CN103710348A - Aptamer AFB1-13 of Aflatoxin B1 and application of aptamer AFB1-13 - Google Patents

Abstract

The invention discloses an aptamer AFB1-13 of Aflatoxin B1 and application of the aptamer AFB1-13, belonging to nucleic acids. The aptamer AFB1-13 of the Aflatoxin B1 is prepared through screening with a compatible SELEX (systematic evolution of ligands by exponential enrichment) method based on agarose microsphere separation-flow cytometry. The aptamer AFB1-13 of the Aflatoxin B1 is rich in G basic groups, has a stem-loop structure, high affinity and good stability, is non-toxic, is easy for synthesis and marking, and can serve as a potential detection reagent in the Aflatoxin B1.

Description

AFB 1aptamer AFB 1-13 and application

Technical field

The present invention relates to a kind of nucleic acid, particularly relate to AFB ₁aptamer AFB ₁-13 and application.

Background technology

In the biotic pollution problem of oil and foodstuffs, the pollution of mycotoxins is one of topmost factor, and aflatoxin (Aflatoxins, AF) is toxicity and the strongest natural pollutant of carinogenicity of finding so far.Aflatoxin is the one group of similar secondary metabolite of chemical structure being produced by Aspergillus flavus and Aspergillus parasiticus bacterium etc., has the basic structure of two furan nucleuss and coumarin (tonka bean camphor), has found at present kind more than 20, mainly comprises B ₁, B ₂, G ₁, G ₂, M ₁and M ₂deng.Wherein, AFB ₁toxicity the strongest, amount is maximum, stability is also the highest, its toxicity is 10 times of potassium cyanide, 68 times of arsenic, Main Function, in organs such as livers, can bring out primary hepatocarcinoma, cancer of the stomach and lung cancer etc., and is a class carcinogens in the delimitation of 1993 cancer research mechanisms of the Nian Bei World Health Organization.AFB ₁extensively be present in soil and animals and plants, plant food especially, as peanut, corn, rice, wheat, milk and various nuts etc.AFB ₁physico-chemical property more stable, fat-soluble, heat-resisting, be difficult to detoxification, the health of humans and animals is produced to harm greatly.AFB ₁content is must examine index in international food health and Agricultural Products Trade, and many countries have all formulated the national standard of its allowance in food.Therefore, to AFB ₁carrying out effective, quick, highly sensitive detection has great importance.（1.Wogan,G.N.Chemical?nature?and?biological?effects?of?the?aflatoxins.Bacteriol?Rev1966,30,460-470;2.Shankaran,R.;Raj,H.G.;Venkitasubramanian,T.A.Biochemical?changes?in?liver?due?to?aflatoxin.Br?J?Exp?Pathol1970,51,487-491）。

At present, conventional AFB ₁detection method overview gets up to mainly contain chemical analysis and immunoassay.Chemical analysis mainly contains thin-layer chromatography chromatography (TLC), high performance liquid chromatography (HPLC) and microtrabeculae method etc., these conventional sense methods have possessed higher detection sensitivity and accuracy, but have that numerous and diverse sample pre-treatments, separation detection are consuming time, the expensive heaviness of plant and instrument and be difficult to realize on-the-spot real-time analysis, need the shortcomings such as professional and technical personnel.Immunoassay is mainly a series of immunological detection methods of high-affinity based on aspergillus flavus resisting toxin monoclone antibody and high specific development, enzyme-linked immunosorbent assay wherein (ELISA) is highly sensitive, security good, interference is few, easy and simple to handle quick, be the most general current practical AFB ₁detection method.But AFB ₁being a kind of hypertoxic small molecules, there is larger difficulty in the preparation of its antibody, and the reagent life-span, shorter being difficult to ensure deposited, and differences between batches are also larger etc., these Bottleneck Restrictions range of application and fast development (the 3.Jin Hwan Do of immunological detection method; Dong-Kug Choi.Aflatoxins:Detection, Toxicity, and Biosynthesis.Biotechnology and Bioprocess Engineering2007,12,585-593; 4.Liu Z.; Gao J..Advances in research on detection methods for aflatoxins.Journal of Anhui Agricultural University2004,31,223-226).Therefore, towards AFB ₁novel detection reagent and detection method urgently develop.

