CN103740632A - Recombinant Escherichia coli and application thereof in preparation of anti-O157:H7 N-glycoprotein vaccine - Google Patents

Abstract

The invention discloses a recombinant Escherichia coli, named recombinant Escherichia coli CBEB, which is obtained by co-transforming constructed recombinant plasmid p-pglB-malEM and p-rfb into Escherichia coli CLM24, and the genotype of the recombinant Escherichia coli is W3110 deltaWaal/p-pglB-malEM+p-rfb. The recombinant Escherichia coli disclosed by the invention is fermented to prepare an anti-O157:H7 N-glycoprotein vaccine, the preparation steps are simple, the production period is short, the yield is high and the production cost is low, so that the recombinant Escherichia coli can be applied to large-scale production of the anti-O157:H7 N-glycoprotein vaccine; moreover, the anti-O157:H7 N-glycoprotein vaccine produced by the method disclosed by the invention has a good immune effect, provides a new choice for immunotherapy of antibacterial infection and has good industrial development and application prospects.

Description

One strain recombination bacillus coli and the application in the N-glucoprotein vaccine of the anti-O157:H7 of preparation thereof

Technical field

The present invention relates to the application in the enterobacteria O157:H7N-of production Chinese People's Anti-Japanese Military and Political College glucoprotein vaccine of a strain recombination bacillus coli and construction process and this recombinant bacterial strain.Belong to biotechnology, genetically engineered and microorganism fermentation field.

Background technology

Enterorrhagia Bacillus coil 0157: H7 usually causes blood sample diarrhoea, anaemia and renal failure in clinical infection, usually jeopardizes patient's life.China has isolated Escherichia coli O 157: H7, shows that also there is the potentially danger of this disease eruption and prevalence in China, should cause enough attention.China has classified enterohemorrhagic Escherichia coli as 21 century may to compatriots' hygiene and health one of 12 kinds of pathogenic micro-organisms of great effect, is only second to hiv virus (HIV), arranges second.Owing to adopting antibiotic therapy can cause the cell wall lysis of Escherichia coli O 157: H7, promote cytotoxic release, thereby increase the weight of the course of disease.At present in clinical for Escherichia coli O 157: the treatment that H7 infects be take prevention and conservative treatment as main.

Glucoprotein vaccine is considered to one of the most effective and safest anti-microbial pathogen vaccine, has broad prospect of application.Glucoprotein vaccine is by having bacterial polysaccharides on immunogenic carrier proteins as O antigen or capsular polysaccharide are connected to, this glycoprotein can cause the immunne response that depends on T cell, can give children to support bacterial-infection resisting and also can provide long-time lasting immunne response to grownup.

At present, the method for synthetic glucoprotein vaccine is mainly chemical method.By genetic engineering technique, express and cmy vector albumen, then with the pathogenic bacteria surface polysaccharide of purifying, carry out chemistry and be coupled.But due to the chemically sensitized randomness of sugar chain, the crosslinked glycoprotein producing has height unhomogeneity; Meanwhile, this method also exists the problems such as step is numerous and diverse, operational difficulty.Based on this, suddenly wait to set up and develop the new glucoprotein vaccine production method that can significantly reduce production costs.

Summary of the invention

For existing methodical deficiency, the problem to be solved in the present invention is to provide a strain recombination bacillus coli and the application in the N-glucoprotein vaccine of the anti-O157:H7 of preparation thereof.

Technical scheme of the present invention connects glycosylation pathway differ with the similar feature of e. coli lipopolysaccharide route of synthesis based on campylobacter jejuni N-, employing derives from rfb gene cluster (the O157:H7rfb gene cluster: GI:3435170) in intestinal bacteria at expression in escherichia coli, and overexpression derives from malE gene (the plasmid pMAL-p5X of source NEB company) mutant and the pglB gene (PglB NCBI-GeneID:905417) that derives from campylobacter jejuni in intestinal bacteria, the N-glycoprotein of the anti-O157:H7 of fermentative production in improvement TB substratum.

