CN103740742B - A kind of method of regulating plant pollen fertility and application thereof - Google Patents

Abstract

Invention belongs to plant genetic engineering and field of plant variety breeding technology, be specifically related to a kind of by Barnase being divided into N and holding and C holding two fragments, utilize two expression to have its expression in plant of overlapping pollen-specific promoters driven period respectively, thus strengthen tissue specificity that Barnase expresses, overcome the method for toxicity leakage problem when utilizing Barnase gene to create male sterility line of plants.

Description

A kind of method of regulating plant pollen fertility and application thereof

Technical field

The invention belongs to plant genetic engineering and field of plant variety breeding technology, be specifically related to a kind of by Barnase being divided into N and holding and C holding two fragments, utilize two expression to have its expression in plant of overlapping pollen-specific promoters driven period respectively, thus strengthen tissue specificity that Barnase expresses, overcome the method for toxicity leakage problem when utilizing Barnase gene to create male sterility line of plants.

Background technology

Hybrid vigour is a kind of universal phenomenon of organic sphere, utilizes hybrid vigour can significantly improve crop yield, quality and resistance.Cross-breeding has become the main path of many crop seed selection new variety, and the seed selection of crop male sterile line is the key link in heterosis utilization.There is cycle length owing to utilizing conventional breeding methods seed selection sterile line, take effect slow, can not meet production development to problems such as such environmental effects sensitivities needs, in recent years, utilize genetically engineered to create male sterile line by the breeding methods as most prospect, become the focus of research, development and utilization within the scope of the world today.

Utilizing plant genetic engineering to create male sterile strategy at present mainly utilizes the specific promoter of pollen development to drive the expression of foreign gene in plant to block pollen development process thus to reach male sterile object, drives Barnase gene specifically expressing in plant to obtain genetically engineered line with genic sterile or utilize Antisense RNA Technique special closedown Devflopment Ofmle Gametophyte key gene to obtain genetically engineered line with genic sterile etc. as utilized tapetum specific promoter.

Barnase is a kind of extracellular RNA enzyme that bacillus amyloliquefaciens (Bacillusamyloliquefaciens) produces, its product is expressed with precursor forms, in processing, transportation, N holds cut about 20 amino acid, becomes maturing enzyme, has 110 amino acid.Barnase has strong toxicity, and its trace expression in specific cells just can cause the death of this cell.Nineteen ninety, Mariani etc. will have the tobacco anther tapetum specific promoter TA29 of special spatial and temporal expression characteristic, be combined with the Barnase gene of bacillus amyloliquefaciens, form mosaic gene, with agrobacterium tumefaciens-mediated transformation, above-mentioned mosaic gene is imported tobacco and rape, obtain transgenic plant (MarianiC etc., Inductionofmalesterilityinplantsbyachimaericribonuclease gene, Nature, 1990,347:737-741).As a result, have the shrinkage of a large portion transfer-gen plant flower pesticide, non-loose powder, selfing can not be solid, but gynoecium is normal, can pollinate solid by other plant; Tissue slice does not find tapetum, and pollen sac is out of shape, without sporule and pollen granule.Therefore, they think, the specifically expressing of TA29-Barnase mosaic gene in rape, tobacco, the tapetum of selective destruction flower, thus prevent the formation of pollen, cause male sterile.

Over 20 years, Barnase is imported into the research that the various crops such as rape, tobacco, cotton, wheat, corn, paddy rice have carried out male sterile induction.Create in the process of male sterility line of plants utilizing Barnase and have also discovered a series of problem, as the toxicity leakage problem etc. that there are the strong promoters such as CaMV35S the temperature sensitive sex chromosome mosaicism of Barnase albumen, the inadequate or upstream of the specificity of pollen-specific promotor that drives it to express and cause.

For this problem, the present invention proposes a kind of construction strategy of new male sterile carrier, in this strategy, Barnase is divided into N end and C hold two fragments, and the expression of sub-Barnase-N and Barnase-C of Barnase two near points is started respectively by two different pollen-specific promotors, owing to not having the activity of RNA enzyme when half molecule Barnase-N and Barnase-C Individual existence, therefore only all have in the pollen cell of expression activity two promotors and just there is Barnase-N and Barnase-C two near points simultaneously, and this two near points can become have the complex body of RNA enzymic activity by self assembly, exercise the function of RNA enzyme, thus reach the male sterile object of plant.The constitutive promoter (as CaMV35S promotor) of the useful strongly expressed of Yi Fang Mian No of the present invention, avoid strong promoter to the specific impact of Barnase genetic expression, better overcome the toxicity leakage problem of Barnase gene, more effectively achieve the application of Barnase gene in creating plants male sterility system.