Aptamer (aptamer) is a class new type functional nucleic acid molecular probe, based on index concentration Fas lignand system evolution technology (SELEX) in-vitro screening from random oligonucleotide library, obtain, be described as " artificial antibody ", can be combined with target molecule high-affinity and high specific, have short, the convenient economy of chemosynthesis of screening cycle and high without lot size variance, stability, be easy to the plurality of advantages such as pinpoint modification, be potential antibody surrogate thing, at biochemical analysis detection field, demonstrate huge application prospect.At present, the identification based on aptamer and detection method become a kind of new blanket technology (5.Liu, J. gradually; Cao, Z.; Lu, Y.Functional nucleic acid sensors.Chem Rev2009,109,1948-1998; 6.Clark, S.L.; Remcho, V.T.Aptamers as analytical reagents.Electrophoresis2002,23,1335-1340).The biosensor that aptamer technology is applied to mycotoxins detection analysis is in active development development.For example, ochratoxin A (Ochratoxin A, OTA) and fumonisin B ₁(Fumonisin B ₁, FB ₁) etc. the aptamer of multiple mycotoxins screened; and developed multiple detection system (7.Screening and Initial Binding Assessment of Fumonisin B1Aptamers Int.J.Mol.Sci.2010; 11; 4864-4881.8.Determination of Ochratoxin A with a DNA Aptamer.J.Agric.Food Chem.2008; 56; 10456 – 10461.9.Yang, C.; Wang, Y.; Marty, J.; Yang, X.Aptamer-Based Colorimetric Biosensing of Ochratoxin A using Unmodified Gold Nanoparticles Indicator.Biosens.Bioelectron.2010.10.Kuang, H.; Chen, W.; Xu, D.; Xu, L.; Zhu, Y.; Liu, L.; Chu, H.; Peng, C.; Xu, C.; Zhu, S.Fabricated Aptamer-Based Electrochemical " signal-Off " Sensor of Ochratoxin A.Biosens.Bioelectron.2010,26,710 – 716).Therefore, screening AFB ₁specific nucleic acid fit and develop aptamer technology for AFB ₁new detecting method there is important Research Significance and market using value.

Summary of the invention

The first object of the present invention is to provide AFB ₁aptamer AFB ₁-13, the sterile S ELEX technology screening of this aptamer application based on Agarose microbead separation-flow cytometry obtains, can high-affinity identification AFB ₁.

The second object of the present invention is to provide AFB ₁aptamer AFB ₁-13 in preparing sample AFB ₁application in detection reagent.

Described AFB ₁aptamer AFB ₁-13, its sequence is as follows:

ATACCAGCTTATTCAATTGTGCAGGGGGAGGGGGAGTGGTGGCTCGCGGTGCGTGGTGGCTGTTAGATAGTAAGTG?CAATCT

Described AFB ₁aptamer AFB ₁-13, utilize its secondary structure of the online software simulation of OligoAnalyzer3.1, there is a kind of possible loop-stem structure, its loop-stem structure is as follows:

Described AFB ₁aptamer AFB ₁-13, with target molecule AFB ₁in conjunction with the mixture forming afterwards, there is fluorescence polarization response, and AFB ₁the fluorescence of itself can be by quencher, therefore based on fluorescence polarization technology or fluorescence spectrum method, described AFB ₁aptamer AFB ₁-13 can be used as AFB in sample ₁a kind of potential detection reagent.

The invention has the advantages that: 1) aptamer obtains by the sterile S ELEX technology screening based on Agarose microbead separation-flow cytometry, in-vitro screening and detect easy fast; 2) aptamer itself is one section of oligonucleotide, chemosynthesis in a large number, and without lot size variance, good stability, is easy to preserve; 3) aptamer energy high-affinity identification AFB ₁, can match in excellence or beauty with antibody; 4) aptamer is easy to pointed decoration mark, and application form is versatile and flexible, and AFB ₁for organic molecule, itself has photoluminescent property, and both character combine and can develop a series of biosensors, is detecting having a extensive future of analysis field.