Recombination bacillus coli called after recombination bacillus coli CBEB of the present invention, is characterized in that: described recombination bacillus coli makes by the following method: build containing malE ^mco-expression carrier p-pglB-malE with pglB gene ^m, then build the expression vector p-rfb containing rfb gene cluster, then by the recombinant plasmid p-pglB-malE of above-mentioned structure ^min p-rfb cotransformation intestinal bacteria CLM24, obtain expressing pglB, malE simultaneously ^mthe recombination bacillus coli CBEB of gene and rfb gene cluster, its genotype is W3110 Δ waal/p-pglB-malE ^m+ p-rfb;

Wherein, described malE ^mderive from plasmid pMAL-p5X, described pglB gene source is in campylobacter jejuni NCTC11168, coexpression malE ^mwith the carrier of pglB gene be pBAD24; Described rfb gene cluster derives from Escherichia coli O 157: H7; The carrier of expressing rfb gene cluster is pYES1L;

Above-mentioned malE ^mfor malE gene mutation body, be by insert the gene gained of the expression glycosylation sequences of one section of nucleotide sequence as shown in SEQ ID No.1 at 3 ' end of malE gene;

Above-mentioned intestinal bacteria CLM24 is the colibacillus engineering building by knocking out the waal gene of starting strain intestinal bacteria W3110, and its genotype is W3110 Δ waal, called after intestinal bacteria CLM24.

The construction process general introduction of above-mentioned recombination bacillus coli CBEB:

Knocking out of 1.waal gene

Basic skills is by Red recombination system, in intestinal bacteria E.coli W3110, to knock out gene waal(oligosaccharyl transferase).The intestinal bacteria E.coli W3110 Δ waal called after CLM24 of gained disappearance waal gene.

Above-mentioned Red recombination system, is to express lambda particles phage recombinase Gam, Bet and Exo by plasmid pSIM19, by design with the primer amplification of homology arm the kan(kalamycin resistance gene with selection markers) recombinant fragment.Then by electroporation apparatus, shock by electricity, recombinant fragment is proceeded in the intestinal bacteria of expressing lambda particles phage recombinase Gam, Bet and Exo, recombinant fragment under the effect of recombinase with genome on goal gene recombinate, thereby original gene substitution is got off, and resistant gene is by expressing FLP restriction endonuclease, from genome, cut away.

The structure of the expression vector of 2.rfb gene cluster

Basic skills is to take Escherichia coli O 157: H7 genome is template, and clone rfb gene cluster, is inserted into obtained rfb gene cluster in linear plasmid pYES1L, thereby obtains the expression vector p-rfb of rfb gene cluster.

3.malE ^mstructure with the co-expression carrier of pglB gene

Basic skills is to take campylobacter jejuni gene group as template, and clone pglB gene, inserts the clone pglB obtaining in plasmid pBAD24, thereby obtains the expression vector p-pglB of pglB; Take plasmid pMAL-p5X as template, clone malE ^mgene, by the clone malE obtaining ^minsert in plasmid p-pglB, thereby obtain malE ^mco-expression carrier p-pglB-malE with pglB ^m.

The structure of 4.N-glycoprotein fermentation recombinant bacterial strain

Basic skills is by constructed recombinant plasmid p-pglB and p-pglB-malE ^min cotransformation intestinal bacteria CLM24, thereby obtain, express rfb gene cluster, overexpression malE ^mrecombination bacillus coli CBEB with pglB.

The application of recombination bacillus coli of the present invention in the N-glucoprotein vaccine of the preparation enterobacteria O157:H7 of the Chinese People's Anti-Japanese Military and Political College.

Further, the N-glucoprotein vaccine method of the concrete enterobacteria O157:H7 of the preparation Chinese People's Anti-Japanese Military and Political College is:

1. shake-flask culture

The constructed mono-bacterium colony of recombinant bacterial strain CBEB of picking is to being equipped with in the triangular flask of 25mL of improvement TB substratum of 3-5mL, and penbritin final concentration is 100 μ g/mL, and spectinomycin final concentration is 50 μ g/mL, and 37 ℃, 200-225r/min, cultivates 12h.

