CN103725774B - Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method - Google Patents
Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method Download PDFInfo
- Publication number
- CN103725774B CN103725774B CN201310488947.7A CN201310488947A CN103725774B CN 103725774 B CN103725774 B CN 103725774B CN 201310488947 A CN201310488947 A CN 201310488947A CN 103725774 B CN103725774 B CN 103725774B
- Authority
- CN
- China
- Prior art keywords
- gene
- ymzc
- rice
- application method
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and an application method. A forward primer sequence of the molecular maker is Wx-YMZC, namely, TCACCATTCCTTCAGTTCTT; and a reverse primer sequence is Wx-YMZCR, namely, TCTGAATAAGAGGGGAAACA. The application method comprises the steps as follows: 1), DNA (deoxyribonucleic acid) of a to-be-investigated rice gene is extracted; 2), PCR (polymerase chain reaction) amplification is performed on the to-be-investigated rice gene; 3), a reaction product is detected by 10% of nondenaturing polyacrylamide gel electrophoresis, and compared with (CT) n types in the Wx gene; and 4), a reaction product is detected by 2% of agarose gel electrophoresis and compared with base types of G/T in the Wx gene after AccI enzyme digestion. According to the novel molecular marker Wx-YMZC, the (CT) n types and the base types of G/T in the Wx gene can be detected only by one-time PCR amplification and one-time enzyme digestion reaction, not only is the experiment simpler, but also the experimental cost is reduced, and simultaneously, the accuracy rate is higher.
Description
Technical field:
The present invention relates to the related molecular marker method of amylose in rice gene Wx, the particularly genotypic molecule marker Wx-YMZC of rapid detection amylose in rice Wx and application method, belong to molecular genetics field, can be used for the Classification Identification of the breeding of amylose in rice molecular marker assisted selection and kind matter.
Background technology:
Paddy rice is one of most important food crop of depending on for existence of global human, and nearly half population take paddy rice as food in the world.What require rice yield along with people improves constantly, and increasing human consumer starts to pursue fine quality rice gradually.Amylose content affects the most important factor of rice quality, and amylose starch catalyzes and synthesizes in conjunction with amylosynthease (GBSS) primarily of the graininess of Wx genes encoding, and its amylose content of material of different Wx gene type there are differences.
Wx gene (Waxy gene, Wx) also referred to as waxy gene, be positioned at (Lwata et al. on No. 6 chromosomal galianconism, 1971), be the main gene controlling amylose content, be made up of 14 exons and 13 introns, comprise the sequence of coding region and 3 ' end and 5 ' end side, total length 5499bp (Wang et a1., 1990).The First Intron 5 ' of paddy rice Wx gene leader sequence holds the tumor-necrosis factor glycoproteins of upstream 55bp place existence one section of (CT) n of shearing site, research shows that the tumor-necrosis factor glycoproteins of this (CT) n and amylose content exist remarkable relation (Shu Qingyao etc., 1998).In addition, the base mutation that a G is replaced into T is there is in+713bp the position of paddy rice Wx gene First Intron 5 ' end+1, the sudden change in this site obviously changes the montage efficiency of Wx gene, large quantity research shows, montage efficiency and the amylose content in this site are directly related (Wang Zongyang etc., 1993).Detect these two gene locuss and select simultaneously, the amylose content improvement that can be later stage rice quality provides better basis.
Traditional conventional detection method is the repeat number (subscript n is multiplicity) of (CT) n in use 484/485 Markers for Detection Wx gene, uses the base type of G/T in PCR-Acc I Markers for Detection Wx gene.The primer used is different, and needs to carry out twice independently different pcr amplification reaction and an endonuclease reaction, and experimental arrangement is more loaded down with trivial details.
Reference
[1]Lwata N,Omura T.Linkage analysis by re-ciprocal translocation method in rice plant(Oryza sativa L.)II:Linkage groups corresponding to the chromosome5,6,7,8,9,10and11[J].Sci.Bull.Fac.Agr.,Kyushu Univ.,1971,25:802-804.
[2]Macdonald F D,Preiss J.Partial purification and characterization of granule-bound starch synthases from normal and waxy maize[J].Plant physiology,1985,78(4):849-852.