Summary of the invention

The object of this invention is to provide a kind of method of establishment male sterility line of plants newly, be to provide a kind of method of formulating male sterile line in dicotyledons more specifically, described method comprises the promotor chosen two pollen-specifics and express, more particularly choose the promotor of two specifically expressings in the pollen of dicotyledons, Barnase gene is divided into N end and C end, drives expression respectively by two promotors.The construct obtained by aforesaid method is after proceeding to plant, the transfer-gen plant of acquisition can be made to realize male sterile, and effectively can avoid Barnase toxicity leakage problem, can also avoid proceeding to the gene silencing problem that two identical promotors cause simultaneously.

Barnase gene protein involved in the present invention, it is a kind of extracellular RNA enzyme that bacillus amyloliquefaciens (Bacillusamyloliquefaciens) produces, there is very strong cytotoxicity, its specific expressed meeting in cell causes the death of cell, is thus widely used in the fields such as the establishment of male sterility line of plants.

In the present invention, reveal too greatly and easily to solve Barnase genotoxicity, the easy problem affecting plant and grow normally, Barnase albumen be divide into N end (1-36 amino acids) and C and holds (37-110 amino acids) two little peptides by the present invention, N end comprises 2 α spirals, and C end comprises 5 β lamellas.Because two little peptides all comprise RNA enzymic activity essential amino acid, (N holds Lys27, C holds Glu73 and His102), so any one section of little peptide does not all have RNA enzymic activity, but both are transferred to a cell at the same time, and after giving expression to albumen simultaneously, can be reassembled into the complex body with RNA enzymic activity, the RNA enzymic activity of this protein complexes re-assemblied can reach about 30% of native protein, can cause the death of expressed cell.

In order to make the Barnase gene of bacterial origin better in plant, especially express in dicotyledons, the present invention also transforms according to the higher structure of Barnase, the Preference of bacillus amyloliquefaciens codon, the nucleotide sequence of Preference to Barnase of dicotyledons codon, simultaneously also to determining that 6 important amino acids of Barnase temperature sensitivity have carried out point mutation (Q16I, T17R, K20R, G65S, K66A and K108R).Transform and the nucleotide sequence finishing point mutation as shown in SEQ ID NO:1, wild-type sequence is as shown in SEQIDNO:2.

Compared with the Barnase of wild-type, Barnase sequence after sudden change provided by the present invention has in dicotyledons can the advantage of more effective expression and temperature sensitivity low (namely more withstand high temperatures), and these advantages are very important for utilizing its ribonuclease activity to regulate and control pollen fertility and set up male sterile line in dicotyledons.

In another aspect of this invention, under the N of the Barnase that encodes respectively holds by contriver and C holds two of little peptide nucleotide sequences to be placed in the driving of two different pollen-specific expression promotors, these two pollen-specifics are expressed promotor and are all expressed in the later stage of pollen development, N end and the C that can realize Barnase hold the efficient expression of the same space-time of two little peptides, thus both reached the object that the present invention formulates male sterile line, the impact that plant normal growth is grown that can overcome again that constitutive expression Barnase gene causes and the waste of energy, the toxicity leakage problem of the Barnase gene that the Weak activity of some pollen-specific promotors in other histoorgans can also be avoided to cause.By the expression vector conversion of plant containing above-mentioned expression cassette, can realize in the transgenic plant of acquisition 50% pollen debility or vigor weak, thus reach the object of targeted regulating plant pollen fertility.

The present invention realizes successively through the following steps:

(1) transform according to the higher structure of Barnase, the Preference of bacillus amyloliquefaciens codon, the nucleotide sequence of Preference to Barnase of dicotyledons codon, simultaneously also to determining that the important amino acid of Barnase temperature sensitivity has carried out point mutation (Q16I, T17R, K20R, G65S, K66A and K108R).Transform and the nucleotide sequence finishing point mutation as shown in SEQ ID NO:1, this sequence handed over precious biotechnology (Dalian) company limited to synthesize;

(2) increased respectively by PCR method and to obtain encoding the nucleotide fragments of BarnaseN end (1-36 amino acids) and C end (37-110 amino acids), connection carrier T confirmation of checking order;