The bacterium liquid of incubated overnight is accessed in the triangular flask of the 100mL that 50mL improvement TB substratum is housed according to the inoculum size of 0.5-3% (v/v), and penbritin final concentration is 100 μ g/mL, and spectinomycin final concentration is 50 μ g/mL, 37 ℃, and 200-225r/min.

Treat bacterium liquid OD ₆₀₀during=0.4-0.6, access in the triangular flask of the 3L that 1L improvement TB substratum is housed according to the inoculum size of 0.5-3% (v/v), penbritin final concentration is 100 μ g/mL, and spectinomycin final concentration is 50 μ g/mL, 37 ℃, and 200-225r/min.

Treat bacterium liquid OD ₆₀₀during=0.6-0.8, adding final concentration is the L-arabinose of 0.2% (v/v), 16-37 ℃, 200-225r/min.

Above-mentioned adding after L-arabinose, preferably 28 ℃ of leavening temperatures.

After 4-6h, the L-arabinose that to add final concentration be 0.2% (v/v), 16-37 ℃, 200-225r/min, continues to cultivate 14-16 hour.

Above-mentioned preferred 6h adds L-arabinose again, and preferably 28 ℃ of leavening temperatures continue to cultivate 14h.

2.N-glycoprotein purification

By the bacterium liquid 10 of shake flask fermentation, 000-12, the centrifugal 5-10min of 000r/min.Centrifugal gained precipitation is processed 1h with 4 ℃ of 1mg/ml N,O-Diacetylmuramidases.10,000-12, the centrifugal 5-10min of 000r/min, uses affine ni-sepharose purification, collects the elutriant of N-glycoprotein, ultrafiltration desalination.

Wherein, in shake flask fermentation, the output of N-glycoprotein is 3mg/L.

Recombination bacillus coli disclosed by the invention and the application in the N-glucoprotein vaccine of the anti-O157:H7 of preparation thereof have very important using value.

Utilize the anti-O157:H7N-glucoprotein vaccine of recombination bacillus coli fermentation preparation provided by the invention, production stage is simple, with short production cycle, and output is high, and production cost is low, can be applied to the scale operation of anti-O157:H7N-glucoprotein vaccine; Meanwhile, the anti-O157:H7N-glucoprotein vaccine that the inventive method is produced has good immune effect, and for the immunotherapy of bacterial-infection resisting provides new selection, prompting has good commercial exploitation and application prospect.

Accompanying drawing explanation

Fig. 1. glucoprotein vaccine one-step fermentation production method principle schematic.

Fig. 2. gene knockout principle steps schematic diagram and waal gene knockout agarose gel electrophoresis detect.

Fig. 3 .p-rfb expression vector collection of illustrative plates.

Fig. 4 .p-pglB-malE ^mexpression vector collection of illustrative plates.

Fig. 5 .SDS-PAGE analyzes MBP glycosylation.MBP is malE ^mthe albumen of genetic expression, MBP-PS is glycosylated MBP.

Fig. 6 .Western blot analyzes MBP glycosylation.Swimming lane 1 is MBP, and swimming lane 2 is MBP-PS.

Fig. 7 .MALDI-TOF analyzes MBP glycosylation.

Fig. 8. the IgG antibody ELISA of the anti-O157 of mice serum detects.

Fig. 9. the ELISA of mice serum cytokine IL-2, IL-4 detects.

Embodiment

General explanation: the related enzyme of following embodiment is all purchased from Thermo company, and plasmid extraction kit and sepharose reclaim DNA fragmentation test kit purchased from Tian Gen company, and operation is carried out according to respective description book completely.In plasmid construction, gene sequencing is completed by Hua Da genome company.Plasmid pYES1L derives from invitrogen company; Plasmid pBAD24 and the bacterium intestinal bacteria W3110 that sets out derive from ATCC (U.S. typical case DSMZ); DH5 α competent cell is purchased from Quan Shijin Bioisystech Co., Ltd.4-6 Balb/C female mice in age in week, is purchased from Shandong University's new drug evaluation center.Cytokine assay ELISA test kit reaches and can be company limited purchased from Shenzhen.Other experimental techniques in embodiment and reagent if no special instructions, are this area ordinary method and commercial reagent.

