 B CN103740771 B CN 103740771B CN 201410046736 A CN201410046736 A CN 201410046736A CN 103740771 B CN103740771 B CN 103740771B
- Authority
- CN
- China
- Prior art keywords
- butyleneglycol
- klebsiella pneumoniae
- produces
- budc
- source
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of method that Klebsiella pneumoniae produces 2R, 3R-butyleneglycol, under oxygen restricted condition, take glycerine as carbon source, by the Klebsiella pneumoniae fermentative production 2R of butyleneglycol reductase gene budC inactivation, and 3R-butyleneglycol.Utilize the product 2R that method of the present invention obtains, 3R-butyleneglycol, there is very high optical purity.
Description
Technical field
The present invention relates to a kind of method of producing 2R, 3R-butyleneglycol, be related specifically to a kind of method that Klebsiella pneumoniae produces 2R, 3R-butyleneglycol.
Background technology
Klebsiella pneumoniae is a kind of important industrial microorganism, for the production of Industrial products such as 1,3-PD, 2,3-butanediol, acetoin and 2-KDGs.
2,3-butanediol is a kind of bulk chemical, and it can be used for the industry such as synthetic plastics and rubber, also be considered to a kind of potential biofuel, 2S, 3S-butyleneglycol and 2R simultaneously, 3R-butyleneglycol due to zero pour lower, can be used for frostproofer (CelinskaE, GrajekW, Biotechnologicalproductionof2,3-butanediol-Currentstateandprospects.BiotechnolAdv, 2009,27,715-725).2,3-butanediol has two chiral carbon, forms meso-2,3-butanediol, 2S, 3S-butyleneglycol and 2R, 3R-butyleneglycol three kinds of steric isomers.2S, 3S-butyleneglycol and 2R, 3R-butyleneglycol are enantiomers, and ctystallizing point is identical with character such as boiling points.
Have multiple-microorganism to synthesize 2,3-butanediol, wherein bacillus polymyxa, Klebsiella pneumoniae, citric acid product acidfast bacilli and serratia marcescens have higher 2,3-butanediol production performance, are the bacterial strains with prospects for commercial application.Current report genus bacillus mainly generates 2R, 3R butyleneglycol, with a small amount of meso-2,3-butanediol; And Klebsiella bacteria mainly generates meso-2,3-butyleneglycol is also with a small amount of 2S, 3S-butyleneglycol (UiS, MasudaT, MasudaH, MurakiH, Mechanismfortheformationof2,3-butanediolstereoisomersinBacilluspolymyxa.JFermentTech nol, 1986,64,481-486).
In Klebsiella, 2,3-butyleneglycol route of synthesis starts from pyruvic acid, two molecule pyruvate decarboxylation form a part acetylactis, acetylactis decarboxylation under the catalysis of decarboxylase forms R-acetoin (3-hydroxy-2-butanone), acetoin consumes NADH and forms meso-2,3-butanediol under the catalysis of butyleneglycol reductase enzyme.Acetylactis can form di-acetyl by non-enzymatic catalysis, di-acetyl reduces and forms S-acetoin under the catalysis of butanediol dehydrogenase, S-acetoin is reduction formation 2S under the catalysis of butanediol dehydrogenase further, 3S-butyleneglycol (XiaoZ, XuP, Acetoinmetabolisminbacteria.CritRevmicrobial, 2007,33,127-140).
The 2,3-butanediol of microorganisms producing is the mixture of two kinds of isomer, has relevant report to utilize engineering strain to produce the 2,3-butanediol of single steric configuration at present.
In Klebsiella, butanediol dehydrogenase is by budC genes encoding, and this enzyme has ability acetoin being reduced into butyleneglycol, also has ability di-acetyl being reduced into S-acetoin, and it is to forming S configuration hydroxyl after the ketone group reduction of substrate; Therefore this enzyme reduction R-acetoin forms meso-2,3-butanediol, and reduction S-acetoin forms 2S, 3S-butyleneglycol.By deriving from the butanediol dehydrogenase gene of Klebsiella pneumoniae at expression in escherichia coli, express the butanediol dehydrogenase of Brevibacterium saccharolyticum simultaneously, the engineering strain obtained can utilize di-acetyl to produce 2S, 3S-butyleneglycol (UiS.etal., Productionofl ?2,3 ?butanediolbyanewpathwayconstructedinEscherichiacoliLett. Appl.Microbiol., 2004,39,533 – 537).
By at the acetolactate synthestase of expression in escherichia coli subtilis and acetolactate decarboxylase gene, express the butanediol dehydrogenase gene in the sources such as Bacillus subtilus again, the engineering strain obtained can utilize glucose to synthesize 2R for carbon source, 3R-butyleneglycol (YanY, LeeC, LiaoJ, Enantioselectivesynthesisofpure (R, R)-2,3-butanediolinEscherichiacoliwithstereospecificsecondary alcoholdehydrogenases.2009, OrgBiomolChem7,3914).