(3) to be increased respectively the promotor PAt03g04360 and PAt2g38500 that obtain two pollen development specifically expressings in late period by PCR method, connect carrier T and confirmation of checking order;

(4) plant expression vector is built: under the nucleotide fragments of BarnaseN end (1-36 amino acids) and C end (37-110 amino acids) that encodes is placed in the promotor PAt03g04360 of two pollen development specifically expressings in late period and the driving of PAt2g38500 respectively;

(5) conversion of plant, particularly, preferred arabidopsis thaliana transformation and rape;

(6) T0 of acquisition is carried out the analysis of Alexander solution-dyed for the pollen of transgenic arabidopsis.Dying navy blue is fertile pollen, and azury is abortive pollen.Result shows to have the weak or debility of 50% Pollen Activity, thus reaches the object of targeted regulating plant pollen fertility.

" promotor " of the present invention is one section of DNA sequence dna being positioned at that structure gene 5' holds upstream, can activate RNA polymerase, make it combine exactly with template DNA and have the specificity of transcription initiation.

" nucleotide sequence " of the present invention is putting in order of nucleic acid (DNA and RNA) nucleotide.In many situations, nucleotide sequence determines higher structure and the biological function of nucleic acid, and namely different sequence has different higher structures and different biological functions.

" pollen development specific expression promoter in late period " of the present invention refers to that this promotor can drive goal gene specifically expressing and the promotor do not expressed at other organ of plant in the pollen granule in Plant Pollen Development late period.

" plant expression vector " of the present invention refer to well known in the prior art, can in vegetable cell any one carrier of constant expression alien gene, as pCAMBIA1300, pBI121 etc.

" conversion " of the present invention refer to well known in the prior art, can by any one methods for plant transformation of exogenous gene transfered plant cell or plant tissue, as agrobacterium-mediated transformation and particle gun etc.

" transgenic plant " of the present invention refer to the plant individual being integrated with foreign gene obtained by gene transfer technique.In usual conversion of plant or transgenic plant genome, the stable nucleotide sequence with foreign gene, stably can entail the next generation by this exogenous nucleotide sequence.

The present invention is compared with the existing technology utilizing Barnase to create male sterile line, it is advantageous that and only have in the cell of expression activity two pollen-specific promotors simultaneously, the BarnaseN end of non-activity and C hold little peptide can exist simultaneously and be assembled into activated complex body, thus effectively prevent pollen-specific promotor specificity inadequate time other histoorgan heteroplasia of male sterile plants, the affected problem of Main Agronomic Characters that cause, to the establishment of plant genetic engineering male sterile line and heterotic utilization all significant.

Accompanying drawing explanation

Fig. 1 is the T-DNA district collection of illustrative plates of expression vector pBnSK.LB and RB is respectively left margin and the right margin of T-DNA; NapinP represents the promotor of rape Napin gene; RFP is from the RFP gene coding region of reef coral; PAt03g04360 represents the promotor of Arabidopis thaliana At03g04360 gene; BarW-C represents the C terminal nucleotide fragment of improved Barnase gene; Trbcs represents the terminator of Arabidopis thaliana rbcs gene; PAt2g38500 represents the promotor of Arabidopis thaliana At2g38500 gene; BarW-N represents the N terminal nucleotide fragment of improved Barnase gene; Tnos represents the terminator of rouge alkali synthetase (no) gene; Pvu II, PstI, Bgl II, BamHI, SmaI, KpnI, SacI, EcoRI and BstPI represent the restriction enzyme site of restriction enzyme respectively.

Fig. 2 is the form of pBnSK transgenic arabidopsis and non-transgenic reference plant.

Fig. 3 is that the pollen staining of pBnSK transgenic arabidopsis is observed.

Fig. 4 is the Fluirescence observation of pBnSK transgenic arabidopsis seed.A is not genetically modified Arabidopis thaliana seed; B is the seed of transgenic arabidopsis (No. 7).

Embodiment

In following embodiment, method therefor is ordinary method if no special instructions, the primer synthesizes by Shanghai Ying Jun biotech company, order-checking is won polygala root biotechnology limited liability company by Beijing three and is completed, endonuclease in PCR kit, vector construction process is purchased from precious biotechnology company limited, pMD18-T connection test kit and T4 are purchased from precious biotechnology (Dalian) company limited, and the method that the equal reference reagent box of method provides is carried out.Carrier p1300 used in experiment is obtained by this laboratory house of correction, and basic framework comes from the pCAMBIA1300 of CAMBIA company.