[3]Wang Z Y,Wu Z L,Xing Y Y,et al.Nucleotide sequence of rice waxy gene[J].NuclAcicls Res,1990,18(19):5898.
[4] Shu Qingyao, Xu Guanghua, the summer is soldierly bearing, etc. rice apparent amylose content progress (summary) [J]. Zhejiang Agriculture journal, 1998,10 (1): 47-54.
[5] Wang Zongyang, Zheng Feiqin, Gao Jiping. the order [J] of two kinds of similar transposable elements in paddy rice waxy gene. Chinese science (B collects), 1993,23 (6): 598-603.
[6]Murray M G,Thompson W F.Rapid isolation of high molecular weight plant DNA[J].Nucleic Acids Research,1980,8(19).
Summary of the invention:
The object of the invention is to propose a kind of New molecular marker Wx-YMZC and corresponding detection method thereof, Classification Identification is carried out to amylose in rice kind matter, higher accuracy rate can be reached, improve detection efficiency.
The present invention realizes like this.Design pair of primers: its forward primer sequence: Wx-YMZCF:TCACCATTCCTTCAGTTCTT, reverse primer sequences: Wx-YMZCR:TCTGAATAAGAGGGGAAACA, called after Wx-YMZC molecule marker.This molecule marker is for the identification of the kind matter of amylose in rice Wx gene and somatotype.
Utilize the above-mentioned kind matter of Wx-YMZC molecular markers for identification amylose in rice Wx gene and the method for somatotype, the steps include:
1. extract the DNA of paddy gene to be checked;
2. pair oryza sativa genomic dna to be checked carries out pcr amplification;
Pcr amplification is totally 10 μ L, and concrete composition is as follows:
Pcr amplification program is in table 1:
The pcr amplification program of table 1 primer Wx-YMZC
3. detect (CT) n type in Wx gene.Reaction product is at 10% native polyacrylamide gel electrophoresis, and with cma staining, statistics electrophoresis banding pattern, different banding pattern corresponds to different (CT) n repeat number types.
4. detect the base type of G/T in Wx gene.Reaction product after AccI enzyme is cut at 2% agarose gel electrophoresis.The single tape of 186bp if electrophoresis result is had an appointment, then show that this rice material is not cut by AccI enzyme, and the genotype of this rice material is TT type; If there are two bands after digested, be about 137bp and 49bp, then show that the genotype of this rice material is GG type; If the DNA band equivalent of three kinds of molecular weight exists, then show that the genotype of this rice material is GT heterozygous.
New molecular marker Wx-YMZC of the present invention is utilized only to need a pcr amplification reaction and an endonuclease reaction just can detect the base type detecting (CT) n type and G/T in Wx gene, not only make experiment simpler, and reducing experimental cost, accuracy rate is higher simultaneously.
Accompanying drawing explanation
Fig. 1 primer Wx-YMZC increases the electrophoresis result of 15 parts of quality matetrials, and wherein M is DNA marker DL500,
Fig. 2 primer Wx-YMZC increases the 2% agarose gel electrophoresis result of 15 kinds of quality matetrials after Acc I enzyme is cut, and wherein M is DNA marker DL500,
Fig. 3-Figure 10 is the sequence alignment figure of Japan's fine (source ncbi database) and 15 quality matetrials.
In figure: "---" represents new primer Wx-YMZC forward primer sequence and reverse primer complementary sequence;
represent the SNP (G/T) of+713bp position of Wx gene First Intron 5 ' end+1;
", represent the repetition of (CT) in Wx gene and the repetition of (AATT).
Embodiment:
(1) for examination material
Test materials comprises 15 parts of materials, wherein the material of 4 parts of high amylose contents, and low material and the 1 part of glutinous rice material waiting amylose content in 10 parts, specifically in table 2.