There is no at present and utilize Klebsiella pneumoniae fermentative production 2R, the report of 3R-butyleneglycol.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of method of producing 2R, 3R-butyleneglycol.By the method, glycerine can be utilized for the 2R of carbon source through fermentation production high-optical-purity, 3R-butyleneglycol.
For solving the problems of the technologies described above, Klebsiella pneumoniae (Klebsiellapneumoniae) is utilized to produce 2R in the present invention, the method of 3R-butyleneglycol, under oxygen restricted condition, by the Klebsiella pneumoniae of butanediol dehydrogenase enzyme gene budC inactivation, take glycerine as carbon source, fermentative production 2R, 3R-butyleneglycol.
In the present invention, described butanediol dehydrogenase, also referred to as diacetyl reductase and acetoin reductase enzyme, can redox reaction between catalysis di-acetyl and acetoin, the redox reaction that also can transform between catalysis acetoin and 2,3-butanediol.In Klebsiella pneumoniae, budC gene reading frame is made up of 771 bases, 256 amino-acid residues of encoding.
In the present invention, utilize Klebsiella pneumoniae to produce the method for 2R, 3R-butyleneglycol, its concrete steps comprise:
(1) the Klebsiella pneumoniae mutant strain of butanediol dehydrogenase gene budC inactivation is built;
(2) by glycerine, nitrogenous source, phosphorus source, metal ion and trace element and water, substratum is mixed with;
(3) in the substratum prepared in step (2), the Klebsiella pneumoniae mutant strain of access butanediol dehydrogenase gene budC inactivation, fermentation culture is carried out under oxygen restricted condition, transformation of glycerol is become 2R by the Klebsiella pneumoniae mutant strain of butanediol dehydrogenase gene budC inactivation, 3R-butyleneglycol and 1, the meta-bolitess such as ammediol, and accumulate in fermented liquid.Namely in culturing process, Klebsiella pneumoniae mutant strain accumulates 2R, 3R-butyleneglycol while consuming glycerine in fermented liquid.
In described step (2), nitrogenous source is selected from: organic nitrogen source and inorganic nitrogen-sourced.Wherein, organic nitrogen source is selected from: corn steep liquor, yeast powder, peptone and soybean cake powder; Inorganic nitrogen-sourcedly to be selected from: ammonium salt, nitric acid and its esters, nitrous acid and its esters and urea.
In described step (2), phosphorus source is the material containing phosphoric, is selected from: phosphoric acid and phosphoric acid salt.
In described step (2), metal ion comprises: potassium, magnesium, iron and manganese; Trace element comprises: zinc, calcium, molybdenum, cobalt, copper, nickel and boron.
In described step (3), oxygen restricted condition is: oxygen-supplying amount is less than thalline maximal aerobic power, wherein thalli growth logarithmic phase and stationary phase Dissolved Oxygen concentration Control below 5%.Described oxygen restricted condition also claims micro-oxygen conditions.
In described step (3), the temperature of fermentation culture is 28 ~ 42 DEG C, and cultivation pH is pH5.5-7.5; The time of fermentation culture is 10 ~ 70 hours.
Described Klebsiella pneumoniae is Klebsiella pneumoniae CGMCC1.6366.
Beneficial effect of the present invention is as follows:
1. raw material used is renewable resources glycerine.
2. product 2R, 3R-butyleneglycol has very high optical purity, not containing 2S in tunning, 3S-butyleneglycol (as embodiment 2,3,4), 2R, 3R-butyleneglycol proportion in total butyleneglycol high (if the proportion in total butyleneglycol of 2R, 3R-butyleneglycol in embodiment 4 is 91%) simultaneously.
3. utilize glycerol fermentation to produce in the process of 1,3-PD at Klebsiella pneumoniae, improve 2,3-butanediol value-added content of product, thus improve the overall economic benefit in whole fermenting process.
Embodiment
The reagent below adopted and biomaterial if not otherwise specified, are commercially produced product.
Embodiment 1
CGMCC1.6366 bacterial strain in the present embodiment is the preservation of China General Microbiological culture presevation administrative center, has amicillin resistance.
1) seed culture medium is prepared
Peptone 10g/L, yeast powder 5g/L, sodium-chlor 5g/L, with tap water preparation, be dispensed in 250mL Erlenmeyer flask, liquid amount 50mL, sterilizing.
2) glycerine, nitrogenous source, phosphorus source and other components are mixed with fermention medium
Glycerine 30g/L, ammonium sulfate 4g/L, dipotassium hydrogen phosphate 0.69g/L, potassium primary phosphate 0.25g/L, magnesium sulfate 0.2g/L, yeast powder 1.5g/L, micro-1.0ml/L, ferrous solution 1.0ml/L.