Embodiment 1. synthesizes BarnaseW nucleotide fragments

Transform according to the higher structure of Barnase, the Preference of bacillus amyloliquefaciens codon, the nucleotide sequence of Preference to Barnase of dicotyledons codon, simultaneously also to determining that the important amino acid of Barnase temperature sensitivity has carried out point mutation (Q16I, T17R, K20R, G65S, K66A and K108R).Transform and the nucleotide sequence finishing point mutation as SEQIDNO:1, called after BarnaseW, is synthesized this sequence by precious biotechnology (Dalian) company limited and obtains.

The structure of embodiment 2. plant expression vector pBnSK

Be designed for the Auele Specific Primer of amplification Pat2g38500:

Primer 1:5 '-gCCCTCgAgACgATTTgTCCTggTTCAgTgCA-3 ' (SEQIDNO:9)

Primer 2: 5 '-CCgagatctCATTggAgAgAgCg-3 ' (SEQIDNO:10)

With the genomic dna of Arabidopis thaliana for template, with above-mentioned primer amplification pAt2g38500, PCR primer detects through 1% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, result shows: institute's extension increasing sequence is the PAt2g38500 promoter sequence of expection, as shown in SEQ ID NO:3.

Be designed for the Auele Specific Primer of amplification BarW-N:

Primer 3:5 '-CCGagatctATGGCTCAAGTG-3 ' (SEQIDNO:11)

Primer 4:5 '-gatggtgaccttaCCATCCAAGAGCCTGAGCC-3 ' (SEQIDNO:12)

With the BarnaseW gene of synthetic for template, with above-mentioned primer amplification BarW-N, PCR primer detects through 2.5% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, result shows: institute's extension increasing sequence is the BarW-N sequence of expection, as shown in SEQ ID NO:4.

Be designed for the Auele Specific Primer of amplification Tnos:

Primer 5:5 '-tctggtgaccgCGTTCAAACATTTGGC-3 ' (SEQIDNO:13)

Primer 6:5 '-CAcggtaccCCCgATCTAgTAAC-3 ' (SEQIDNO:14)

With plasmid pBnSI for template, with above-mentioned primer amplification Tnos, PCR primer detects through 2.5% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, and result shows: institute's extension increasing sequence is the Tnos sequence of expection, as shown in SEQ ID NO:5.

Be designed for the Auele Specific Primer of amplification PAt3g04360:

Primer 7:5 '-AATggtaccTgAgACCgTgTTCCggggT-3 ' (SEQIDNO:15)

Primer 8:5 '-CCgAgctcATCATATTTTTTTTgTgTgg-3 ' (SEQIDNO:16)

With the genomic dna of Arabidopis thaliana for template, with above-mentioned primer amplification PAt3g04360, PCR primer detects through 1% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, result shows: institute's extension increasing sequence is the PAt3g04360 promoter sequence of expection, as shown in SEQ ID NO:6.

Be designed for the Auele Specific Primer of amplification BarW-C:

Primer 9:5 '-tggagctcgactcgagatggttgcttctaagggaaacctc-3 ' (SEQIDNO:17)

Primer 10:5 '-gatccatggttaCCATCCAAGAGCCTGAGCC-3 ' (SEQIDNO:18)

With the BarnaseW gene of synthetic for template, with above-mentioned primer amplification BarW-C, PCR primer detects through 2.5% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, result shows: institute's extension increasing sequence is the BarW-C sequence of expection, as SEQ ID NO:7 shows.

Be designed for the Auele Specific Primer of amplification Trbcs:

Primer 11:5 '-CCgCCATggAgCTTTCgTTCgTATCATCg-3 ' (SEQIDNO:19)

Primer 12:5 '-AgTcagctggATTgATgCATgTTgTCA-3 ' (SEQIDNO:20)

With plasmid pBnSI for template, with above-mentioned primer amplification Trbcs, PCR primer detects through 2.5% agarose gel electrophoresis and reclaims, product is connected into pMD18-T, screening positive clone also carries out sequence verification, result shows: institute's extension increasing sequence is the Trbcs sequence of expection, as shown in SEQ ID NO:8.

In primer 1, sequence ctcaga is the restriction enzyme site of Xho I, in primer 2 and 3, sequence agatct is the restriction enzyme site of Bgl II, in primer 4 and 5, sequence ggtgacc is the restriction enzyme site of Bstp I, in primer 6 and 7, sequence ggtacc is the restriction enzyme site of KpnI, in primer 8 and 9, sequence gagctc is the restriction enzyme site of SacI, in primer 10 and 11, sequence ccatgg is the restriction enzyme site of NcoI, and in primer 12, sequence cagctg is the restriction enzyme site of Pvu II.

