CN103717756A

CN103717756A - Assay for the detection of nucleotide substitutions in genomes of sabin oral poliovirus vaccine viruses

Info

Publication number: CN103717756A
Application number: CN201280023280.7A
Authority: CN
Inventors: J·M·达什潘德; S·S·南迪; D·K·沙玛
Original assignee: Indian Council of Medical Research
Current assignee: Indian Council of Medical Research
Priority date: 2012-03-07
Filing date: 2012-03-07
Publication date: 2014-04-09
Anticipated expiration: 2032-03-07
Also published as: HK1194438A1; CN103717756B; WO2013132504A1; BR112013030390A2

Abstract

The present invention provides a multiplex SNP assay method and primers for the specific and simultaneous detection of mutations in the genomes of live attenuated oral poliovirus vaccine (Sabin) viruses, vaccine-like and vaccine derived polio viruses of all the three serotypes. Importantly, the inventive primers and the assay eliminate the need for costly, time-consuming and complex procedures like complete genome sequencing. This novel assay is able to test several samples in a very short time. Therefore, the assay is very simple, fast and cost-effective. A kit comprising the novel primers is also provided.

Description

Test for detection of the nucleotide subsitution in the genome of Sa guest oral polio virus vaccine virus

Invention field:

The present invention broadly belongs to biological technical field, and be specifically related to the new primer for detection of the sudden change of the specific site in the genome of the derivative poliovirus of attenuation oral polio virus vaccine (Sa Bin) virus, vaccine sample and vaccine of living, and the test kit that contains above-mentioned primer.

Background of invention:

Albert B doctor Sabin has researched and developed the attenuation oral polio virus vaccine alive for immunity antagonism paralytic spinal poliomyelitis.He is by careful laboratory work, isolates very carefully the virus strain of sudden change from produce the disease of wild-type poliovirus of all three kinds of serotypes.By the strain of these attenuations (non-neurotoxic) poliovirus, for generation of the attenuation oral polio vaccine of living, this vaccine has been used in the whole world more than 50 year.Sa Bin has has also researched and developed for evaluate the test of the neurotoxicity (NVT) of poliovirus monkey.NVT has become for proving the standard quality control test of oral polio virus vaccine attenuation.Researched and developed recently the neurotoxicity test in transgenic mice, as the replacement scheme of monkey NVT.

NVT can check the biological character (attenuation and toxicity) of poliovirus.Although NVT can be by the classification of severity of toxicity, it can not determine viral genome proterties.

In the eighties in 20th century, described and distinguished wild and antigen and molecule marker Sa guest OPV strain.Genome sequencing, clone and recombinant DNA technology are used for understanding the genome difference between poliovirus Sa guest attenuation and that parent is wild.These researchs cause the detection of the specific sudden change relevant to the attenuation proterties of Sabin vaccine poliovirus.

In following table 1, provided most possible attenuation site:

Researched and developed molecular testing, that is, and by the mutation analysis of PCR and restriction enzyme cutting (MAPREC), with the sudden change on Single locus in quantitative Sabin vaccine strain (the main attenuation site in the 5 ' untranslated district) and associated with NVT result thereof.WHO has recommended this test for testing the quality of poliovirus vaccine.The sudden change of having researched and developed by PCR in real time recently, detects.Also researched and developed the Microarray that can detect the sudden change in whole virogene of poliomyelitis group.

United States Patent (USP) 5585477 and 5691134 relates to the Auele Specific Primer for detection of the poliovirus in clinical sample, and thus itself and non-poliomyelitis enterovirus (NPEV) are made a distinction, but the specific test method of distinguishing poliovirus based on its inherited character (that is, specifically based on attenuation site) is not described.

Complete gene order-checking and full genome micromatrix can be determined the accurate Nucleotide (A, T, G or C) in all known poliomyelitis attenuations site, but still do not exist fast and test is easily used as above-mentioned six sites of poliovirus 1(of simultaneously detecting in single test), tri-sites of 2() and 3(2 site) the costliness of sudden change and the alternative of complex technology in all known attenuation site.

Goal of the invention:

The application's object is to be provided for to detect the multiplex PCR test of the sudden change of the specific site in the genome of the derivative poliovirus of attenuation oral polio vaccine alive (Sa Bin) virus, vaccine sample and the vaccine of these three kinds of serotypes simultaneously.