Wherein, trace element is: manganous sulfate 100mg/L, zinc chloride 70mg/L, Sodium orthomolybdate 35mg/L, boric acid 60mg/L, cobalt chloride 200mg/L, copper sulfate 29.28mg/L, nickelous chloride 25mg/L, concentrated hydrochloric acid (37%) 0.9ml/L.
Ferrous solution is: add ferrous sulfate 5.0g, the concentrated hydrochloric acid 4ml of 37% in every premium on currency.
3) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access wild-type Klebsiella pneumoniae CGMCC1.6366 lawn, 37 DEG C of aerobic cultivations of shaking table, rotating speed is 180 rpms, cultivates 12 hours.
4) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 3L fermention medium, ventilation 1L per minute, mixing speed 250 rpms, temperature 37 DEG C, the pH utilizing sodium hydroxide solution to control fermenting process is 6.0, when glycerol concentration is reduced to 3g/L, stream glycerol adding, controls glycerol concentration in 3-40g/L scope, fermentation culture 48 hours.
Utilize gas-chromatography to detect the product in fermented liquid and substrate, adopt Japanese Shimadzu Corporation GC2012 gas chromatograph, equipment RESTEK company
chiral chromatographic column, injector temperature sets 225 DEG C, detector adopts FID(hydrogen flame) detector, detector temperature sets 225 DEG C, column oven temperature programming, initial 50 DEG C, with 5 DEG C of per minute ramp to 75 DEG C, retain 8 minutes, with 20 DEG C of per minute ramp to 200 DEG C, retain 2 minutes.
Detected result is: glycerine 21.7g/L, 1,3-PD 59.0g/L, 2R, 3R-butyleneglycol 5.5g/L, meso-2,3-butanediol 14.2g/L, 2S, 3S-butyleneglycol 1.0g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 26%.
Embodiment 2
One, the structure of Klebsiella pneumoniae CGMCC1.6366budC mutant strain
Step is as follows:
1, utilize pcr amplification Klebsiella pneumoniae butanediol dehydrogenase (budC) and upstream and downstream flanking sequence, be connected to cloning vector by TA cloning process, and carry out determined dna sequence.
According to Klebsiella pneumoniae MGH78578(Genbank:CP000647) genomic information, design butanediol dehydrogenase PCR primer, shown in upstream primer budC-s:GCCATCCAGGAAGAGAAAAAATATCA(SEQIDNO.1), shown in downstream primer budC-a:AGACGTTTGTACGCCTGGGTAGAAG(SEQIDNO.2).
By above-mentioned primer, with Klebsiella pneumoniae CGMCC1.6366 genomic dna for template, through pcr amplification, obtain butanediol dehydrogenase (budC) gene fragment, be connected on pMD-18Tsimple plasmid (commerical prod) by TA cloning process, called after pMD18T-budC plasmid, sequencing results is as follows:
BudC gene adjacent upstream partial sequence is:
Shown in GCCATCCAGGAAGAGAAAAAATATCAGCGCCTGTCCGGCGTCGAGTTCGGGCCGAT GGATTTTAAAGCCTATGCCGAGTCCTTCGGCGCCAAAGGGTTTGCCGTGGAAAGCG CTGAGGCGCTGGAGCCGACCCTGCGCGCGGCGATGGACGTCGACGGCCCGGCGGTA GTGGCCATCCCGGTGGATTATCGCGATAACCCGCTGCTGATGGGTCAGCTGCATCT GAGTCAGATTCTGTAAGTCATCACAATAAGGAAAGGAAA(SEQIDNO.3).
BudC gene reading frame is:
ATGAAAAAAGTCGCACTTGTTACCGGCGCCGGCCAGGGGATTGGTAAAGCTATCGCCCTTCGTCTGGTGAAGGATGGATTTGCCGTGGCCATTGCCGATTATAACGACGCCACCGCCAAAGCGGTCGCCTCCGAAATCAACCAGGCCGGCGGCCGCGCCATGGCGGTGAAAGTGGATGTCTCCGACCGCGATCAGGTGTTTGCCGCCGTCGAACAGGCGCGCAAAACGCTGGGCGGCTTCGACGTCATCGTCAACAACGCCGGCGTGGCGCCGTCCACGCCGATCGAGTCCATTACCCCGGAGATTGTCGATAAAGTTTACAATATCAACGTTAAAGGGGTGATCTGGGGCATTCAGGCGGCGGTCGAGGCCTTTAAGAAAGAGGGGCACGGCGGGAAAATCATTAACGCCTGTTCCCAGGCCGGCCACGTCGGCAACCCGGAGCTGGCGGTGTATAGCTCCAGTAAATTCGCCGTACGCGGCTTAACCCAGACCGCCGCTCGCGACCTCGCGCCGCTGGGCATCACGGTCAACGGCTACTGCCCGGGGATCGTCAAAACGCCGATGTGGGCCGAAATTGACCGCCAGGTGTCCGAAGCTGCCGGTAAACCGCTGGGTTACGGTACCGCCGAGTTCGCCAAACGCATCACCCTTGGTCGTCTGTCCGAACCGGAAGATGTCGCCGCCTGCGTCTCCTATCTTGCCAGCCCGGATTCTGATTACATGACCGGTCAGTCATTGCTGATCGACGGCGGGATGGTATTTAACTAA(SEQIDNO. 4).