Accompanying drawing explanation

Fig. 1 is AFB ₁the fluorescent microscope image of-beads.Figure a is the light field imaging of control group Control-beads, and figure b is sample sets AFB ₁the light field imaging of-beads, figure c is the fluorescence details in a play not acted out on stage, but told through dialogues imaging of control group Control-beads, figure d is sample sets AFB ₁the fluorescence details in a play not acted out on stage, but told through dialogues imaging of-beads.

Fig. 2 is AFB ₁the fluorescence spectrum scintigram of-beads.Curve a is sample sets AFB ₁-beads.Curve b is control group Control-beads.

Fig. 3 be in flow cytometry monitoring screening process the initial library of DNA for target molecule AFB ₁the fluorescence deflection graph of-beads enrichment.Curve a is blank AFB ₁-beads, curve b is the initial library of DNA, and curve c the 4th takes turns enrichment storehouse, and curve d the 6th takes turns enrichment storehouse, and curve e the 8th takes turns enrichment storehouse, and curve f is 11th round enrichment storehouse.

Fig. 4 be in flow cytometry monitoring screening process the initial library of DNA for the fluorescence deflection graph of anti-sieve element COOH-beads enrichment.Curve a is blank COOH-beads, and curve b is the initial library of DNA, and curve c the 4th takes turns enrichment storehouse, and curve d the 6th takes turns enrichment storehouse, and curve e the 8th takes turns enrichment storehouse, and curve f is 11th round enrichment storehouse.

Fig. 5 is Flow Cytometry Assay aptamer AFB ₁-13 couples of target molecule AFB ₁the binding curve figure of-beads.

Fig. 6 is AFB ₁with aptamer AFB ₁the fluorescence polarization response diagram of-13 combinations.A is the free AFB of blank group ₁, b is control group stochastic sequence Random, c is sample sets aptamer AFB ₁-13.

Fig. 7 is AFB ₁with aptamer AFB ₁the fluorescence spectrum scintigram of-13 combinations.Curve a is blank group AFB ₁, curve b is control group stochastic sequence Random, curve c is sample sets aptamer AFB ₁-13.

Embodiment

Embodiment 1 target AFB ₁synthetic and the sign of-beads

Using Agarose microbead as the solid phase carrier of target molecule, be conducive to separation not in conjunction with or weak binding and non-specific binding sequence, and be applicable to Flow cytometry.By AFB ₁the synthetic route that is coupled to Agarose microbead is specific as follows:

Get 7.6mg AFB ₁be dissolved in 4mL pyridine, add 35mg carboxymethyl hydroxylamine hydrochloride, 80 ℃ of backflows are spent the night, and through vacuum concentration and silica gel column chromatography (chloroform/methanol=10:1), isolate AFB ₁-oxime is also dissolved in 3mL anhydrous methylene chloride, adds 5.4mg NHS, 9.6mg dicyclohexylcarbodiimide and 5mg Dimethylamino pyridine, and magnet rotor stirs and to spend the night, and after filtration and evaporation concentration, obtains AFB ₁-oxime Acibenzolar (11.Chu, F.S.; Hsia, M.T.; Sun, P.S.:Preparation and characterization of aflatox-n B1-1-(O-carboxymethyl) oxime.Journal-Association of Official Analytical Chemists1977,60,791-4.).Get 0.107g NHS-beads and be dispersed in 900 μ L dipotassium hydrogen phosphate damping fluids (50mM, pH9.0), add 100 μ L quadrols, magnet rotor stirs and spends the night.The centrifugal supernatant that goes, and obtain NH with PB damping fluid (0.1M, pH8.0) cleaning microballon ₂-beads.By AFB ₁-oxime Acibenzolar is dissolved in 0.8mL DMF, NH ₂-beads is scattered in 0.8mL dipotassium hydrogen phosphate damping fluid (50mM, pH9.0), and both mix, and magnet rotor stirs and spends the night, and then with 50%DMF and PB buffer solution for cleaning microballon, obtains AFB ₁-beads, 4 ℃ keep in Dark Place.By fluorescence spectrum, scan (Ex:365nm; Em:380-600nm) and fluorescent microscope imaging to AFB ₁-beads characterizes (referring to Fig. 1 and 2).