Described LB substratum is: peptone 10g/L, yeast powder 5g/L, NaCl10g/L.

Described SOC substratum is: peptone 2g/L, yeast powder 0.5g/L, NaCl0.0585g/L, KCl0.0186g/L, MgCl ₂0.203g/L, MgSO ₄0.246g/L, glucose 20mmol/L.

Described improvement TB substratum is: peptone 10-20g/L, yeast powder 5-30g/L, glycerine 1-10ml/L, NaCl5-10g/L.

Knocking out of embodiment 1, intestinal bacteria W3110waal gene

(1) clone of homologous fragment

Utilize Red recombination system to knock out goal gene.The waal gene order design primer of announcing according to Genbank:

pKD-waal?F：

5’-TTGGAAAAGTTATCATCATTATAAAGGTAAAACATGCTAACATCCTTTAAACTTCATTCATTGAAACCTTACACTCTGGTGTAGGCTGGAGCTGCTTC-3’

pKD-waal?R：

5’-GAGTTTTAACTCACTTCTTAAACTTGTTTATTCTTAATTAATTGTATTGTTACGATTATTAATGACGAGTAAGAGGACATGGGAATTAGCCATGGTCC-3’

With pKD4 by PCR(polymerase chain reaction) amplification in vitro obtains the recombinant fragment with kalamycin resistance.PCR reaction system is as follows: (primer concentration is 20 μ mol/L)

Template DNA 1 μ l, adds water and mends to 50 μ l.

PCR reaction conditions: 97 ℃ of denaturation 10min, 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 90s, 30 rear 72 ℃ of extension 10min of circulation, 4 ℃ of preservations.After the digestion of DpnI restriction endonuclease, reclaim the concentrated homologous recombination fragment of purifying.

(2) preparation of Electroporation-competent cells

(I) picking, with the intestinal bacteria W3110 of pSIM19 plasmid, proceeds in LB substratum, adds 100mg/L penbritin simultaneously, and 30 ℃, 200r/min, cultivates OD ₆₀₀to 0.4;

(II) 42 ℃ of water-bath 15min, 200r/min;

(III) ice bath 15min, centrifugal thalline, then utilizes 10% glycerine washing 3 times;

(IV) add 10% glycerine, be concentrated into 50 times, packing competence.

(3) electricity transforms, screening recon

(I) draw the homologous recombination fragment of 8 μ g/ml, add in the competent cell of 100 μ l, after mixing, be transferred in the 2mm electricity revolving cup of precooling, gently get rid of to cup bottom.Regulate electroporation apparatus, 2.5Kv, electric shock;

(II) add the SOC substratum of 900 μ l, be transferred in aseptic EP pipe after mixing, 37 ℃, 120r/min, cultivates 1h;

(III) coating kalamycin resistance is dull and stereotyped, transfers recon utilization

waal?test?F:GGTATGTAGGGCTCCAAGAG

waal?test?R:AATTTGGTCCCCGAATCATC

Carry out PCR detection, by the further confirmation of PCR product order-checking waal gene, by kalamycin resistance gene, replaced.

(IV) FLP locus specificity restructuring

PCP20 is proceeded to kalamycin resistance clone, cultivates 8h for 30 ℃, after be increased to 42 ℃ and spend the night, thermal induction FLP recombinase is expressed, plasmid is also lost gradually.Utilize transfering loop to pick bacterium liquid rules on non-resistant substratum, the mono-clonal growing is proceeded on the dull and stereotyped and kalamycin resistance flat board of non-resistant simultaneously and cultivated, on non-resistant flat board, grow and kalamycin resistance gene being eliminated of not growing on kalamycin resistance flat board.Utilize detection primer waal test F and waal test R further to identify.

(V) obtain the colibacillus engineering that knocks out waal gene and build, its genotype is W3110 Δ waal, called after intestinal bacteria CLM24.The results are shown in Figure 2.