BudC gene adjacent downstream partial sequence is:
Shown in TAAATAATAAGCTCTGACATGGCTTGCCCCTGCTGATATGCAGGGGCTTTTTTTGG TTTGGGTGTGAGCATCGTGCAAAACGCAGCAACGATATTTGAAGGTCTCTGGCACG ACGTGGGCAATCTGACTGGGTTGAAGGCCTGCTTTGAGCGAGGAGCATGTATTTTT CTTCACCCTCTACTTCGTCCATTCTTTATGCAGTAACGCATAGATGTATGTGTCGT CATACCTTGCCTTACCATCGTCGTTTTCAAAGGAGACAAACTCTTTAAAACAACCT TCCTGTCGCATATGCAAACGTTCACAGAGTTTTTGAGAGGCCAGGTTGTAAACTTC TACCCAGGCGTACAAACGTCT(SEQIDNO.5).
2, the gene order utilizing step 1 to be cloned into, preparation both sides are connected with the DNA fragmentation connecting resistance box in the middle of homology arm.
In this step, adopt in intestinal bacteria, utilize the catalysis of Red recombinase, DNA fragmentation and the pMD18T-budC plasmid with homology arm connection resistance box carry out homologous recombination, obtain the budC gene of inactivation that pMD18T-budC plasmid recombinates, this plasmid is utilized to be had the DNA fragmentation of long homology arm by pcr amplification as template, these fragment both sides are connected with the sequence with budC gene upstream and downstream sequence homology, middle connection resistance box.
The materials such as the plasmid of this step principle of operation and use and bacterial strain can see (Weiet.al.RedrecombinaseassistedgenereplacementinKlebsiel lapneumoniaeJournalofIndustrialMicrobiology & Biotechnology2012), and concrete steps are as follows:
A.pMD18T-budC plasmid thermal shock is transformed in the bacillus coli DH 5 alpha-pIJ790 containing pIJ790 plasmid, called after DH5 α-pMD18T-budC.
Preparation DH5 α-pMD18-budC competent cell, at yeast culture after 1 hour, adds the pectinose of 10mmol/L, the expression of Red recombinase in induction pIJ790 plasmid.
B. design primer budC-s2 and budC-a2, sequence is respectively:
Shown in AGATAGGAGACGCAGGCGGCGACATCTTCCGGTTCGGACATTCCGGGGATCCGTCG ACC(SEQIDNO.6) and CAGGCGCGCAAAACGCTGGGCGGCTTCGACGTCATCGTCATGTAGGCTGGAGCTGC TTC(SEQIDNO.7 shown).
Primer budC-s2's
" AGATAGGAGACGCAGGCGGCGACATCTTCCGGTTCGGAC " sequence and budC gene corresponding sequence homology, primer budC-a2's
" CAGGCGCGCAAAACGCTGGGCGGCTTCGACGTCATCGTCA " sequence and budC gene corresponding sequence homology.
Utilize primer budC-s2 and budC-a2, with plasmid pIJ778 for template amplification goes out to be about the DNA fragmentation A of 1491bp.The two ends of this fragment have the homology arm with budC sequence homology respectively, and tundish contains the streptomycin resistance gene aadA deriving from pIJ778 plasmid.
C. DNA fragmentation A transformed competence colibacillus DH5 α-pMD18T-budC competent cell is utilized.Utilize electric shock transformation method, conversion voltage is 2000V, and select the bacterial strain of streptomycin resistance, Streptomycin sulphate consumption is 50mg/L.
BudC analogous parts on the homologous sequence of DNA fragmentation A both sides and plasmid pMD18T-budC is recombinated, and obtains plasmid, and called after pMD18T-C plasmid.
D. utilize shown in primer budC-s(SEQIDNO.1) and budC-a(SEQIDNO.2 shown in), with pMD18T-C plasmid for template carries out pcr amplification, the DNA fragmentation B of acquisition 2394bp.
DNA fragmentation B two ends have budC gene and the flanking sequence of 516bp and 466bp respectively, and this sequence is as homology arm.Have streptomycin resistance gene aadA in the middle of DNA fragmentation B, DNA fragmentation B is for carrying out the linear DNA fragment of budC gene recombination on CGMCC1.6366 karyomit(e).