Embodiment 2 AFBs ₁the fit screening of specific nucleic acid

(1) design of random oligonucleotide library is with synthetic

The random oligonucleotide library that designs and synthesizes two ends FX and be 18 Nucleotide, middle random area and be 45 Nucleotide is as follows: 5'-ATA CCA GCT TAT TCA ATT-N45-AGA TAG TAA GTG CAA TCT-3', storage capacity is 10 ¹⁵.The primer sequence is respectively forward primer (FP): 5'-ATA CCA GCT TAT TCA ATT-3'; reverse primer (RP): 5'-AGA TTG CAC TTA CTA TCT-3'; fluorescent dye primer (FFP): 5'-FAM-ATA CCA GCT TAT TCA ATT-3'; biotin labeling primer (BRP): 5'-Bio-AGA TTG CAC TTA CTA TCT-3'(12.Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z.C.; Chen, H.W.; Mallikaratchy, P.; Sefah, K.; Yang, C.J.; Tan, W.Aptamers evolved from live cells as effective molecular probes for cancer study.Proc Natl Acad Sci USA2006,103,11838-11843).

(2) screening of aptamer

AFB ₁-beads is as target molecule, and the COOH-beads that hydrolyzing N HS-beads forms is as anti-sieve element.

Get the initial library of 10nmol and be dissolved in 200 μ L binding buffer liquid (20mM Tris-HCl, pH8.0,100mM NaCl, 5mM KCl, 2mM MgCl ₂, 1mM CaCl ₂) in, 95 ℃ of 5min, ice bath 5min, room temperature 30min.200pmol is all used in inferior one-level library.Anti-sieve operation is from third round, by the library of denaturing treatment and 2 μ L COOH-beads incubated at room 5min.It filters collects liquid and 2 μ L AFB ₁-beads incubated at room 60min.Use binding buffer liquid to clean microballon, in connection with the AFB of DNA ₁-beads directly carries out PCR amplification and (uses FP and BRP, 94 ℃ of 3min; 94 ℃ of 15s; 50 ℃ of 15s; 72 ℃ of 15s; 72 ℃ of 3min), and adsorb and obtain single-chain nucleic acid library through the NaOH of 0.1M wash-out with streptavidin microballon, for next round, screening.Screening process increases proof strength by wheel, carries out altogether 11 and takes turns.By the enrichment condition (referring to Fig. 3 and 4) in Flow cytometry library.Finally enrichment is restrained to storehouse and carry out cloning and sequencing (13.Hu, J.; Wu, J.; Li, C.; Zhu, L.; Zhang, W.Y.; Kong, G.; Lu, Z.; Yang, C.J.A G-quadruplex aptamer inhibits the phosphatase activity of oncogenic protein Shp2in vitro.Chembiochem.2011,12,424-430).

The avidity of embodiment 3 aptamers characterizes

Aptamer molecule, at 5' end mark Fluoresceincarboxylic acid (FAM), is prepared to 0-7000nM gradient solution in 200 μ L binding buffer liquid, and thermally denature is processed, with 0.4 μ L AFB ₁-beads incubated at room 30min.After cleaning with binding buffer liquid, be suspended in binding buffer liquid, by cells were tested by flow cytometry bead surface fluorescence intensity.With fluorescence intensity, to the mapping of aptamer concentration, use formula Y=Bmax X/ (K _d+ X) carry out the combination dissociation constant K of the matching mensuration aptamer of binding curve _d(referring to Fig. 5).

Embodiment 4 fluorescence polarizations and fluorescence spectrum research aptamer and AFB ₁between interaction

With binding buffer liquid (20mM Tris-HCl, pH8.0,100mM NaCl, 5mM KCl, 2mM MgCl ₂, 1mM CaCl ₂) the unmarked aptamer solution of preparation 2 μ M, carry out thermally denature processing, 95 ℃ of 5min, ice bath 5min, room temperature is placed 30min.Then add wherein AFB ₁making its final concentration is 0.2 μ M, and at room temperature hatches 30min.Blank group is independent AFB under the same terms ₁solution, control group is stochastic sequence Random.Measure the fluorescence anisotropy value (Ex:365nm that respectively organizes solution system; Em:442nm); Each group solution system is carried out to fluorescence spectrum scanning (Ex:365nm; Em:380～650nm) (referring to Fig. 6 and 7).