The material of table 215 part different amylose content
(2) detection of paddy rice Wx genotypic sequences
The Wx gene complete sequence of the Japanese fine paddy rice of search in ncbi database (http://www.ncbi.nlm.nih.gov/), is convenient to primer Wx-YMZF and Wx-YMZR checked order for a pair with primer3.0 design.This primer amplification sequence comprises the tumor-necrosis factor glycoproteins of one section of (CT) n at Wx gene leader sequence First Intron 5 ' end 55bp place, shearing site upstream and the G/T site of First Intron 5 ' end SNP, amplified fragments size is about 848bp, the company that checks order of Beijing section of holding up is sent by the amplified production of 15 parts of materials to check order subsequently, sequencing with primer Wx-YMZ for sequencing primer, the order-checking of sequence is completed by positive and negative twice sequencing reaction, the fragment of order-checking uses DNAMAN to carry out splicing and the correction (concrete sequence is shown in accompanying drawing 1) of craft, the gene order of statistics 15 parts of materials, count 5 kinds of different (CT) n types (subscript is multiplicity) altogether, wherein (CT) n type of No. 1 is (CT)
20, No. 2-8 is (CT)
18, No. 9-12 is (CT)
17, No. 13 is (CT)
13, 14 and No. 15 is (CT)
11, and First Intron 5 ' holds the sequence display of+713bp position G/T of+1 in Wx gene: 2-12 material is TT type, and 1,13,14 and 15 is GG type, be that the primer that subsequent design is new is prepared by the conserved sequence of comparison 15 high-quality resources simultaneously.
Measure the molecule marker Wx-YMZ of amylose in rice Wx genotypic sequences:
Wx-YMZF forward primer sequence: GCGTCGTCATAGACAAAAGT
Wx-YMZR reverse primer sequences: TGACCAACTCGGCTACTAAA
The pcr amplification of this primer is totally 25 μ L, and concrete composition is as follows:
Pcr amplification program is in table 3:
The pcr amplification program of table 3 primer Wx-YMZ
The Wx genotype of table 4 15 parts of materials
(3) acquisition of Wx-YMZC mark
DNAMAN software is used to compare sequencing result and the Japan fine paddy rice Wx gene order same sector of primer Wx-YMZ in the amplified production of 15 parts of materials, the conservative section choosing very high homology redesigns three to new primer Wx-YMZA, Wx-YMZB and Wx-YMZC, the First Intron 5 ' that these three pairs of primers only comprise Wx gene leader sequence holds the tumor-necrosis factor glycoproteins of upstream 55bp place existence one section of (CT) n of shearing site and Wx gene First Intron 5 ' to hold the base mutation of the G/T of+713bp position of+1, the Fragment Differential of this primer amplification is only relevant with the repeat number of (CT), and this fragment is only containing a PCR-AccI restriction enzyme site, the specificity of this restriction enzyme site is only relevant with the base position of G/T, the object of three pairs of primers is intended to the change being distinguished n value in (CT) n in amplified production by 10% native polyacrylamide gel electrophoresis, do not need the amplification again of primer PCR-Acc I, the product directly can cutting this primer amplification by Acc I enzyme detects the change (see accompanying drawing 3) of its G/T type.
Experimentally result filters out amplified production and enzyme and cuts that after product clip size is suitable, electrophoresis result is clear, the good primer Wx-YMZC of polymorphism, and this primer amplification clip size is about 186bp.
Its forward primer (5 '-3 ') sequence: TCACCATTCCTTCAGTTCTT,
Reverse primer (5 '-3 ') sequence: TCTGAATAAGAGGGGAAACA.
(4) extraction of paddy DNA to be checked
CTAB method with reference to Murray (1980) extracts paddy DNA, and makes suitable amendment.
1) in the paddy rice spire phase, clip 2cm-3cm rice leaf is placed in the 2mL centrifuge tube that steel ball is housed, and adds 700 μ L2 × CTAB extracting solutions.
2) load in proof press by centrifuge tube, draw a design grinding 5min, is Powdered, can stops to pipe intra vane.If pipe intra vane is still larger sheet, then can draw a design the time by proper extension, until blade be broken for Powdered till.
3) will beat excellent centrifuge tube and be placed in the water-bath water-bath 1h of 65 DEG C, period constantly shakes.
4) water-bath centrifuge tube is completely taken out, and be cooled to room temperature, add isopyknic chloroform/primary isoamyl alcohol (24: 1) subsequently, soft mixing to liquid in pipe of being inverted becomes emulsification shape (being divided into three layers) up and down, put into whizzer, the centrifugal 5min of 12000rpm rotating speed.
5) softly centrifuge tube is taken out, draw the supernatant liquor of about 450 μ L, move to reference numeral and in sterilized new 1.5mL centrifuge tube, and add the Virahol (about 300 μ L) of 2/3 volume precooling (-20 DEG C), centrifuge tube is turned upside down (action wants soft) after shaking up for several times, be placed in-20 DEG C of refrigerator about 30min.