The structure of embodiment 2, rfb gene cluster (GI:3435170) expression vector

The Escherichia coli O 157 of announcing according to NCBI: H7 genome sequence design primer:

O157-1-F:

5’-GTACCCGGGGATCCTCTAGAGTCGACGCATAAATTTTAATGCTTATCAAAACTATTAGC-3’

O157-1-R:

5’-CATGGATGTCCGTATAAATGGACACACATAATAGCTTTAGTTTTATTAGTGA-3’

O157-2-F:

5’-TCACTAATAAAACTAAAGCTATTATGTGTGTCCATTTATACGGACATCCATG-3’

O157-2-R:

5’-TATGCGCGACAATTATAATGCACATCGTC-3’

O157-3-F:

5’-TGACGATGTGCATTATAATTGTCGCGCATATTTTAACAATAAAACAAATGATGC-3’

O157-3-R:

5’-GAATTTCTTCTCTCATCCGCCAAAACAGAAGCTTTGTTTACTCCTGTCAGGGGTTACC-3’

Take O157:H7 genome as template, take respectively O157-1-F and O157-1-R, O157-2-F and O157-2-R, O157-3-F and O157-3-R as primer, minute three sections of PCR clone rfb gene cluster.PCR reaction system is as follows: (primer concentration is 20 μ mol/L)

Template DNA 1 μ l, adds water and mends to 50 μ l.

PCR reaction conditions: 97 ℃ of denaturation 10min, 94 ℃ of sex change 30s, 60 ℃ (O157-1) or 54 ℃ (O157-2) or 60 ℃ (O157-3) 30s that anneals, 72 ℃ are extended 5min, and 10min, 4 ℃ of preservations are extended in latter 72 ℃ of 30 circulations.

Three PCR fragments of clone are joined to linked system.As follows:

30 ℃ of water-baths connect after 30min, add 35.5 μ l DMSO to mix, then 42 ℃ of thermal shock 20min.The centrifugal 5min of 1,800r/min, by the resuspended precipitation of 1mL0.9%NaCl, gets 100 μ l coating CSM-Trp dull and stereotyped.Cultivate picking transformant after 3 days for 30 ℃, extract plasmid checking.Then further sequence verification rfb gene cluster is correct.Thereby obtained recombinant plasmid p-rfb.

Embodiment 3, recombinant plasmid p-pglB-malE ^mstructure

(1) structure of pglB gene (PglB NCBI-GeneID:905417) expression vector

The campylobacter jejuni NCTC11168 genome sequence design primer of announcing according to NCBI:

pglB-F:

5’-CACGCCATGGTCTTGAAAAAAGAGTATTTAAAAAACCC-3’

pglB-R:

5’-ATTCCCGGGTCAATGATGATGATGATGATGAATTTTAAGTTTAAAAACTTTAG-3’

Take NCTC11168 genome as template, PCR clone pglB gene.PCR reaction system is as follows: (primer concentration is 20 μ mol/L)

Template DNA 1 μ l, adds water and mends to 50 μ l.

PCR reaction conditions: 97 ℃ of denaturation 10min, 94 ℃ of sex change 30s, 50 ℃ of annealing 30s, 72 ℃ are extended 2min, 30 rear 72 ℃ of extension 10min of circulation, 4 ℃ of preservations.

Clone's pglB fragment is utilized respectively to endonuclease NcoI and SmaI digestion process, plasmid vector pBAD24 is also utilized respectively to endonuclease NcoI and SmaI digestion process simultaneously.Utilize sepharose test kit to reclaim the pglB fragment of digestion process and pBAD24 plasmid vector, then utilize T4 ligase enzyme to connect.

Linked system is 10 μ l:

PglB fragment: 6 μ l;

PBAD24 carrier: 2 μ l;

10×Buffer：1μl；

T4 ligase enzyme: 1 μ l.