Above-mentioned sequence verification is connected with respectively the pMD18-T carrier of PAt38500, BarW-N, Tnos, PAt3g04360, BarW-C and Trbcs fragment, respectively according to primer both sides with restriction enzyme site carry out double digestion, obtain that sequence is correct, two ends be with the above-mentioned fragment of corresponding restriction enzyme site.In pCAMBIA1300 carrier, be connected into above-mentioned fragment successively, finally obtain plant expression vector pBnSK, as shown in Figure 1.

The genetic transformation of the Arabidopis thaliana that embodiment 3. is agriculture bacillus mediated

Utilize electrization that plant expression vector pBnSK is proceeded to Agrobacterium EHA105 bacterial strain.

Dip in colored method with Agrobacterium and infect Arabidopis thaliana, in the dark Dual culture 2-3 days, be then normally cultured to results seed.Under fluorescent microscope, select fluorescently-labeled seed redly, and carry out Molecular Detection to obtain the Arabidopsis plant turning pBnSK.

Embodiment 4: the pollen fertility of transgenic Arabidopsis plants detects

Carry out analysis to the transgenic Arabidopsis plants material obtained by method described in embodiment 3 to find, obvious morphological differences (Fig. 2) is not had between transfer-gen plant and Wild type control plants, but the pollen fertility of transfer-gen plant is obviously different compared with wild-type, this shows that the pBnSK transfer-gen plant obtained by the method for the invention is except pollen fertility phenotypic alternation, does not cause the phenotypic variation of any other histoorgan.

Pollen is carried out to the Arabidopsis plant of the above-mentioned pBnSK of turning and can contaminate rate detection, in contrast with the pollen of wildtype Arabidopsis thaliana simultaneously.

The method adopted is: in Arabidopis thaliana flowering period, respectively individual plant is randomly drawed from transgenic Arabidopsis plants and Wild type control plants thereof, a flower is got in each strain, every flower gets 1 flower pesticide, be placed in slide glass central authorities, drip Alexander solution (the 95% ethanol 10mL of one 1%, 1% malachite green 5mL, 5g phenol, the C.I. 42685 5mL of 1%, the Exocarpium Citri Rubrum G0.5mL of 1%, Glacial acetic acid 2mL, glycerol 25mL, distilled water 50mL), after tweezers and dissecting needle release pollen, covered, examine under a microscope, counting can stained pollen number and pollen frequency, dying navy blue is fertile pollen, azury for abortive pollen (Fig. 3 show dyeing after fertile flower powder and can not pollen granule be educated).

The pollen analyzing transgenic Arabidopsis plants can contaminate rate, and the mazarine pollen of result display contrast WT lines accounts for 98.6% ~ 100%; And in multiple transfer-gen plant randomly drawed, No. 5, No. 7, No. 14 and No. 26 normal fertile pollens of plant (mazarine) and abortive pollen (light blue) ratio closely 1:1, show that the transfer-gen plant of constructed carrier can produce the pollen carrying foreign cell virulent gene of equivalent and not carry the pollen of foreign cell virulent gene, i.e. 50% inactivation of construct pBnSK render transgenic strain pollen.The pollen of one of them strain can contaminate rate experimental result as shown in Figure 3, this result shows that carrier provided by the present invention expresses the pollen deactivation function that can reach expection in Arabidopis thaliana as a whole, and do not cause the phenotypic variation of other histoorgans of transfer-gen plant, prove that barnase gene has played the function of expection in pollen as cytotoxic gene.

Embodiment 5: fluorescent seeds and the non-fluorescence seed segregation ratio of transgenic Arabidopsis plants are analyzed

By after transforming transgenic Arabidopsis plants results seed that pBnSK carrier obtains to it tie the segregation ratio that T1 carries out fluorescence and non-fluorescence seed for seed and investigate, result shows that the seed of No. 5, No. 7, No. 14 and No. 26 strains all demonstrates the segregation ratio of 1:1, the red fluorescence segregation ratio analytical results of one of them strain seed as shown in Figure 4, illustrates that construct pBnSK provided by the present invention can realize the function of pollen fertility.