6) by centrifuge tube with the centrifugal 5min of 12000rpm rotating speed, abandoning supernatant, adds 500 μ L70% ethanolic soln washing precipitations, gently shake precipitation is suspended.
7) by centrifuge tube with the centrifugal 5min of 12000rpm rotating speed, abandoning supernatant, carefully by after centrifugal with the centrifuge tube back-off of precipitation on thieving paper, dried overnight precipitates.
8) add in 200 μ L TE damping fluids of baking oven preheating in advance, and be placed in vibrator and shake dissolution precipitation, be stored in 4 DEG C for subsequent use.
(5) PCR of Wx-YMZC mark reacts and electrophoresis detection
Pcr amplification is totally 10 μ L, and concrete composition is as follows:
Pcr amplification program is in table 5:
The pcr amplification program of table 5 primer Wx-YMZC
(6) electrophoresis result analysis
(CT) n type in 1.Wx gene
Molecule marker Wx-YMZC is utilized to carry out gene type assay to 15 for examination material.Detect 5 kinds of different (CT) n types altogether, this result and sequencing result completely the same.Specifically see Fig. 1, in figure, numbering is numbered consistent with table 2.
As can be seen from electrophoresis result and sequencing result, No. 1 is a kind of banding pattern, and its (CT) n type is (CT)
20; 2-8 is a kind of banding pattern, and its (CT) n type is (CT)
18; 9-12 is a kind of banding pattern, and its (CT) n type is (CT)
17; No. 13 is a kind of banding pattern separately, and its (CT) n type is (CT)
13; 14 and No. 15 is a kind of banding pattern, and its (CT) n type is (CT)
11, utilize mark Wx-YMZC can use (CT) n type of (CT) n type detection unknown material of known materials, and band is clear.
2. detect the base type of G/T in Wx gene
Molecule marker Wx-YMZC is utilized to carry out G/T gene type assay to 15 parts for examination material.If the base T of+713bp position at Wx gene First Intron 5 ' end+1, then can not be cut by AccI enzyme enzyme, thus electrophoresis result is the single tape of about 186bp, is TT shaped material, and No. 2-12 is TT shaped material, if the base of+713bp position is G, then be cut to two bands by AccI enzyme enzyme, about 137bp and 49bp, be GG shaped material, 1,13-15 is GG shaped material (specifically seeing Fig. 2).
Claims (2)
1. the genotypic molecule marker Wx-YMZC of rapid detection amylose in rice Wx, it is characterized in that this molecule marker is by forward primer sequence: Wx-YMZCF:TCACCATTCCTTCAGTTCTT, and reverse primer sequences: Wx-YMZCR:TCTGAATAAGAGGGGAAACA formed, called after Wx-YMZC molecule marker.
2. a rapid detection amylose in rice Wx genotypic molecule marker Wx-YMZC application method, is characterized in that the steps include:
1) DNA of paddy gene to be checked, is extracted;
2), pcr amplification is carried out to oryza sativa genomic dna to be checked;
Pcr amplification is totally 10 μ L, and concrete composition is as follows:
Pcr amplification program is as follows:
3), reaction product 10% native polyacrylamide gel electrophoresis detects (CT) n type in comparison Wx gene;
4), reaction product detects the base type of G/T in comparison Wx gene after Acc I enzyme is cut with 2% agarose gel electrophoresis.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310488947.7A CN103725774B (en) | 2013-10-18 | 2013-10-18 | Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310488947.7A CN103725774B (en) | 2013-10-18 | 2013-10-18 | Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103725774A CN103725774A (en) | 2014-04-16 |
CN103725774B true CN103725774B (en) | 2015-06-24 |
Family
ID=50450065
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310488947.7A Expired - Fee Related CN103725774B (en) | 2013-10-18 | 2013-10-18 | Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103725774B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106318937B (en) * | 2015-06-17 | 2019-03-15 | 深圳华大生命科学研究院 | Molecular labeling and its application |
CN110894542A (en) * | 2019-12-31 | 2020-03-20 | 扬州大学 | Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101113468A (en) * | 2007-07-20 | 2008-01-30 | 南京农业大学 | Molecule labelling method for soft rice gene locus with low-content of amylose |