3, conversion or combining method is utilized to be transferred in Klebsiella pneumoniae CGMCC1.6366 by the DNA fragmentation B of preparation, butanediol dehydrogenase gene on DNA fragmentation B and karyomit(e) carries out homologous recombination, screening obtains the bacterial strain of strain chromosome butanediol dehydrogenase gene recombination inactivation, and concrete steps are as follows:
A. by pDK6-red Plastid transformation in CGMCC1.6366, obtain CGMCC1.6366-pDK6-red bacterial strain, the electroporated CGMCC1.6366-pDK6-red competent cell of linear DNA fragment B.Streptomycin sulphate is utilized to screen resistant strain.
B. the checking of recombinant bacterium, design verification primer Yanzheng778z:
Shown in AGAATCTCGCTCTCTCCAGGGGAAG(SEQIDNO.8), its sequence pair answers one section of sequence in the middle of streptomycin resistance gene aadA.
Utilize shown in primer budC-s(SEQIDNO.1) and Yanzheng778z, with the bacterial strain STb gene grown for template carries out pcr amplification, product D NA fragment is 1274bp, and with starting strain CGMCC1.6366 STb gene for template carries out PCR without specific band, show that the recombinant bacterium obtained is correct, called after CGMCC1.6366-budC-.The butanediol dehydrogenase gene of this bacterial strain is inactivation by homologous recombination.
Two, the Klebsiella pneumoniae CGMCC1.6366-budC-fermentative production 2R of butanediol dehydrogenation enzyme deactivation is utilized, 3R-butyleneglycol
1) seed culture medium and fermention medium is prepared
Seed culture medium and fermention medium is prepared according to embodiment 1.
2) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access the Klebsiella pneumoniae CGMCC1.6366-budC-lawn of preparation, 28 DEG C of aerobic cultivations of shaking table, rotating speed is 200 rpms, cultivates 12 hours.
3) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 4L fermention medium, ventilation 2L per minute, mixing speed 200 rpms, temperature 28 DEG C, utilizes 30% sodium hydroxide solution to control fermenting process pH5.5, fermentation culture 10 hours.
Detect fermented liquid component according to the GC conditions in embodiment 1, result is: glycerine 3.2g/L, 1,3-PD 13.8g/L, 2R, 3R-butyleneglycol 1.1g/L, meso-2,3-butanediol 0.3g/L, 2S, 3S-butyleneglycol 0.0g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 78%.
Embodiment 3
1) seed culture medium and fermention medium is prepared
Seed culture medium and fermention medium is prepared according to embodiment 1.
2) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access Klebsiella pneumoniae CGMCC1.6366-budC-lawn prepared by embodiment 2,42 DEG C of aerobic cultivations of shaking table, rotating speed is 200 rpms, cultivates 12 hours.
3) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 4L fermention medium, ventilation 1L per minute, mixing speed 150 rpms, temperature 42 DEG C, utilizes sodium hydroxide solution to control fermenting process pH7.5, when glycerol concentration is reduced to 5g/L, stream glycerol adding, controls glycerol concentration in 5-40g/L scope, fermentation culture 70 hours.
Detect fermented liquid component according to the GC conditions in embodiment 1, result is: glycerine 33.3g/L, 1,3-PD 65.9g/L, 2R, 3R-butyleneglycol 19.2g/L, meso-2,3-butanediol 3.9g/L, 2S, 3S-butyleneglycol 0.0g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 83%.
Embodiment 4
1) seed culture medium and fermention medium is prepared
Seed culture medium and fermention medium is prepared according to embodiment 1.
2) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access Klebsiella pneumoniae CGMCC1.6366-budC-lawn prepared by embodiment 2,37 DEG C of aerobic cultivations of shaking table, rotating speed is 180 rpms, cultivates 12 hours.
3) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 3L fermention medium, ventilation 1L per minute, mixing speed 250 rpms, temperature 37 DEG C, utilizes sodium hydroxide solution to control fermenting process pH6.0, when glycerol concentration is reduced to 3g/L, stream glycerol adding, controls glycerol concentration in 3-40g/L scope, fermentation culture 48 hours.
Detect fermented liquid component according to the GC conditions in embodiment 1, result is: glycerine 18.3g/L, 1,3-PD 55.3g/L, 2R, 3R-butyleneglycol 24.6g/L, meso-2,3-butanediol 2.3g/L, 2S, 3S-butyleneglycol 0.0g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 91%.
Embodiment 5
The fermentation that wild strain utilizes glucose to be carbon source.
1) seed culture medium is prepared
Seed culture medium is prepared according to embodiment 1.
2) fermention medium is mixed with
Glucose 50g/L, ammonium sulfate 4g/L, dipotassium hydrogen phosphate 0.69g/L, potassium primary phosphate 0.25g/L, magnesium sulfate 0.2g/L, yeast powder 1.5g/L, micro-1.0ml/L, ferrous solution 1.0ml/L.