SEQUENCELISTING

<110> Shenzhen Crop Molecular Design Breeding Institute

Shenzhen Xingwang Biological Seed Industry Co., Ltd.

Unnamed Xingwang System Crop Design Front Laboratory (Beijing) Co., Ltd.

The method of a <120> regulating plant pollen fertility and application thereof

<130>

<160>20

<170>PatentInversion3.3

<210>1

<211>336

<212>DNA

<213> synthetic

<400>1

atggctcaagtgattaacactttcgatggagtggctgattacctcatcagataccacaga60

ctcccagacaactacatcactaagtctgaggctcaggctcttggatgggttgcttctaag120

ggaaacctcgctgatgttgctcctggaaagtctattggaggtgatatcttctctaacaga180

gagggaaagctcccttctgcttctggtagaacttggagagaggctgacatcaactacacc240

tctggattcaggaactctgatagaatcctctactcttctgattggcttatctacaagact300

actgatcactaccagactttcactagaatcagatga336

<210>2

<211>336

<212>DNA

<213> bacillus amyloliquefaciens (Bacillusamyloliquefaciens)

<400>2

atggctcaagtgattaacactttcgatggagtggctgattacctccaaacttaccacaag60

ctcccagacaactacatcactaagtctgaggctcaggctcttggatgggttgcttctaag120

ggaaacctcgctgatgttgctcctggaaagtctattggaggtgatatcttctctaacaga180

gagggaaagctccctggaaagtctggtagaacttggagagaggctgacatcaactacacc240

tctggattcaggaactctgatagaatcctctactcttctgattggcttatctacaagact300

actgatcactaccagactttcactaagatcagatga336

<210>3

<211>2093

<212>DNA

<213> Arabidopis thaliana (Arabidopsisthaliana)