16 ℃ connect after 12h, the connecting fluid of 10 μ l are transformed to bacillus coli DH 5 alpha competent cell.Conversion process is: the connecting fluid of 10 μ l is added in the DH5 α competent cell of 100 μ l, mix.Ice bath 30min, 42 ℃ of thermal shock 90s, ice bath 2min, adds the LB substratum of 900 μ l, and 37 ℃, 100r/min, hatching 1h, coating amicillin resistance is dull and stereotyped, cultivates 16h, and picking transformant extracts plasmid checking.Then further sequence verification pglB gene is correct.Thereby obtained recombinant plasmid p-pglB.

(2) malE ^mthe structure of (the plasmid pMAL-p5X of source NEB company) and pglB expression vector

The plasmid pMAL-p5x primers of announcing according to NCBI:

malE ^M-F:

5’-TCCCCCGGGGGAAGGAGG?CATAGATTATGAAAATAAAAACAGGTGC-3’

malE ^M-R:

5’-GCGTCGACGTCTCAATGATGATGATGATGATGGGTCGCGTTCTGATCTCCTCCAGTGGCGTTCTGATCGCCGCCGGTCGCGTTCTGATCGCCGCCGGTCGCGTTCTGATCTTCCAGCTGCGCGTCTTTCAGGGC-3’

Wherein: above-mentioned malE ^min-R, contain the gene of expressing glycosylation sequences, its nucleotide sequence is as shown in SEQ ID No.1, specifically:

5’-CTGGAAGATCAGAACGCGACCGGCGGCGATCAGAACGCGACCGGCGGCGATCAGAACGCCACTGGAGGAGATCAGAACGCGACC-3’

Take plasmid pMAL-p5x as template, and PCR clones malE ^mgene.PCR reaction system is as follows: (primer concentration is 20 μ mol/L)

Template DNA 1 μ l, adds water and mends to 50 μ l.

PCR reaction conditions: 97 ℃ of denaturation 10min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 90s, 30 rear 72 ℃ of extension 10min of circulation, 4 ℃ of preservations.

Clone's pglB fragment is utilized respectively to endonuclease SmaI and SalI digestion process, plasmid vector p-pglB is also utilized respectively to endonuclease SmaI and SalI digestion process simultaneously.Utilize sepharose test kit to reclaim the pglB fragment of digestion process and p-pglB plasmid vector, then utilize T4 ligase enzyme to connect.

Linked system is 10 μ l:

PglB fragment: 6 μ l;

PBAD24 carrier: 2 μ l;

10×Buffer：1μl；

T4 ligase enzyme: 1 μ l.

16 ℃ connect after 12h, the connecting fluid of 10 μ l are transformed to bacillus coli DH 5 alpha competent cell.Conversion process is: the connecting fluid of 10 μ l is added in the DH5 α competent cell of 100 μ l, mix.Ice bath 30min, 42 ℃ of thermal shock 90s, ice bath 2min, adds the LB substratum of 900 μ l, and 37 ℃, 100r/min, hatching 1h, coating amicillin resistance is dull and stereotyped, cultivates 16h, and picking transformant extracts plasmid checking.Then further sequence verification malE ^mgene correct.Thereby obtained recombinant plasmid p-pglB-malE ^m.

The purifying of the structure of embodiment 4, recombinant escherichia coli strain and fermentation and N-glycoprotein

(1) structure of recombinant escherichia coli strain

With reference to embodiment 1(2) method prepares CLM24 electricity and turns competent cell.The recombinant plasmid p-rfb that draws 10 μ l, adds in the competent cell of 100 μ l, is transferred in the 2mm electricity revolving cup of precooling after mixing, and gently gets rid of to cup bottom.Regulate electroporation apparatus, 2.5Kv, electric shock; In electric revolving cup, add subsequently the SOC substratum of 900 μ l, mix, be transferred in aseptic EP pipe, 37 ℃, 120r/min, cultivates 1h; Coating kalamycin resistance is dull and stereotyped, after 37 ℃ of cultivation 24h, transfers recon checking.Thereby obtain recombinant bacterium CLM24/p-rfb.