Result

Embodiment 1 is according at AFB ₁on add a carboxyl, with NH ₂-beads carries out coupling and successfully synthesizes AFB by forming the basic ideas of stable amido linkage ₁-beads, and by fluorescent microscope imaging and fluorescent scanning spectrum, its pattern and coupling content are characterized.As shown in Figure 1, in details in a play not acted out on stage, but told through dialogues fluorescence imaging, with respect to not having through AFB ₁the Control-beads modifying, AFB ₁-beads sends obvious fluorescence; As shown in Figure 2, under 365nm UV-irradiation, AFB ₁-beads sends fluorescence at 425nm place, than the high 6 times of left and right of the fluorescent value of Control-beads.Hence one can see that, AFB ₁-beads coupling success.AFB on Agarose microbead ₁coupling content by measuring based on fluorescent scanning establishment of spectrum standard working curve, estimate the AFB for 4.5fmol ₁/ beads.

The sterile S ELEX technology screening of embodiment 2 based on Agarose microbead separation-flow cytometry successfully obtains can high-affinity identification AFB ₁aptamer.As shown in Figure 3, for just sieving target molecule AFB ₁-beads, initial storehouse does not have obvious fluorescence skew, substantially not with AFB ₁-beads combination, along with the increase of screening wheel number, the 4th, 6,8, the 11 fluorescence skews of taking turns enrichment storehouse increase gradually, and the fluorescence skew intensity in 11th round enrichment storehouse reaches 300 times of initial storehouse, illustrates in enrichment storehouse and AFB ₁the sequence of-beads combination is enrichment gradually in screening process; As shown in Figure 4, for anti-sieve element COOH-beads, enrichment storehouse is taken turns in initial storehouse, the 4th, 6,8,11 does not all have obvious fluorescence skew, is not combined with COOH-beads.Explanation screens from random oligonucleotide library that enrichment has obtained and AFB ₁the nucleotide sequence of-beads combination, therefore sends to cloning and sequencing by 11th round enrichment storehouse.

Embodiment 3 by Flow Cytometry Assay aptamer to target molecule AFB ₁the binding ability of-beads.As shown in Figure 5, AFB ₁aptamer AFB ₁-13 combination dissociation constant K _dbe 1.41 ± 0.04 μ M, there is higher avidity.

Embodiment 4 has studied aptamer and target molecule AFB by fluorescence polarization assay and fluorescence spectrum scanning analysis ₁between binding interactions, thereby verified that described aptamer can be used as AFB in sample ₁a kind of potential detection reagent.As shown in Figure 6, there is not aptamer AFB ₁-13 o'clock, AFB freely ₁owing to itself being organic molecule, molecular weight is only 312.27g/mol, rotates very soon, records its fluorescence anisotropy value and is about 0.013; As aptamer AFB ₁-13 when exist, and records its fluorescence anisotropy value and be increased to and be about 0.050; And when contrast stochastic sequence Random exists, its fluorescence anisotropy value is about 0.016, is not significantly increased.Described aptamer and target molecule AFB are described thus ₁between specific combination interact.As shown in Figure 7, under buffer system condition used, AFB ₁under UV-light 365nm irradiates, at 442nm place emitting fluorescence; As aptamer AFB ₁-13 when exist, and the reduction of highly significant has appearred in its maximum emission wavelength place fluorescent value; And when contrast stochastic sequence Random exists, corresponding fluorescent value is only in a slight decrease.Aptamer and target molecule AFB are stated in explanation thus ₁in conjunction with after, quenching of fluorescence.

Claims (3)

1. AFB ₁aptamer AFB ₁-13, it is characterized in that its sequence is as follows:

ATACCAGCTTATTCAATTGTGCAGGGGGAGGGGGAGTGGTGGCTCGCGGTGCGTGGTGGCTGTTAGATAGTAAGTG?CAATCT。

2. AFB as claimed in claim 1 ₁aptamer AFB ₁-13, it is characterized in that it has a kind of possible loop-stem structure.

3. AFB as claimed in claim 1 ₁aptamer AFB ₁-13 in preparing sample AFB ₁application in detection reagent.

Images