Wherein, trace element is: manganous sulfate 100mg/L, zinc chloride 70mg/L, Sodium orthomolybdate 35mg/L, boric acid 60mg/L, cobalt chloride 200mg/L, copper sulfate 29.28mg/L, nickelous chloride 25mg/L, concentrated hydrochloric acid (37%) 0.9ml/L.
Ferrous solution is: add ferrous sulfate 5.0g, the concentrated hydrochloric acid 4ml of 37% in every premium on currency.
3) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access wild-type Klebsiella pneumoniae CGMCC1.6366 lawn, 37 DEG C of aerobic cultivations of shaking table, rotating speed is 180 rpms, cultivates 12 hours.
4) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 3L fermention medium, ventilation 1L per minute, mixing speed 250 rpms, temperature 37 DEG C, utilizes sodium hydroxide solution to control fermenting process pH6.0, when glucose concn is reduced to 10g/L, stream adds glucose, controls glycerol concentration in 3-40g/L scope, fermentation culture 48 hours.
Detect fermented liquid component according to the GC conditions in embodiment 1, result is: 2R, 3R-butyleneglycol 0.3g/L, meso-2,3-butanediol 41.1g/L, 2S, 3S-butyleneglycol 2.2g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 0.7%.
Embodiment 6
The fermentation that butanediol dehydrogenase mutant strain utilizes glucose to be carbon source.
1) seed culture medium and fermention medium is prepared
Seed culture medium and fermention medium is prepared according to embodiment 5.
2) seed culture
In the Erlenmeyer flask that seed culture medium is housed, access Klebsiella pneumoniae CGMCC1.6366-budC-lawn prepared by embodiment 2,37 DEG C of aerobic cultivations of shaking table, rotating speed is 180 rpms, cultivates 12 hours.
3) fermentation culture
By one bottle, cultured seed, access is equipped with in the 5L fermentor tank of 3L fermention medium, ventilation 1L per minute, mixing speed 250 rpms, temperature 37 DEG C, utilizes sodium hydroxide solution to control fermenting process pH6.0, when glucose concn is reduced to 10g/L, stream adds glucose, controls glycerol concentration in 3-40g/L scope, fermentation culture 48 hours.
Detect fermented liquid component according to the GC conditions in embodiment 1, result is: 2R, 3R-butyleneglycol 0.8g/L, meso-2,3-butanediol 3.9g/L, 2S, 3S-butyleneglycol 0.2g/L.The ratio of 2R, 3R-butyleneglycol shared by total butyleneglycol is 16%.
<110> Shanghai Advanced Research Institute, Chinese Academy of Sciences
<120> Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol
<160>8
<170>PatentInversion3.3
<210>1
<211>26
<212>DNA
<213> artificial sequence
<400>1
gccatccaggaagagaaaaaatatca26
<210>2
<211>25
<212>DNA
<213> artificial sequence
<400>2
agacgtttgtacgcctgggtagaag25
<210>3
<211>263
<212>DNA
<213> Klebsiella pneumoniae
<400>3
gccatccaggaagagaaaaaatatcagcgcctgtccggcgtcgagttcgggccgatggat60
tttaaagcctatgccgagtccttcggcgccaaagggtttgccgtggaaagcgctgaggcg120
ctggagccgaccctgcgcgcggcgatggacgtcgacggcccggcggtagtggccatcccg180
gtggattatcgcgataacccgctgctgatgggtcagctgcatctgagtcagattctgtaa240
gtcatcacaataaggaaaggaaa263
<210>4
<211>771
<212>DNA
<213> Klebsiella pneumoniae
<400>4
atgaaaaaagtcgcacttgttaccggcgccggccaggggattggtaaagctatcgccctt60
cgtctggtgaaggatggatttgccgtggccattgccgattataacgacgccaccgccaaa120
gcggtcgcctccgaaatcaaccaggccggcggccgcgccatggcggtgaaagtggatgtc180
tccgaccgcgatcaggtgtttgccgccgtcgaacaggcgcgcaaaacgctgggcggcttc240
gacgtcatcgtcaacaacgccggcgtggcgccgtccacgccgatcgagtccattaccccg300
gagattgtcgataaagtttacaatatcaacgttaaaggggtgatctggggcattcaggcg360
gcggtcgaggcctttaagaaagaggggcacggcgggaaaatcattaacgcctgttcccag420
gccggccacgtcggcaacccggagctggcggtgtatagctccagtaaattcgccgtacgc480