<400>3

ggacgatttgtcctggttcagtgcatataaaaatgagaagacgatgtggaatacatcgta60

aatctcatgatggtcgcactataatttttgttgcagctgatgtacttgaagactcaaaac120

ggtaatggatcaagataatgtccttcatgaatgtagcaatgagatgttatatgggggctc180

tctacattaatgtgtgttattctgttatatatttagatacaatttttcaggcccttttct240

ttaaaaaaactcaaaccatatacatccaatttttttaagatgttgccagaaagttgatta300

aactgtccactgaaatgacataaaattacatcagtaaaacgatttgtactaatgttgatg360

taatgttttttaaaaattacgttatgaaatgagtttttatattctttgttacatttatga420

ttccttctcccaatattttttatatattccgaatcattttggttaacataagaataaaca480

tcatgattatcatacattgttgaaaggaaaaaaccataaaataaataatggtgattaaga540

gcttctagttgcatgcaatacacaagttaactataaatttattggataatgtagaaattg600

tgtaaaaaacaaaaccaatgatggtgtcatcttaaaggcaatttagttgcaattctctta660

agataagtaaatttcttcgataaagtgaacattttcgaaatacaaaatcattaggggaga720

tgcggattgtcttcccagaagcatgcacaagatttcataagctatttgatacattcatta780

catattctttgatagcgacagctttgggtgtccccaaaacttgttccatgtctccctaca840

ttcattacctacataattttaatatcgtttgttagacaacaaacaacttccttttatatg900

tatttagatttaaatattattctataaatagttcttggcttcgtcttattcgttttgata960

gttaaaaatttgtcatttgtatatattgcccgaaaaaaccgatggagtaaaattttaatt1020

agtaatctaaaggggaccattgtcgaagcttactaacgtacggaagatgctatgactaac1080

caattagtgtataatcacatgcccttcaaacctcaattatatatgcacactcacaagtca1140

caaacctcacttatctttgcttttttttgtatcttaaaatgtagattacacacttgttaa1200

cttagttggtccacttatctaaatttttaaaaacaagtataaacgagacttggttggtac1260

agattattactttttaattactccacagcaaaaattggaactcggagacagccaatagct1320

attatgatatacacttgtaatacatacactaataacgacccttcaacaatcttggggttt1380

ttattaacctactttatacagtttgtttctgttagatttgatcattcatgtcaacttcgg1440

gctatttagtattctttttatatacatttcttggttagaagtagtttatggggtttaatt1500

atctttagtatcactaaaagggcagccataaaagtaagtattaaaatatttgatccaatc1560

acatgtttccacttcgtttttgtctgttacctattttcctaatatatattctataccata1620

aactcaataacctaaatataactaacaaacaaagacatttataaactaaatgtttactca1680

ataatattcaaaagctatatttgtccttgagattaattgcatttaaaaagattacacatc1740

tggaccagttcaaacattaaattgtggcccacataatggcccagcccaaagtggcaatat1800

catttctctctaagcgcgttttccatctgacataaatcatattcaaatcttccacagcgg1860

aaatgaagttagagaaccatatgatcatcatcataaattcatcattaattatatacattc1920

aaaatcagtaatggaccctcactttctctaaccaaagaattaaataaataaaacaacaac1980

gaaatgtgcttcttctaataatcgaacaagtcttgttgatttttctttcttcttggggcg2040

gatcataatttagaaccgcccgaaaccttcggatcctttcgctctctccaatg2093

<210>4

<211>108

<212>DNA

<213> synthetic

<400>4

atggctcaagtgattaacactttcgatggagtggctgattacctcatcagataccacaga60

ctcccagacaactacatcactaagtctgaggctcaggctcttggatgg108

<210>5

<211>264

<212>DNA

<213> synthetic

<400>5

gtgacccgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtctt60

gcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaa120

tgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaa180

tacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtca240

tctatgttactagatcgggggtac264

<210>6

<211>1888

<212>DNA

<213> Arabidopis thaliana (Arabidopsisthaliana)