Another free-revving engine of the present invention is to provide for detect the new primer of sudden change in specific attenuation site of genome of the poliovirus of these three kinds of serotypes simultaneously.

A further object of the present invention is to provide the test kit that comprises above-mentioned primer for multiplex PCR test, and for detect simultaneously, the attenuation oral polio vaccine alives (Sa Bin) of these three kinds of serotypes is viral in described test, the sudden change of the specific site of the genome of vaccine sample and the derivative poliovirus of vaccine.

Invention statement

According to the present invention, provide the sudden change of specific site or the test of SNP and the primer of the genome of the derivative poliovirus of attenuation oral polio vaccine alive (Sa Bin) virus, vaccine sample and vaccine for detect these three kinds of serotypes simultaneously.

Summary of the invention:

The present invention relates to test and the new primer of sudden change of specific site of the genome of the derivative poliovirus of attenuation oral polio vaccine alive (Sa Bin) virus, vaccine sample and vaccine for detect these three kinds of serotypes simultaneously.The present invention also provides the test kit comprising for detection of the primer of the sudden change on all specific sites in the genome of above-mentioned virus.

the summary of the present invention of reference table/schema/embodiment etc.:

Fig. 1 & 1A has described the result for sudden change-SNaP firing test (shot assay) of the Nucleotide of the specific position of Sa guest poliovirus 1 and contrast target.

Fig. 2 & 2A has described the result for sudden change-SNaP firing test of the Nucleotide of the specific position of Sa guest poliovirus 2 and contrast target.

Fig. 3 & 3A has described the result for sudden change-SNaP firing test of the Nucleotide of the specific position of Sa guest poliovirus 3 and contrast target.

Fig. 4 has described the first step multiplex PCR result on 2% sepharose.

Table 1 provides attenuation site most possible in the genome of poliovirus.

Table 2 provides the primer for the preparation of DNA cloning of target specific regions.

detailed description of the present invention with reference to accompanying drawing/embodiment

Reference table, accompanying drawing etc. and specific embodiment have been described the present invention; This description is not to want to explain in a limiting sense.When with reference to description of the invention, the various embodiments for replacing of the present invention will be that those skilled in the art are apparent.Therefore expect that these can form a part of the present invention for the embodiment of replacing.

The invention provides a kind of test method; A set of specific new primer and the test kit that comprises these Auele Specific Primers, for detect the Nucleotide in all known attenuation site of the poliovirus of all three kinds of hypotypes in single test simultaneously, described three kinds of hypotypes are six sites of poliovirus 1(), tri-sites of 2() and 3(2 site).

Other advantages of this test are to utilize same principle to extend further to comprise other site.This test is based on multiple reverse transcription PCR, virogene of poliomyelitis group RNA is transformed into cDNA and DNA cloning.Then PCR product is tested for multiple SNP.Use Genetic Analyzer to resolve SNP test product, to identify the Nucleotide (Fig. 1 to 3) in the attenuation site in virogene of poliomyelitis group.This test is applicable to a large amount of samples, and for test vaccine and on-the-spot isolate.This test method can be transformed into quantitative test.

the detailed content of test:

1. from various sources, obtain poliovirus samples (known serotype, for example, poliovirus 1,2 or 3).(from faecal samples separation 1,2 and 3 type polioviruses, from NIBSc.PK, obtaining oral polio virus vaccine (Sa Bin) strain).

2. use the synthetic cDNA of antisense PCR primer, and produce DNA cloning in single multiple reverse transcription and PCR reaction.

3. purified pcr product (DNA cloning son).

4. use " new primer " of the present invention to carry out multiple single nucleotide polymorphism and detect test [test for 1 type poliovirus at present comprises 6 primer pairs, and 2 types comprise 3 primer pairs, and 3 types comprise 2 primer pair polyads].

5. by the electrophoresis on Genetic Analyzer, resolve SNP, retrieve data, and use these data of Gene Mapper software analysis.