Get recombinant bacterium CLM24/p-rfb chemistry (CaCl prepared by 50ul ₂) add 5ul plasmid p-pglB-malE in competent cell ^m, mix ice bath after 20～30 minutes, 42 ℃ of water-bath heat shocks ice bath 3～5 minutes after 90 seconds; Then add 900ul LB substratum, 37 ℃, 120r/min renewal cultivation 45min～1h; The centrifugal 2min of 4,000r/min, pours out part supernatant, and remaining thalline coating amicillin resistance is dull and stereotyped, after 37 ℃ of cultivation 24h, transfers recon checking.Thereby obtain recombinant bacterium CLM24/p-rfb+p-pglB-malE ^m.

(2) fermentation of recombination bacillus coli

The recombinant bacterial strain CBEB(CLM24/p-rfb+p-pglB-malE that picking is constructed ^m) single bacterium colony is to being equipped with in the triangular flask of 25mL of improvement TB substratum of 5mL, penbritin final concentration is 100 μ g/mL, and spectinomycin final concentration is 50 μ g/mL, and 37 ℃, 200r/min, cultivates 12h.

The bacterium liquid of incubated overnight is accessed in the triangular flask of the 100mL that 50mL improvement TB substratum is housed according to the inoculum size of 1% (v/v), and penbritin final concentration is 100 μ g/mL, and spectinomycin final concentration is 50 μ g/mL, 37 ℃, and 200-225r/min.

When bacterium liquid OD600=0.6, according to the inoculum size of 1% (v/v), access in the triangular flask of the 3L that 1L improvement TB substratum is housed, penbritin final concentration is 100 μ g/mL, spectinomycin final concentration is 50 μ g/mL, 37 ℃, 200-225r/min.

Treat bacterium liquid OD ₆₀₀=0.6 o'clock, adding final concentration was the L-arabinose of 0.2% (v/v), 28 ℃, and 200-225r/min.

After 6h, the L-arabinose that to add final concentration be 0.2% (v/v), 28 ℃, 200-225r/min, continues to cultivate 14h.

(3) purifying of N-glycoprotein

1L fermented liquid, through the centrifugal 10min of 10,000r/min, is collected thalline and is also used the periplasmic space protein extract of 30mL (20mM Tris-HCl, 20% (wt/vol) sucrose, 1mM EDTA, 1mg/ml N,O-Diacetylmuramidase, pH7.5) 4 ℃ of processing thalline 1h.The centrifugal 30min of 12,000r/min, then collects supernatant and joins and use binding buffer liquid (10mM imidazoles, 0.5MNaCl, 20mM Na ₂hPO ₄/ NaH ₂pO ₄damping fluid, in the affine nickel post of the 5mL that pH7.4) pre-equilibration is crossed.Through the binding buffer liquid washing of 10 column volumes, with elution buffer (250mM imidazoles, 0.5M NaCl, 20mMNa ₂hPO ₄/ NaH ₂pO ₄damping fluid, pH7.4) wash-out, collects the elutriant containing N-glycoprotein.

Packing the elutriant that contains target protein into molecular weight cut-off is 10kDa super filter tube, and 4 ℃ 5, the centrifugal 30min of 000g, discards lower pipe liquid, in sleeve pipe, fills it up with desalination damping fluid, 4 ℃ 5, and the centrifugal 30min of 000g.Repeat 3 times, be concentrated into 2mL to target protein, and imidazoles is fully removed.Albumen after concentrated is frozen in-70 ℃ of refrigerators.

The evaluation of embodiment 5, N-glycoprotein

SDS-PAGE analysis is carried out in the N-glycoprotein sampling of purifying.MBP molecular weight, in 46KDa left and right, conforms to theoretical molecular.The glycosylated MBP of N-forms scalariform band, and main band molecular weight distribution is between 50KDa and 55KDa.Because SDS-PAGE sensitivity is limited, the band of some glycoprotein does not show.The results are shown in Figure 5.

Utilize Western Blot to identify N-glycoprotein, adopt respectively anti-His, anti-MBP, anti-O157 antibody as primary antibodie, select suitable sheep anti mouse or goat-anti rabbit anti-as two, detect analysis.N-glycosylated MBP demonstrates owing to having added the O-antigen that chain length do not wait the scalariform band that the nonglycosylated MBP of molecular weight ratio is large, prove MBP generation glycosylation.The results are shown in Figure 6.

Utilize MALDI-TOF to carry out the evaluation of molecular weight to the glycosylated MBP of N-and MBP.MBP molecular weight is 45823Da, and MBP host molecule amount is distributed near 48790Da.The results are shown in Figure 7.

Embodiment 6, N-glycoprotein immune effect

(1) immune mouse

Get the female mouse of Balb/C in 6 week age, be divided into three groups, be respectively every 30 μ g of back subcutaneous multi-point injection N-glycosylation MBP(, 150 μ l, n=8), every 30 μ g of MBP(, 150 μ l, n=8) and every 150 μ l of PBS(, n=5), every immunity in two weeks once, immunity is three times altogether.First immunisation is used complete Freund's adjuvant, and incomplete Freund's adjuvant is used in second and third immunity.Before immunity and after each immunity one week, from mouse shank saphena, get blood 200ml, after the standing 1h of room temperature, the centrifugal 20min of 4,000r/min, takes out serum, and packing is stored in-20 ℃.

(2) serum antibody titer detects

Escherichia coli O 157: H7 lipopolysaccharides is coated with 96 orifice plates, ELISA detects Escherichia coli O 157 in mice serum: the anti-titre of H7 lipopolysaccharides, the results are shown in Figure 8.

(3) serum cytokines detects

By cytokine ELISA test kit (Shenzhen reaches section), measure IL-2 and the IL-4 level in the rear mice serum of immunity.IL-2 level: MP group > M group > PBS group; IL-4 level: MP group < M group < PBS group., show that MBP-PS can activating Th 1 cell, suppress Th2 cytoactive.The results are shown in Figure 9.

According to above N-glycoprotein immune effect, measure and can reach a conclusion, the N-glucoprotein vaccine that recombination bacillus coli of the present invention is produced has the effect of the obvious enterobacteria O157:H7 of the Chinese People's Anti-Japanese Military and Political College.This mouse model is simulated the environment in human body completely, therefore for human tumor treatment, also has good effect in theory.Indicate that vaccine of the present invention can be used for the mankind and prevents Escherichia coli O 157: the immunotherapy of H7.

The immunotherapy that the present invention is bacterial-infection resisting provides new selection, has a good application prospect.

Claims (2)

1. a strain recombination bacillus coli, this bacterium called after recombination bacillus coli CBEB, is characterized in that: described recombination bacillus coli makes by the following method: build containing malE ^mco-expression carrier p-pglB-malE with pglB gene ^m, then build the expression vector p-rfb containing rfb gene cluster, then by the recombinant plasmid p-pglB-malE of above-mentioned structure ^min p-rfb cotransformation intestinal bacteria CLM24, obtain expressing pglB, malE simultaneously ^mthe recombination bacillus coli CBEB of gene and rfb gene cluster, its genotype is W3110 Δ waal/p-pglB-malE ^m+ p-rfb;

Wherein, described malE ^mderive from plasmid pMAL-p5X, described pglB gene source is in campylobacter jejuni NCTC11168, coexpression malE ^mwith the carrier of pglB gene be pBAD24; Described rfb gene cluster derives from Escherichia coli O 157: H7; The carrier of expressing rfb gene cluster is pYES1L;

Above-mentioned malE ^mfor malE gene mutation body, be by insert the gene gained of the expression glycosylation sequences of one section of nucleotide sequence as shown in SEQ ID No.1 at 3 ' end of malE gene;

Above-mentioned intestinal bacteria CLM24 is the colibacillus engineering building by knocking out the waal gene of starting strain intestinal bacteria W3110, and its genotype is W3110 Δ waal, called after intestinal bacteria CLM24.

2. the application of recombination bacillus coli in the N-glucoprotein vaccine of the preparation enterobacteria O157:H7 of the Chinese People's Anti-Japanese Military and Political College described in claim 1.

Images