CN101792805A (en) * | 2010-03-18 | 2010-08-04 | 江苏省农业科学院 | Molecular markers of paddy endosperm low amylose content gene Wx-mq |
CN101880724A (en) * | 2010-07-14 | 2010-11-10 | 中国科学院遗传与发育生物学研究所 | Molecular marker of gene for regulating amylose content of rice and application thereof |
CN102146472A (en) * | 2011-03-18 | 2011-08-10 | 江苏省农业科学院 | Four-primer marking method for identifying different genotypes of rice dark endosperm mutator gene Wx-mq |
CN103276071A (en) * | 2013-05-20 | 2013-09-04 | 湖北省农业科学院粮食作物研究所 | Genotype identification primer and method of rice amylose content control gene Wx and identification method |
-
2013
- 2013-10-18 CN CN201310488947.7A patent/CN103725774B/en not_active Expired - Fee Related
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101113468A (en) * | 2007-07-20 | 2008-01-30 | 南京农业大学 | Molecule labelling method for soft rice gene locus with low-content of amylose |
CN101792805A (en) * | 2010-03-18 | 2010-08-04 | 江苏省农业科学院 | Molecular markers of paddy endosperm low amylose content gene Wx-mq |
CN101880724A (en) * | 2010-07-14 | 2010-11-10 | 中国科学院遗传与发育生物学研究所 | Molecular marker of gene for regulating amylose content of rice and application thereof |
CN102146472A (en) * | 2011-03-18 | 2011-08-10 | 江苏省农业科学院 | Four-primer marking method for identifying different genotypes of rice dark endosperm mutator gene Wx-mq |
CN103276071A (en) * | 2013-05-20 | 2013-09-04 | 湖北省农业科学院粮食作物研究所 | Genotype identification primer and method of rice amylose content control gene Wx and identification method |
Also Published As
Publication number | Publication date |
---|---|
CN103725774A (en) | 2014-04-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9714431B2 (en) | Compositions and methods for enhancing oil content in plants | |
CN101974520B (en) | Molecular maker SIsv1118 closely linked with high gene of millet strain | |
CN103509791B (en) | The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof | |
CN102086472B (en) | Gene relevant to thousand seed weight character of wheat, haplotype of gene and application thereof | |
CN101240279B (en) | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 | |
CN101240278B (en) | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 | |
CN104789557A (en) | Cucurbita moschata internal reference gene and application thereof | |
CN103725774B (en) | Molecular marker Wx (waxy gene)-YMZC for rapidly detecting rice amylase Wx genotype and application method | |
CN101824411B (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
CN104762397A (en) | Molecular marker method for detecting low abdominal fat percentage of Gaoyou ducks and application | |
CN103898197A (en) | Common malignant tumor susceptibility gene detection chip | |
CN104404030A (en) | Kit and method for rapidly extracting plant genome DNA | |
Wu et al. | Detection of olive oil using the Evagreen real-time PCR method | |
Wu et al. | Event-specific qualitative and quantitative PCR detection methods for transgenic rapeseed hybrids MS1× RF1 and MS1× RF2 | |
CN102827936B (en) | Composition and reagent kid for testing human serum albumin transgenic rice strain 114-7-2 | |
La Paz et al. | Characterization of polyadenylated cryIA (b) transcripts in maize MON810 commercial varieties | |
CN106282338A (en) | The molecular detecting method of rice photo-thermo-sensitive male sterility pms3 and p/tms12 1 gene and molecular marker thereof | |
Xu et al. | Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1 | |
CN102864146B (en) | Application of ath-eTM160 in inhibiting functions of microRNA160 | |
CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
Ma et al. | Single-primer PCR correction: a strategy for false-positive exclusion | |
CN108456679A (en) | High oleic acid transgenic soybean event E2D8037-3 external source Insert Fragment flanking sequences and its application | |
CN104946742B (en) | A kind of DNA molecular marker method based on single primer amplification reaction | |
CN106636399A (en) | Method for performing true and false identification on oviductus ranae and special primer | |
WO2014018501A1 (en) | Endpoint zygosity assay to detect rf4 gene in maize |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150624 Termination date: 20151018 |
|
EXPY | Termination of patent right or utility model |