ggcttaacccagaccgccgctcgcgacctcgcgccgctgggcatcacggtcaacggctac540
tgcccggggatcgtcaaaacgccgatgtgggccgaaattgaccgccaggtgtccgaagct600
gccggtaaaccgctgggttacggtaccgccgagttcgccaaacgcatcacccttggtcgt660
ctgtccgaaccggaagatgtcgccgcctgcgtctcctatcttgccagcccggattctgat720
tacatgaccggtcagtcattgctgatcgacggcgggatggtatttaactaa771
<210>5
<211>357
<212>DNA
<213> Klebsiella pneumoniae
<400>5
taaataataagctctgacatggcttgcccctgctgatatgcaggggctttttttggtttg60
ggtgtgagcatcgtgcaaaacgcagcaacgatatttgaaggtctctggcacgacgtgggc120
aatctgactgggttgaaggcctgctttgagcgaggagcatgtatttttcttcaccctcta180
cttcgtccattctttatgcagtaacgcatagatgtatgtgtcgtcataccttgccttacc240
atcgtcgttttcaaaggagacaaactctttaaaacaaccttcctgtcgcatatgcaaacg300
ttcacagagtttttgagaggccaggttgtaaacttctacccaggcgtacaaacgtct357
<210>6
<211>59
<212>DNA
<213> artificial sequence
<400>6
agataggagacgcaggcggcgacatcttccggttcggacattccggggatccgtcgacc59
<210>7
<211>59
<212>DNA
<213> artificial sequence
<400>7
caggcgcgcaaaacgctgggcggcttcgacgtcatcgtcatgtaggctggagctgcttc59
<210>8
<211>25
<212>DNA
<213> artificial sequence
<400>8
agaatctcgctctctccaggggaag
Claims (7)
1. a Klebsiella pneumoniae produces 2R, the method of 3R-butyleneglycol, is characterized in that: described method is under oxygen restricted condition, take glycerine as carbon source, utilize the Klebsiella pneumoniae fermentative production 2R of butanediol dehydrogenase gene budC inactivation, 3R-butyleneglycol.
2. Klebsiella pneumoniae as claimed in claim 1 produces the method for 2R, 3R-butyleneglycol, it is characterized in that: the step that described Klebsiella pneumoniae produces 2R, 3R-butyleneglycol comprises:
(1) the Klebsiella pneumoniae mutant strain of butanediol dehydrogenase gene budC inactivation is built;
(2) by glycerine, nitrogenous source, phosphorus source, metal ion and trace element and water, substratum is mixed with;
(3) in the substratum of abovementioned steps preparation, the Klebsiella pneumoniae mutant strain of access butanediol dehydrogenase gene budC inactivation, carries out fermentation culture under oxygen restricted condition.
3. Klebsiella pneumoniae as claimed in claim 2 produces the method for 2R, 3R-butyleneglycol, it is characterized in that: in described step (2), described nitrogenous source is selected from: organic nitrogen source and inorganic nitrogen-sourced; Described phosphorus source is selected from: phosphoric acid and phosphoric acid salt; Described metal ion comprises: potassium, magnesium, iron and manganese; Described trace element comprises: zinc, calcium, molybdenum, cobalt, copper, nickel and boron.
4. Klebsiella pneumoniae as claimed in claim 3 produces the method for 2R, 3R-butyleneglycol, it is characterized in that: described organic nitrogen source is selected from: corn steep liquor, yeast powder, peptone and soybean cake powder; Describedly inorganic nitrogen-sourcedly to be selected from: ammonium salt, nitric acid and its esters, nitrous acid and its esters and urea.
5. Klebsiella pneumoniae as claimed in claim 2 produces 2R, the method of 3R-butyleneglycol, it is characterized in that: the oxygen restricted condition in described step (3) is: oxygen-supplying amount is less than thalline maximal aerobic power, wherein thalli growth logarithmic phase and stationary phase Dissolved Oxygen concentration Control below 5%.
6. Klebsiella pneumoniae as claimed in claim 2 produces the method for 2R, 3R-butyleneglycol, and it is characterized in that: in described step (3), the temperature of fermentation culture is 28 ~ 42 DEG C, and cultivation pH is 5.5-7.5, and the time of fermentation culture is 10 ~ 70 hours.