<400>6

caacttaatttgtttatcactatccttcaatttttctcgcgagtggaaaatttatatacc60

taagaaataatatattttttgataaaagtataagaaattttactataagaccaaataagt120

aagaaattttccaaccatttttttctgtacacgattttatgattttttgtcaacaacaaa180

gatgaatacttacgagcgccaggggtatcaatacgttcgaatttgtatatcaaatgacat240

cctcgaagatgaatacgagctgacgtggcatttccacacgatctagacgaaatttcacga300

agatcaccaacacatttatggcagatctcactcggataatcttctctgcattggaaccat360

ccagagacagcgtgtttttcgttaccaactagagtcttcaagaatttagatcgagaggat420

tctgattcgagtttgcgtaagaaagaagaaagggcttgtgcacgaagaaagagattctga480

ttcgagtaatttggagattttgttgttgctttttggaggatgtttgcgtccaatggatcg540

cattgtttgaaaacaagagtgtcgtaatcaagttgagaagtgttgatgatagagggaaga600

gacagaatgattagggctagggtttgtgtgaggagagagatcaagtggacaaccatgttt660

gagtcaaaactacagggaagagagatatatttttaattcattgaatatatacattggtga720

atggagagggaagttgtggtagattagattttgtctacgtatgtctaccacttgtctaca780

tatgttaaagatttagttgtgacttaggaggtcgtcaagcgcacgtgctaagcacaccaa840

cgatttcttgatcttttcttcttgttggtatgaatatgatcctagaggttagtttaacaa900

ttttctaatgattttatgtatagtgaaacagtaatattattcacaatttgtggaactggc960

tgatccaaaatatgttaaaaatgacattcggctactagcggaggtctgattcttagccta1020

acccttattcaattcttttaatactactagtgttggtttgaagtaagagaataataatgt1080

acgtaaatgtatgtaatttgaaagtaagaaaagctttcgatgaagtcttagacagtaaca1140

aactaacaaacatatccgctcaactaaatttacctaacaaatttccatagttttcaacca1200

agatttaaattaaaaatacactggaaattctaaacaaccctaaattatgttttttttttg1260

ttgtgtgagagcgaaatagtcggaattagagtaagaccaatcaaattttaaatatttatc1320

gtaacttttatttcaagttgctttatatgatgtcttgaatctcaattgccttgccaagaa1380

aaacaagcgctgacatatataaaaagcctaaaattacagaagaaaaatacaaagagctag1440

aagaaaaagaaattcccctgttcttccgtaaatatcgttaattcgttatgacagagtttc1500

attctctttgactagatctttatttttttctttacaccgatacaagtcaaaactcttaac1560

aaacaaatatttagatcaacatagaccaaagagtcaaagaaataatgtctgtctccataa1620

agtctccaacttttataacaaattttccgttgaatatgacagtaaataaaccaacggtct1680

agttcttatcatgtctaaaaaccacaagctccttcctcatcttacgctcccctctttacc1740

tctccttttattctccttctcattctcctctcaacaactgatcgtataatcattctcacg1800

gagacgagtgaccaaaacaaggtctcccgcttcttgcgaagattaaacgaatccatttag1860

attttaaaaaccacacaaaaaaaatatg1888

<210>7

<211>231

<212>DNA

<213> synthetic

<400>7

atggttgcttctaagggaaacctcgctgatgttgctcctggaaagtctattggaggtgat60

atcttctctaacagagagggaaagctcccttctgcttctggtagaacttggagagaggct120

gacatcaactacacctctggattcaggaactctgatagaatcctctactcttctgattgg180

cttatctacaagactactgatcactaccagactttcactagaatcagatga231

<210>8

<211>654

<212>DNA

<213> synthetic

<400>8

catggacgcagctttcgttcgtatcatcggtttcgacaacgttcgtcaagttcaatgcat60

cagtttcattgcgcacacaccagaatcctactgagttcgagtattatggcattgggaaac120

atgtttttcttgtaccatttgttgtgcttgtaatttactgtgttttttattcggttttcg180

ctatcgaactgtgaaatggaaatggatggagaagagttaatgaatgatatggtccttttg240

ttcattctcaaattaatattatttgttttttctcttatttgttgtgtgttgaatttgaaa300

atataagagatatgcaaacattttgttttgagtaaaaatgtgtcaaatcgtggcctctaa360

tgaccgaagttaatatgaggagtaaaacacttgtagttgtaccattatgcttattcacta420

ggcaacaaatatattttcagacctagaaaagctgcaaatgttactgaatacaagtatgtc480

ctcttgtgttttagacatttatgaactttcctttatgtaattttccagaatccttgtcag540

attctaatcattgctttataattatagttatactcatggatttgtagttgagtatgaaaa600

tattttttaatgcattttatgacttgccaattgattgacaacatgcatcaatcg654

<210>9

<211>32

<212>DNA

<213> synthetic

<400>9

gccctcgagacgatttgtcctggttcagtgca32

<210>10

<211>23

<212>DNA

<213> synthetic

<400>10

ccgagatctcattggagagagcg23

<210>11

<211>21

<212>DNA

<213> synthetic

<400>11

ccgagatctatggctcaagtg21

<210>12

<211>32

<212>DNA

<213> synthetic

<400>12

gatggtgaccttaccatccaagagcctgagcc32

<210>13

<211>27

<212>DNA

<213> synthetic

<400>13

tctggtgaccgcgttcaaacatttggc27

<210>14

<211>23

<212>DNA

<213> synthetic

<400>14

cacggtacccccgatctagtaac23

<210>15

<211>28

<212>DNA

<213> synthetic

<400>15

aatggtacctgagaccgtgttccggggt28

<210>16

<211>28

<212>DNA

<213> synthetic

<400>16

ccgagctcatcatattttttttgtgtgg28

<210>17

<211>40

<212>DNA

<213> synthetic

<400>17

tggagctcgactcgagatggttgcttctaagggaaacctc40

<210>18

<211>31

<212>DNA

<213> synthetic

<400>18

gatccatggttaccatccaagagcctgagcc31

<210>19

<211>29

<212>DNA

<213> synthetic

<400>19

ccgccatggagctttcgttcgtatcatcg29

<210>20

<211>27

<212>DNA

<213> synthetic

<400>20

agtcagctggattgatgcatgttgtca27

Claims (8)

1. an expression cassette, it is characterized in that containing two different pollen-specific expression promotors, each promotor is held with the N of Barnase gene respectively or C holds and is connected, wherein said pollen-specific expresses the nucleotide sequence of promotor respectively as shown in SEQIDNO:3 and SEQIDNO:6, the N terminal sequence of wherein said Barnase gene is as shown in SEQIDNO:4, and C terminal sequence is as shown in SEQIDNO:7.

2. regulating plant pollen fertility a method, it comprises:

(1) expression cassette according to claim 1 is built;

(2) expression cassette step (1) obtained imports vegetable cell;

(3) regenerate transgenic plant;

It is characterized in that described transgenic plant are male sterile.

3. method according to claim 2, wherein said plant is dicotyledons.

4. method according to claim 3, wherein said dicotyledons is Arabidopis thaliana or rape.

5. a promotor for pollen specific expression, is characterized in that described pollen specific expresses the nucleotide sequence of promotor as shown in SEQIDNO:3 or SEQIDNO:6.

6. pollen specific according to claim 5 expresses the application of promotor in regulating plant pollen fertility.

7. application according to claim 6, wherein said plant comprises dicotyledons.

8. application according to claim 7, wherein said dicotyledons comprises Arabidopis thaliana or rape.