Novelty of the present invention and creative in new design of primers, for detect convenience and the specificity of multiple test of sudden change in all attenuations site and the test kit that comprises these Auele Specific Primers simultaneously, be intrinsic.In order to understand better the present invention, provide as follows further detailed content:

Table 1: most possible attenuation site in the genome of poliovirus

I. the design of primer: for detection of the new PCR primer of specific mutant

A. primer is than the short Nucleotide in attenuation site to be studied

B. designed 5 ' end tail of variable-length, and be combined in primer.

C. the genome sequence of cauda Duan Buyu primer target reaction (complementation).

D. design increases progressively the primer (base pair) of length, while making to resolve in Genetic Analyzer, first represent first attenuation site, and last site in the end with ascending order.

2, test method

A. this test can be identified the allelotrope of all nucleotide positions of target,, can detect the Nucleotide in all attenuations site in poliovirus 1,2 and 3 that is.

If b. should comprise novel site, can be in conjunction with other primers in a multiple test.

C. for three kinds of poliovirus serotypes, design different primer sets.

D. in a test, can study all attenuations site.

Table 2: for the preparation of the primer of DNA cloning of target specific regions

1-type

1.PV128-5′CATGGGACGCTAGTTGTGAA3′

2.PVI-IA-5'ATGAAACCTGAGCACCCAIT3'

3.Y7-5'GGGTTTGTGTCAGCCTGTAATGA3'

4.81-5'TGGGACGACTACACATGGCA3'

5DG53-5'TGGCTGCITATGGTGACAAT3'

6.DC21-5'TCA'GGTAATITCCACCACCA3'

7.PVI-J38-5'AAGTCATCGGGATGCATGIT3'

8，PV112A-5'CTGGCCAGCATAGTGGTCTA3'

2-type

1.PV23218-5'TGAGTCTGGACATTCCTCACC3'

2.PV2-575A.5′GTCACCATAAGCAGCCATGA3'

3.PV2-38308-5'CAACTGAGACGCAAACTGGA3'

4.PV2-3018A-5'AGAGGACGTCAGCCACGTAD'

3-type

I.PV3-285'ACGGGACGCTAGITGTGAAC3'

2.PV3-2A5'GCTCCCATTGTGACACTGAA3'

3.PV3-585'GAGCTCGCCGAGATAGACAC3'

4.PV3-5A5'AGATGAITGGAGGCCAAGAD'

Detailed content for the primer of SNP test is below provided:

SNP primer for 1-type (Sa guest virus)

Primer title: PV I IF-1, nucleotide position-480

Serial ID 1:

5'GACTGACTAATGCGGCTAATCCCAACCTCGG3′

Tm-67.6, GC-56.5%, length-31nt

Primer title: PVI_2F-I, nucleotide position-935

Serial ID 2:

5'GACTGACTGCCCATCAAGGATGTCCTGATAAAAACA3'Tm-66.4, GC-42.9%, length-36nt

Primer title: PVI_3F-1, nucleotide position-2438

Serial ID 3:

5'GACTGACTGACTGACTTGTAATGACTTCAGCGTGCGCTTG3'Tm-65.2, GC-50%, length-40nt

Primer title: PVI_4F-1, nucleotide position-2795

Serial ID 4:

5'GACTGACTGACTCAGCTTCCACCAAGAATAAGGATAAGCTATTT3'Tm-64.4, GC-37.5%, length-44nt

Primer title: PVI_5F-I, nucleotide position-2879

Serial ID 5:

5'GACTGACTGACTGACTGACTTTCACCTATTCTAGATTTGATATGGAA3'Tm-55 .7, GC-29.6%, length-47nt

Primer title: PVI_6F1, nucleotide position-6203

Serial ID 6:

5'GACTGACTGACTGACTGACTACGTGGGTAACAAAATTACTGAAGTGGATGAG3T m-66.3, GC-40.6%, length-52nt

SNP primer for (2-type poliomyelitis)

Primer title: PV2_2A, nucleotide position-481

Serial ID 7:

5'GACTGACTCGGCTAATCCTAACCACGGA3'

Tm-58.7, GC-55%, length-28nt

Primer title: PV2_28, nucleotide position-2908

Serial ID 8:

5'GACTGACTGACTTTTTGTGGTCACCTCAAACTAC3'

Tm-53.2, GC-40.9%, length-34nt

Primer title: PV2_2C, nucleotide position-2909

Serial ID 9:

5'GACTGACTGACTGACTTTTTGTGGTCACCTCAAACTACA3'Tm-56, GC-39%, length-39nt

SNP primer for (3-type poliomyelitis)

Primer title: PV3_3A, nucleotide position-472

Serial ID 10:

5'GACTGACTCCCCTGAATGCGGCTAAT3'

Tm-57.2, GC-55.6%, length-26nt

Primer title: PV3_38, nucleotide position-2034

Serial ID 11:

5'GACTGACTGACTGCTTGTCACTATCCCCAGCAT3'

Tm-57.8, GC-52.4%, length-33nt

According to one of them embodiment, in the present invention disclosed concrete test method can in a test, identify target all nucleotide positions allelotrope and study all attenuations site, therefore and can be used for identifying the Nucleotide in all attenuations site in poliovirus 1,2 and 3 genomes.If need to comprise new site, can be incorporated in a multiple test adding primer.This test method has been utilized the different primers group for these three kinds of poliovirus serotype designs.This test method is applicable to a large amount of samples, and can be for detection of vaccine and on-the-spot isolate.In addition, this test method can be transformed into quantitative test, and can extend to and comprise other mutational site.

Another embodiment of the invention relates to the PCR primer for detection of the mutation specific site in the genome of the derivative poliovirus of attenuation oral polio virus vaccine alive (Sa Bin) virus, vaccine sample and the vaccine of all three kinds of serotypes.This primer is characterised in that they have variation in its length, and is than the short Nucleotide in attenuation site to be studied.This primer has been designed to 5 ' the end tail in conjunction with variable-length, and the genome sequence of this cauda section and primer institute target is non-complementary.

Designed the primer that increases progressively length (base pair), while making to resolve, with ascending order, first represent first attenuation site, and last site in the end in Genetic Analyzer.

Another aspect more of the present invention relates to test kit, it contains above-mentioned primer, sudden change (nucleotide subsitution) for detection of the specific site in the genome of the derivative poliovirus of attenuation oral polio virus vaccine alive (Sa Bin) virus, vaccine sample and the vaccine of all three kinds of serotypes, comprises above-mentioned primer.This test kit further comprises deoxy-ribonucleoside triphosphate, polysaccharase, divalent cation and/or damping fluid.

Embodiment:

Following examples are of the present invention for illustrating, rather than are intended to limit the scope of the invention by any way.

Embodiment 1:

From the poliovirus of three kinds of serotypes, prepare DNA cloning

Obtain individually the poliovirus of each serotype (1,2 or 3 type).In single multiple reverse transcription and PCR reaction (Roche), use antisense PCR primer and DNA cloning to produce, from the synthetic poliovirus sample of freezing infection culture, cDNA.By PCR purification kit (Quagcn) purified pcr product (DNA cloning).

RT-PCR-analyzes for RT-PCR, directly obtains freezing infection culture (1fll) and the 67mM Tris/HCl(pH8.8 in 50fll cumulative volume), 17mM ammonium sulfate, 6mM EDTA, 2mM MgCh, every kind of dNTP of 200Mm, 1mM dithiothreitol (DTT), every kind of primer of 1mM, 10U placenta RNA enzyme inhibitors (Roche), 3U avian meloblastosis virus (AMV) reversed transcriptive enzyme (Roche) and 5U Taq archaeal dna polymerase (Roche Applied Science).Reaction is hatched 30 minutes at 50 ℃, then at 94 ℃, hatch 3 minutes.In 9700-type thermal cycler (Applied Biosystems), carried out 35 thermal cyclings, 94 ℃, 30s, 42 ℃, 30s, 72 ℃, 30s.After thermal cycling, then at 72 ℃, hatch 5 minutes.By electrophoresis in 10% polyacrylamide TBE gel, carry out analytical reaction product, and dye with 0.5flg Ethidum Eremide mrl.By QIA fast PCR purification kit (Qiagen), carry out purify DNA.

Embodiment 2:

Single nucleotide polymorphisms test (SNP test) for the identification of sudden change

Containing multiple reaction mixture (5lll), primer mixture (the 3lll) (final concentration used of SNaPshot, 0.15-0.6Ilmolll) and in the 10III final volume of template (2Ill), carried out 10 SNP reaction, described template is comprised of the above-mentioned multiple PCR products with QIAquick PCR purification kit (Qiagcn) purifying.By the multiple PCR products set from viral RNA amplification, and before SNaPshot reaction, purifying on identical pillar.Cycling program comprises 25 circulations, 96 ℃ of 10s, 50 ℃ of 5s and 60 ℃ of 30s.By hatch IS-minute with 1U shrimp alkaline phosphotase at 37 ℃, at 75 ℃, hatch IS-minute subsequently, make enzyme-deactivating carry out purifying extension products.The product of purifying (0.5Ill) is mixed with 9III methane amide and 0.5IIIGeneScan-120LIZ size standards (Applied Biosystems), and by capillary electrophoresis (ABI PRISM3130Genetic Analyzer; Applied Biosystems) separation.With GeneMapper3.0 software (Applied Biosystems) analytical results.

Design by this way SNP primer, make each primer than the short Nucleotide in attenuation site to be studied, and synthetic from Sigma.Design increases progressively the primer of length (base pair), make first to represent first attenuation site, and last site in the end.By SnaPshot test kit (Applied Biosystem), carry out multiple single nucleotide polymorphism and detected test.By Genetic Analyzer3130(Applied Biosystem) on capillary electrophoresis resolve SNP, and regain data, and by Gene Mapper software analysis.

Advantage of the present invention

1. can in a test, study all attenuations site, and detect the Nucleotide in all attenuations site in poliovirus 1,2 and 3 genomes.

2. this test method can detect the allelotrope (base of mixing) in all researchs site.

3. this test method can be identified the allelotrope of the nucleotide position of all targets.

4. this test comprises multiple reaction.

5. this test can operate a large amount of samples.

6. this test can be used for vaccine detection and the detection of on-the-spot isolate.

7. this test can be transformed into quantitative test.

8. this test can extend to and comprise other site.

Claims

1. for detect the sudden change of specific site or the test of SNP of genome of the poliovirus of three kinds of serotypes simultaneously, it comprises the following steps:

A. from various sources, obtain poliovirus sample,

B. by using the synthetic cDNA of antisense PCR primer, produce DNA cloning of the poliovirus of step a,

C. the DNA cloning of purification step b is sub,

D. use the PCR primer of SEQ ID I-II, carry out multiple single nucleotide polymorphism and detect test,

E. by electrophoresis, resolve SNP,

F. retrieve data, and use these data of Gene Mapper software analysis.

2. as desired for detect the sudden change of specific site or the test of SNP of genome of the poliovirus of three kinds of serotypes simultaneously in claim 1, wherein said virus is selected from 1-type poliovirus (Sa guest virus), 2-type poliovirus and 3-type poliovirus.

3. as desired for detect test specific locus mutation or SNP of genome of the poliovirus of three kinds of serotypes simultaneously in claim 1, SNP in wherein said primer sequence ID1 to 6 detection 1-type poliovirus (Sa guest virus), SNP in primer sequence ID7 to 9 detection 2-type poliovirus, primer sequence ID10 to II is for detection of the SWP in 3-type poliovirus.

4. as desired for detect the sudden change of specific site or the test of SNP of genome of the poliovirus of three kinds of serotypes simultaneously in claim 1, wherein said primer detects that the attenuation oral polio virus vaccine alives (Sa Bin) of three kinds of serotypes is viral, the SNP in vaccine sample and the derivative poliovirus of vaccine.

5. as desired for detect the sudden change of specific site or the test of SNP of genome of the poliovirus of three kinds of serotypes simultaneously in claim 1, wherein said primer has variation in its length.

6. as desired for detect the sudden change of specific site or the test of SNP of genome of the poliovirus of three kinds of serotypes simultaneously in claim 5, wherein the variation in primer is than the short Nucleotide in attenuation site to be studied.

7. the test requiring in claim any one as described above, wherein said primer has been designed to 5 ' the end tail in conjunction with variable-length.

8. the test requiring in claim any one as described above, wherein the Design of length primer to increase progressively, makes, when resolving, first represent first attenuation site, and last site in the end with ascending order in Genetic Analyzer.

9. as desired test in claim 1, wherein if comprise new site, can be incorporated in a multiple test adding primer.

10. for detection of the sudden change of specific site or the test kit of SNP in the genome of the derivative poliovirus of attenuation oral polio virus vaccine alive (Sa Bin) virus, vaccine sample and the vaccine of all three kinds of serotypes, the primer that wherein this test kit comprises described serial ID I to II.