7. Klebsiella pneumoniae as claimed in claim 1 produces the method for 2R, 3R-butyleneglycol, it is characterized in that: described Klebsiella pneumoniae is Klebsiella pneumoniae CGMCC1.6366.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410046736.2A CN103740771B (en) | 2014-02-10 | 2014-02-10 | Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410046736.2A CN103740771B (en) | 2014-02-10 | 2014-02-10 | Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740771A CN103740771A (en) | 2014-04-23 |
| CN103740771B true CN103740771B (en) | 2016-01-20 |
Family
ID=50497836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410046736.2A Active CN103740771B (en) | 2014-02-10 | 2014-02-10 | Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740771B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101577502B1 (en) * | 2013-12-16 | 2015-12-14 | 지에스칼텍스 주식회사 | Recombinant microorganism having enhanced d(-) 2,3-butanediol producing ability and method for producing d(-) 2,3-butanediol using the same |
| CN104630100A (en) * | 2015-01-23 | 2015-05-20 | 中国科学院上海高等研究院 | Reconstructed Klebsiella pneumoniae and application of reconstructed Klebsiella pneumoniae in production of R-acetoin |
| CN106929438A (en) * | 2016-11-18 | 2017-07-07 | 天津科技大学 | One plant height produces the saccharomyces cerevisiae and its construction method of Tetramethylpyrazine |
| JP7324478B2 (en) * | 2021-01-06 | 2023-08-10 | 蘇州蘇震生物工程有限公司 | Method for preparing meso-2,3-butanediol |
| CN112321391B (en) * | 2021-01-06 | 2021-04-06 | 苏州苏震生物工程有限公司 | Preparation method of meso-2, 3-butanediol |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103451141A (en) * | 2013-08-09 | 2013-12-18 | 天津大学 | Bacillus subtilis strain for producing high-purity chiral meso-2,3-butanediol as well as construction method and application of strain |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2783007B9 (en) * | 2011-11-21 | 2018-03-28 | Metabolic Explorer | Microorganism strains for the production of 2,3-butanediol |
-
2014
- 2014-02-10 CN CN201410046736.2A patent/CN103740771B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103451141A (en) * | 2013-08-09 | 2013-12-18 | 天津大学 | Bacillus subtilis strain for producing high-purity chiral meso-2,3-butanediol as well as construction method and application of strain |
Non-Patent Citations (3)
| Title |
|---|
| budC knockout in Klebsiella pneumoniae for bioconversion from glycerol to 1,3-propanediol;Guo Xinkun et al;《Biotechnology and Applied Biochemistry》;20131218;557-563 * |
| Deletion of meso-2,3-butanediol dehydrogenase gene budC for enhanced D-2,3-butanediol production in Bacillus licheniformis;Qi Gaofu et al;《Biotechnology for Biofuels》;20140129;第7卷;16 * |
| 产酸克氏杆菌1, 3－丙二醇发酵液中2, 3－丁二醇的定性和定量分析;杨光等;《分析化学》;20070731;第35卷(第7期);1039-1042 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740771A (en) | 2014-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5618995B2 (en) | Production of butanediol by anaerobic microbial fermentation. | |
| CN102329765B (en) | XZ-A26 bacterial strain for producing L-alanine with high yield as well as construction method and application of XZ-A26 bacterial strain | |
| CN103740771B (en) | Klebsiella pneumoniae produces the method for 2R, 3R-butyleneglycol | |
| Xu et al. | Metabolic engineering of Escherichia coli for efficient production of (3 R)‐acetoin | |
| Wechgama et al. | Enhancement of batch butanol production from sugarcane molasses using nitrogen supplementation integrated with gas stripping for product recovery | |
| US10570424B2 (en) | Recombinant methanotrophic bacterium and a method of production of succinic acid from methane or biogas thereof | |
| JP6942697B2 (en) | Clostridium beigelinky and its use, and method for producing butanol | |
| CN110358720B (en) | Zymomonas mobilis recombinant strain for producing isobutanol, construction method and application thereof | |
| Yang et al. | Industrial production of 2, 3-butanediol from the engineered Corynebacterium glutamicum | |
| US9701987B2 (en) | Fermentation process for the production and control of pyruvate-derived products | |
| CN105051181B (en) | The preparation method of the increased recombinant microorganism of the generative capacity of 2,3-butanediol and the 2,3-butanediol using it | |
| Hniman et al. | Community analysis of thermophilic hydrogen-producing consortia enriched from Thailand hot spring with mixed xylose and glucose | |
| CN102952826B (en) | Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin | |
| CN107354118A (en) | A kind of genetic engineering bacterium and its construction method and application with γ terpinene synthesis capabilities | |
| CN102864116B (en) | Gene engineering bacterium for producing succinic acid and construction and application thereof | |
| CN103388009B (en) | Method for producing R-acetoin from klebsiella pneumoniae | |
| CN107075462A (en) | The generative capacity of 2,3 butanediols obtains enhanced recombinant microorganism and the production method using its 2,3 butanediols | |
| US10287558B2 (en) | Microorganisms for succinic acid production | |
| CN103184243A (en) | Fermentation production method for xylitol | |
| CN104204206B (en) | A kind of method for producing butanol | |
| Chu et al. | Metabolic regulation and optimization of oxygen supply enhance the 2, 3‐butanediol yield of the novel Klebsiella sp. isolate FSoil 024 | |
| WO2014013330A2 (en) | Method for producing 2,3-butanediol using improved strains of raoultella planticola | |
| CN106967662A (en) | A kind of recombinant bacterium of fixed carbon dioxide synthesizing succinic acid and its construction method and application | |
| CN115261292B (en) | Engineered klebsiella bacteria, and use and method for producing 1, 2-propanediol | |
| CN111304138B (en) | Recombinant escherichia coli for producing beta-carotene and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |