CN103695555A

CN103695555A - Fluorescent genotyping detection kit and detection method for eight K-ras gene mutations

Info

Publication number: CN103695555A
Application number: CN201310732595.5A
Authority: CN
Inventors: 吴舒歌; 吴大治; 夏懿
Original assignee: Shanghai Fosun Pharmaceutical Group Co Ltd; Shanghai Xingyao Medical Technology Development Co Ltd
Current assignee: Shanghai Fosun Pharmaceutical Group Co Ltd; Shanghai Xingyao Medical Technology Development Co Ltd
Priority date: 2013-12-25
Filing date: 2013-12-25
Publication date: 2014-04-02

Abstract

The invention belongs to the field of biotechnology and clinical molecular diagnosis and in particular relates to a fluorescent genotyping detection kit and a detection method for eight human K-ras gene mutations. According to the method, an MGB (minor groove binder) probe technology is combined with a mismatch ARMS (amplification refractory mutation system) technology, an MGB probe complementary with a DNA (deoxyribonucleic acid) plus strand and an ARMS downstream primer complementary with a DNA minus strand are designed at allelic gene loci, a mismatch locus is introduced in the ARMS downstream primer, the MGB probe is overlapped with the ARMS primer by not more than 5 bp, and the eight human K-ras gene mutations are subjected to genotyping detection by four reaction pipes based on multiple fluorescent PCR (polymerase chain reaction). The method has the advantages of good specificity, high sensitivity, simplicity and quickness for operation, accuracy for genotyping, simplicity for result interpretation and the like, and can be used for detecting the clinical K-ras gene mutations and helping doctors screen the crowed with effective anti-EGFR (epidermal growth factor receptor) treatment.

Description

8 kinds of sudden change fluorescence parting detecting reagents of K-ras gene and detection method

Technical field

The invention belongs to biotechnology and clinical molecular diagnosis field, relate in particular to 8 kinds of mutation detection kits of a kind of mankind K-ras gene and detection method.

Background technology

K-ras gene is a kind of in RAS gene family, is positioned on the mankind's No. 12 karyomit(e)s, and be a kind of proto-oncogene, very large on human cancer impact.The ras albumen that K-ras gene coding molecule amount is 21kD has another name called p21 albumen, and p21 albumen is positioned at the internal surface of cytolemma, has GTP enzymic activity, participates in intracellular signal conduction, is activated state during in conjunction with GTP, is inactivation state during in conjunction with GDP.K-ras gene seems molecular switch in body, it plays important regulating and controlling effect in the signal transduction pathway of the processes such as growth of tumour cell and vasculogenesis, normal K-ras gene can be grown by inhibition tumor cell, but occur can forever to activate by induced gene when abnormal, make Cellular Signaling Transduction Mediated disorderly, uncontrolled cellular proliferation and canceration.The mode that K-ras gene is activated has 3 kinds: point mutation, gene great expression, gene insert and transposition.Wherein point mutation is the most common, mostly occurs on No. 12 codons and No. 13 codons of 2 exons, and codon 61,63,117,119 and 146 is more rare.

K-ras gene is one of important gene marker of the neoplasm targeted therapy medicine of confirmation at present, and K-ras transgenation is one of important factor of prediction EGFR tyrosine kinase inhibitor (EGFR-TK1) and the opposing of EGF-R ELISA (EGFR) monoclonal antibody (Victibix and Cetuximab) targeted therapy.In EGFR signal path, K-ras and catchment small molecular G protein thereof are one of elements of this signal path.After K-ras transgenation, can make this path abnormal activation, not be subject to the impact of EGFR stream signal instruction.Now, EGFR monoclonal antibody is combined with surface of cell membrane EGFR, though blocked the biography down of signal path, after K-ras transgenation, autophosphorylation can occur, and resists the effect of EGFR monoclonal antibody, thereby EGFR monoclonal antibody medicine is failed to respond to any medical treatment.Therefore, use the treatment of EGFR targeted drug must carry out K-ras detection in Gene Mutation before, according to the suitable medicine of patient's transgenation condition selecting, improve the specific aim for the treatment of, farthest extend patient's lifetime.

At present, the detection about K-ras transgenation has obtained clinical approval and use in colorectal cancer and lung cancer therapy.Issued clinical study result the earliest in June, 2008 in American Society of Clinical Oncology (ASCO) annual meeting, and K-ras saltant type patient can not benefit from anti-EGFR treatment, increases on foot on the contrary untoward reaction danger and medical expense; And K-ras wild-type patient just probably benefits from this class pharmacological agent.In October in the same year, K-ras detection in Gene Mutation is written into latest edition (2008 the 3rd edition) the state-run cancer integrated network of the < < U.S. (NCCN) colorectal cancer clinical practice guideline > >.This guide explicitly points out all metastatic colorectal cancer patients all should detect K-ras gene appearance, and only has K-ras wild-type patient just to advise accepting EGFR inhibitor (as Cetuximab and Victibix) treatment.In addition, 09 year NCCN nonsmall-cell lung cancer clinical practice guideline > > of < < explicitly points out: if there is sudden change when K-ras gene, do not advise that patient uses Erlotinib (Tarceva) to carry out molecular targeted therapy, K-ras transgenation is relevant to the primary drug resistance of the target therapeutic agents such as Gefitinib, Erlotinib with nonsmall-cell lung cancer (NSCLC).Therefore before tumour patient is accepted the treatment of EGFR targeted drug, must carry out K-ras detection in Gene Mutation, according to detected result, determine whether use EGFR targeted drug as clinical treatment measure, to improve the specific aim of clinical therapy of tumor, reduce medical expense, save valuable treatment time.

The method of at present conventional K-ras point mutation detection has DNA direct sequencing, single-strand conformation polymorphism analysis method (PCR-SSCP), restriction fragment length polymorphism analytical method (PCR-PFLP), high resolution solubility curve (HRM), gene chip, Luminex, fluorescence quantitative PCR method etc.Sequencing is the gold standard of generally acknowledged detection in Gene Mutation, can show exactly the concrete mutation type that may exist, but sequencing equipment cost used is high, detection time, slightly length, complex operation, sensitivity were lower, and result interpretation is more complicated, operator is had relatively high expectations, be difficult to form business-like diagnostic products.Single-strand conformation polymorphism analysis and restriction fragment length polymorphism analytical procedure is various, sensitivity is low, and detected result often needs sequencing to confirm, neither be applicable to the simple and effective method of clinical detection.High resolution solubility curve is a kind of new tool that detects transgenation, carries out gene type and SNP detection of rising in recent years, can detect rapidly the sudden change of single base in nucleic acid fragment.But the method is difficult to examination homozygous mutation, and false positive false negative is higher, and PCR condition is harsh, can not somatotype, and also detected result needs sequencing to confirm.Though gene chip and liquid-phase chip can accurately be distinguished concrete mutation type, but it is high to equipment requirements, is difficult to large-scale promotion, is used for R&D institution.

Fluorescence quantitative PCR method is the most widely used a kind of detection means of molecular diagnosis field, and the method is highly sensitive, easy and simple to handle, is applicable to large-scale clinical application.Conventional fluorescent probe type has Taqman probe, MGB probe, Allglo probe etc., and wherein Taqman probe application is the widest.Taqman probe is at the two ends of a probe oligonucleotides report fluorophor of difference mark and a cancellation fluorophor, when probe is complete, the fluorescent signal of reporter group transmitting is quenched group and absorbs, during pcr amplification, 5 ' end-3 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded by probe enzyme, make to report that fluorophor is separated with cancellation fluorophor and send fluorescence, by the variation of monitoring fluorescent signal, embody the variation of PCR product amount.MGB probe principle of work and Taqman probe are similar, but 3 ' end quenching of MGB probe goes out, fluorophor is non-luminous MGB(minor groove binder).MGB probe is compared and is had the following advantages with Taqman probe: (1) improves signal to noise ratio: without background fluorescence, have better cancellation effect; (2) improve the Tm value of probe: probe shorter (13-20bp), is adapted to more multiple PCR.Therefore MGB probe has the ability of distinguishing single base mutation, than Taqman probe, is more suitable for detection base mutation.Allglo probe is another probe type that can improve probe Tm value, shortening probe sequence, the fluorescence dye of mark report each other and essence group that goes out mutually on oligo on its probe, it is the fluorescent quantitation probe of new generation that U.S. AlleLogic Biosciences company releases, but Allglo probe synthetic producer is at home very limited, during large-scale application, be difficult to guarantee the popularity in starting material source.

Sudden change amplification retarding system (amplification refractory mutation system, ARMS) is also allele-specific PCR, and this method develops and forms on PCR basis, is a kind of round pcr that is directly used in point mutation analysis.Because primer extension in PCR process is that 3 ' end starts, so the extension of the base pair primer of 3 ' end is in vital position.Around this principle, sudden change and that base of normal allele difference are arranged in to primer 3 ' least significant end, when reaction is carried out, if primer 3 ' terminal bases and template DNA sequences match, can increase, if do not mated, chain extension reaction will be obstructed because 3 ', 5 '-phosphodiester bond forms obstacle, thereby reach to distinguish, detects allelic object.At present, domestic Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. is exactly the ADx-ARMS patented technology of having developed independent intellectual property right on the basis of ARMS technology, and successfully developed corresponding test kit and carried out K-ras detection in Gene Mutation, but the said firm's test kit is expensive, and detect 7 kinds of sudden changes and need to divide 7 pipes to detect, need the tumor sample of more amount.

Therefore, be necessary to provide a kind of improved method to carry out quick, accurate, cost-effective detection to K-ras transgenation.

Summary of the invention

Although ARMS technology is widely used in tumour individuation Molecular Detection field, if but it is very large non-specific only to come recognition allele to have with the difference of a base of primer 3 ' end in implementation process, easily produce false positive results, and specificity is not strong while detecting ARMS primer with general probe, has improved yet and has produced false-positive probability.Therefore this test kit improves on this basis: (1) primer and probe all design in allelotrope site, but guarantees overlapping 5 bp that are no more than of type specificity probe and type specificity primer; (3) type specificity probe uses MGB probe, can shorten probe length, improves detection specificity, and MGB probe and allelotrope site DNA normal chain are complementary; (3) upstream primer is used universal primer during pcr amplification, downstream primer is used ARMS primer, ARMS downstream primer and allelotrope site DNA minus strand are complementary, and improve at base mismatch of the artificial introducing in the position of ARMS primer 3 ' end the reciprocal the 2nd or the 3rd specificity detecting; (4) use multiple fluorescence PCR technology, minutes 4 reaction tubess to mankind K-ras gene 8 kinds of sudden changes carry out somatotype detection.Each PCR reaction tubes, when detecting wild type gene contrast, can also detect two kinds of mutated genes, has reduced reaction tubes number.Detection method after improving can be carried out somatotype detection to K-ras transgenation quickly and accurately, and specificity is good, highly sensitive, and result interpretation is convenient, and economical and practical, can be in clinical application large-scale promotion.

Test kit provided by the invention comprises: mark probe and wild-type downstream primer in PCR mixed reaction solution, allele-specific MGB probe, general upstream primer, ARMS downstream primer, wild-type, and positive reference substance.PCR mixed reaction solution of the present invention comprises PCR Buffer, UNG enzyme, Taq DNA polysaccharase, MgCl ₂, dNTPs.

Test kit provided by the invention can complete 8 kinds of sudden change somatotypes of K-ras gene and detect in 4 pipes, on the basis that guarantees accurately typing, reduces reaction tubes number, saves sample.Reaction tubes A detects codon 12 GGT > GAT and 12 GGT > AGT replacement mutations; Reaction tubes B detects codon 12GGT > GTT and 12 GGT > GCT replacement mutations; Reaction tubes C detects codon 12 GGT > TGT and 12 GGT > CGT replacement mutations; Reaction tubes D detects codon 13 GGC > GAC and 13 GGC > CGC replacement mutations.

Test kit provided by the invention uses technical project specificity MGB probe, general upstream primer and the ARMS downstream primer of allele-specific probe and allele-specific primers amplification, described specificity MGB probe is preferably connected with fluorescence radiation group at 5 ' end, and 3 ' end is connected with fluorescent quenching group.Described fluorescence radiation group is FAM or VIC, and described fluorescent quenching group is MGB.Particularly, described specificity MGB probe sequence is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8; The sequence of described general upstream primer is as shown in SEQ ID NO:9; Described ARMS downstream primer sequence is as shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17.Concrete sequence is as follows:

SEQ ID NO:1:5 '-FAM-AGTTGGAGCTGATG-BHQ-3 ' (detecting 12 GGT > GAT replacement mutations)

SEQ ID NO:2:5 '-VIC-TAGTTGGAGCTAGT-BHQ-3 ' (detecting 12 GGT > AGT replacement mutations)

SEQ ID NO:3:5 '-FAM-TTGGAGCTGTTGG-BHQ-3 ' (detecting 12 GGT > GTT replacement mutations)

SEQ ID NO:4:5 '-VIC-AGTTGGAGCTGCTG-BHQ-3 ' (detecting 12 GGT > GCT replacement mutations)

SEQ ID NO:5:5 '-FAM-AGTTGGAGCTTGTG-BHQ-3 ' (detecting 12 GGT > TGT replacement mutations)

SEQ ID NO:6:5 '-VIC-AGTTGGAGCTCGTG-BHQ-3 ' (detecting 12 GGT > CGT replacement mutations)

SEQ ID NO:7:5 '-FAM-TTGGAGCTGGTGAC-BHQ-3 ' (detecting 13 GGC > GAC replacement mutations)

SEQ ID NO:8:5 '-VIC-TGGAGCTGGTCGC-BHQ-3 ' (detecting 13 GGC > CGC replacement mutations)

SEQ ID NO:9：5’- TTATAAGGCCTGCTGAAAATGACTGA -3’

SEQ ID NO:10:5 '-GCACTCTTGCCTACGCTAT-3 ' (detecting 12 GGT > GAT replacement mutations)

SEQ ID NO:11:5 '-CACTCTTGCCTACGCCTCT-3 ' (detecting 12 GGT > AGT replacement mutations)

SEQ ID NO:12:5 '-GCACTCTTGCCTACGCGAA-3 ' (detecting 12 GGT > GTT replacement mutations)

SEQ ID NO:13:5 '-CACTCTTGCCTACGCCAG-3 ' (detecting 12 GGT > GCT replacement mutations)

SEQ ID NO:14:5 '-CACTCTTGCCTACGCCGCA-3 ' (detecting 12 GGT > TGT replacement mutations)

SEQ ID NO:15:5 '-GCACTCTTGCCTACGCCACG-3 ' (detecting 12 GGT > CGT replacement mutations)

SEQ ID NO:16:5 '-AAGGCACTCTTGCCTACCT-3 ' (detecting 13 GGC > GAC replacement mutations)

SEQ ID NO:17:5 '-CAAGGCACTCTTGCCTACTCG-3 ' (detecting 13 GGC > CGC replacement mutations)

Test kit provided by the invention also comprises that wild-type interior mark probe and wild-type downstream primer are as internal reference.In described wild-type, mark probe is MGB probe, preferably at 5 ' end, is connected with fluorescence radiation group, and 3 ' end is connected with fluorescent quenching group.Described fluorescence radiation group is NED, and described fluorescent quenching group is MGB.In described wild-type, mark probe and wild-type downstream primer sequence are as shown in SEQ ID NO:18, SEQ ID NO:19.

SEQ ID NO:18：5’-NED-TTGGAGCTGGTGGC-BHQ-3’

SEQ ID NO:19：5’- GCACTCTTGCCTACGCCAC -3’

When described MGB probe comprises one or more in the sequence as shown in SEQ ID NO:1 and SEQ ID NO:2, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > GAT and 12 GGT > AGT replacement mutations.

When described MGB probe comprises one or more in the sequence as shown in SEQ ID NO:3 and SEQ ID NO:4, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > GTT and 12 GGT > GCT replacement mutations.

When described MGB probe comprises one or more in the sequence as shown in SEQ ID NO:5 and SEQ ID NO:6, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > TGT and 12 GGT > CGT replacement mutations.

When described MGB probe comprises one or more in the sequence as shown in SEQ ID NO:7 and SEQ ID NO:8, described positive reference substance is the mixing plasmid DNA that has codon 13 GGC > GAC and 13 GGC > CGC replacement mutations.

Second object of the present invention is to provide a kind of method that K-ras transgenation fluorescence somatotype detects.The method is specifically first for the allelotrope site design of K-ras transgenation place and the specificity MGB probe of DNA normal chain complementation, then in allelotrope site, design the ARMS downstream primer with the complementation of DNA minus strand, and guarantee probe and the overlapping 5bp that is no more than of primer, design again subsequently general upstream primer and internal reference primer and probe.In reaction system, add PCR mixed reaction solution, allele-specific MGB probe, general upstream primer, ARMS downstream primer, wild-type interior mark probe and wild-type downstream primer to carry out the detection of quantitative fluorescent PCR.

Described allele-specific MGB probe comprises one or more as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 sequence;

The sequence of described general upstream primer is as shown in SEQ ID NO:9;

The sequence of described ARMS downstream primer comprises one or more shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 sequence;

In described wild-type, the sequence of mark probe and wild-type downstream primer is as shown in SEQ ID NO:18, SEQ ID NO:19.

The invention provides a kind of method that K-ras transgenation fluorescence somatotype detects, its advantage is to adopt allele-specific probe and other allelotrope of primer pair different shaped to carry out augmentation detection.The fluorescence labeling probe adopting in the inventive method is allele-specific MGB probe, has shortened probe sequence, has improved detection specificity.Different from ARMS upstream primer conventionally used in addition, in the present invention by mispairing ARMS design of primers in downstream, at the equal designing probe in allelotrope site and primer, wherein MGB probe and allelotrope site DNA normal chain are complementary, ARMS primer and allelotrope site DNA minus strand are complementary, and guarantee probe and the overlapping 5bp that is no more than of primer.Detection kit of the present invention and detection method have the following advantages: the detection technique that (1) adopts specific probe to combine with Auele Specific Primer, and highly sensitive, specificity is good, can effectively stop non-specific amplification, accurately detects 8 kinds of sudden changes of K-ras gene; (2) adopt multiple fluorescence PCR detection technique, reduce reaction tubes number, save sample, economical and practical; (3) omnidistance stopped pipe operation, and add interior mark system and UNG enzyme anti-pollution system, can carry out more accurately and efficiently somatotype detection, guarantee that real result is credible; (4) simple to operate testing process only needs 90min to complete, and result interpretation is simple fast, is convenient to analyze; (5) be applicable to the application of clinical K-ras detection in Gene Mutation, for individual patients medication provides scientific basis, reduce Operative risk and patient burden.

Embodiment

For making the present invention easier to understand, the K-ras detection in Gene Mutation in colorectal cancer paraffin section DNA of take below illustrates the embodiment of this test kit as example.

Embodiment 1: the extraction of genomic dna

Collection Clinicopathologic Diagnosis is colorectal cancer (CRC) patient's paraffin-embedded tissue section, with the REPLI-g FFPE Kit test kit of Qiagen company, extract sample genomic dna, and by concentration and the purity of the nucleic acid of NanoDrop 1000 nucleic acid-protein determinator Detection and Extraction.

Embodiment 2: the design of primer, probe

Design and screen specificity MGB probe, ARMS primer, universal primer and internal reference primer and the probe of 8 kinds of sudden changes of energy specific detection K-ras gene.8 kinds of sudden changes of K-ras gene are respectively: the replacement mutation of codon 12 GGT > GAT, 12 GGT > AGT, 12 GGT > GTT, 12 GGT > GCT, 12 GGT > TGT, 12 GGT > CGT, 13 GGC > GAC and 13 GGC > CGC.Allele-specific MGB probe sequence is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8; General upstream primer sequence is as shown in SEQ ID NO:9; ARMS downstream primer sequence is as shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17; Wild-type internal reference probe sequence is as shown in SEQ ID NO:18; Wild-type internal reference primer sequence is as shown in SEQ ID NO:19.

Embodiment 3: the optimization of reaction system

(1) optimization of primer concentration: the in the situation that other condition being identical in reaction system, primer concentration is done to multiple proportions serial dilution from 200 nM to 800 nM respectively, by the analysis of test-results is relatively determined to best primer concentration is 600 nM.

(2) optimization of concentration and probe concentration: the in the situation that other condition being identical in reaction system, concentration and probe concentration is done to multiple proportions serial dilution from 100 nM to 300 nM respectively, by the analysis of test-results is relatively determined to best concentration and probe concentration is 200 nM.

(3) optimization of MgCl2 concentration: the in the situation that other condition being identical in reaction system, MgCl2 concentration is done to multiple proportions serial dilution from 2 mM to 5 mM, by the analysis of test-results is relatively determined to best MgCl2 concentration is 3 mM.

(4) optimization of Taq DNA polysaccharase: add various enzymes in reaction system, by the analysis comparison to test-results, determine that best enzyme is GoldStar Taq DNA Polymerase.

Reaction system through optimizing is 30 μ l, and each composition of PCR reaction solution consists of: PCR buffer(1 *), Taq archaeal dna polymerase (1 U), UNG enzyme (0.2 U), dNTPs(250 nM), MgCl2(3 mM), MGB probe (200 nM), primer (600 nM), template DNA (10-100 ng).

Each sample carries out 4 tube reactions, every tube reaction adds common PCR reaction mixture, general upstream primer, wild-type internal reference primer and probe, then in reaction tubes A, add the MGB probe and the downstream ARMS primer that detect codon 12 GGT > GAT and 12 GGT > AGT replacement mutations, in reaction tubes B, add the MGB probe and the downstream ARMS primer that detect codon 12 GGT > GTT and 12 GGT > GCT replacement mutations, in reaction tubes C, add the MGB probe and the downstream ARMS primer that detect codon 12 GGT > TGT and 12 GGT > CGT replacement mutations, in reaction tubes D, add the MGB probe and the downstream ARMS primer that detect codon 13 GGC > GAC and 13 GGC > CGC replacement mutations.After configuring PCR reaction solution, add the genomic dna template of having extracted, each experiment must comprise positive control and negative control.Configured rear vortex and mixed, centrifugal and upper machine testing.

Embodiment 4: the optimization of response procedures

(1) optimization of annealing temperature: the in the situation that other condition being identical in reaction system, carry out grads PCR, annealing temperature is respectively 58 ℃ to 63 ℃, by relatively determining that to the analysis of test-results optimum annealing temperature is 60 ℃.

(2) optimization of annealing time: the in the situation that other condition being identical in reaction system, annealing time is respectively 45 s to 90 s, by relatively determining that to the analysis of test-results optimum annealing temperature is 45 s.

Response procedures through optimizing is: 50 ℃, and 2 min; 95 ℃, 10 min; Next be 40 circulations: 95 ℃, 15 s; 60 ℃, 45s (collection fluorescence).During upper machine testing, at FAM, VIC, NED fluorescence channel, detect fluorescent signal respectively.

Embodiment 5: result interpretation

After reaction finishes, with the quantitative fluorescent PCR software that instrument is supporting, this experimental result is analyzed.Under normal circumstances, each fluorescence channel of negative control (FAM, VIC, NED) is all without amplification, and each fluorescence channel of positive control (FAM, VIC, NED) all has amplification, internal reference passage (NED) Ying Junyou amplification in reaction tubes A, B, C, D.In reaction tubes A, B, C, D, NED passage is to detect K-ras gene wild-type, if when in tested sample, K-ras gene all suddenlys change, this fluorescence channel is without amplification.

If the FAM passage of reaction tubes A occurs amplification and shows that this sample has 12 GGT > GAT replacement mutations, if appearring in the VIC passage of reaction tubes A, amplification shows that this sample has 12 GGT > AGT replacement mutations;

If the FAM passage of reaction tubes B occurs amplification and shows that this sample has 12 GGT > GTT replacement mutations, if appearring in the VIC passage of reaction tubes B, amplification shows that this sample has 12 GGT > GCT replacement mutations;

If the FAM passage of reaction tubes C occurs amplification and shows that this sample has 12 GGT > TGT replacement mutations, if appearring in the VIC passage of reaction tubes C, amplification shows that this sample has 12 GGT > CGT replacement mutations;

If the FAM passage of reaction tubes D occurs amplification and shows that this sample has 13 GGC>GAC replacement mutations, if appearring in the VIC passage of reaction tubes D, amplification shows that this sample has 13 GGC > CGC replacement mutations.

Sequence table

The upper starfish credit of <110> medical science and technology Development Co., Ltd

8 kinds of sudden change fluorescence parting detecting reagents of <120> K-ras gene and detection method

<130> 19

<160> 19

<170> PatentIn version 3.3

<210> 1

<211> 14

<212> DNA

<213> artificial sequence

<400> 1

agttggagct gatg 14

<210> 2

<211> 14

<212> DNA

<213> artificial sequence

<400> 2

tagttggagc tagt 14

<210> 3

<211> 13

<212> DNA

<213> artificial sequence

<400> 3

ttggagctgt tgg 13

<210> 4

<211> 14

<212> DNA

<213> artificial sequence

<400> 4

agttggagct gctg 14

<210> 5

<211> 14

<212> DNA

<213> artificial sequence

<400> 5

agttggagct tgtg 14

<210> 6

<211> 14

<212> DNA

<213> artificial sequence

<400> 6

agttggagct cgtg 14

<210> 7

<211> 14

<212> DNA

<213> artificial sequence

<400> 7

ttggagctgg tgac 14

<210> 8

<211> 13

<212> DNA

<213> artificial sequence

<400> 8

tggagctggt cgc 13

<210> 9

<211> 26

<212> DNA

<213> artificial sequence

<400> 9

ttataaggcc tgctgaaaat gactga 26

<210> 10

<211> 19

<212> DNA

<213> artificial sequence

<400> 10

gcactcttgc ctacgctat 19

<210> 11

<211> 19

<212> DNA

<213> artificial sequence

<400> 11

cactcttgcc tacgcctct 19

<210> 12

<211> 19

<212> DNA

<213> artificial sequence

<400> 12

gcactcttgc ctacgcgaa 19

<210> 13

<211> 18

<212> DNA

<213> artificial sequence

<400> 13

cactcttgcc tacgccag 18

<210> 14

<211> 19

<212> DNA

<213> artificial sequence

<400> 14

cactcttgcc tacgccgca 19

<210> 15

<211> 20

<212> DNA

<213> artificial sequence

<400> 15

gcactcttgc ctacgccacg 20

<210> 16

<211> 19

<212> DNA

<213> artificial sequence

<400> 16

aaggcactct tgcctacct 19

<210> 17

<211> 21

<212> DNA

<213> artificial sequence

<400> 17

caaggcactc ttgcctactc g 21

<210> 18

<211> 14

<212> DNA

<213> artificial sequence

<400> 18

ttggagctgg tggc 14

<210> 19

<211> 19

<212> DNA

<213> artificial sequence

<400> 19

gcactcttgc ctacgccac 19

Claims

1. 8 kinds of sudden change fluorescence parting detecting reagents of a mankind K-ras gene, this test kit comprises mark probe and wild-type downstream primer in PCR mixed reaction solution, allele-specific MGB probe, general upstream primer, ARMS downstream primer, wild-type, and positive reference substance.

2. 8 kinds of sudden change fluorescence parting detecting reagents of mankind K-ras gene according to claim 1, is characterized in that: in described PCR mixed reaction solution, contain PCR Buffer, UNG enzyme, Taq archaeal dna polymerase, MgCl ₂, dNTPs.

3. 8 kinds of sudden change fluorescence parting detecting reagents of mankind K-ras gene according to claim 1, is characterized in that: described allele-specific MGB probe sequence is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8.

4. 8 kinds of sudden change fluorescence parting detecting reagents of mankind K-ras gene according to claim 1, is characterized in that: described general upstream primer sequence is as shown in SEQ ID NO:9; Described ARMS downstream primer sequence is as shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17.

5. 8 kinds of sudden change fluorescence parting detecting reagents of mankind K-ras gene according to claim 1, is characterized in that: in described wild-type, mark probe sequence is as shown in SEQ ID NO:18; Described wild-type downstream primer sequence is as shown in SEQ ID NO:19.

6. 8 kinds of mankind K-ras genes according to claim 1 sudden change fluorescence parting detecting reagents, it is characterized in that: when described allele-specific MGB probe comprises one or more in the sequence as shown in SEQ ID NO:1 and SEQ ID NO:2, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > GAT and 12 GGT > AGT replacement mutations.

7. 8 kinds of mankind K-ras genes according to claim 1 sudden change fluorescence parting detecting reagents, it is characterized in that: when described allele-specific MGB probe comprises one or more in the sequence as shown in SEQ ID NO:3 and SEQ ID NO:4, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > GTT and 12 GGT > GCT replacement mutations.

8. 8 kinds of mankind K-ras genes according to claim 1 sudden change fluorescence parting detecting reagents, it is characterized in that: when described allele-specific MGB probe comprises one or more in the sequence as shown in SEQ ID NO:5 and SEQ ID NO:6, described positive reference substance is the mixing plasmid DNA that has codon 12 GGT > TGT and 12 GGT > CGT replacement mutations.

9. 8 kinds of mankind K-ras genes according to claim 1 sudden change fluorescence parting detecting reagents, it is characterized in that: when described allele-specific MGB probe comprises one or more in the sequence as shown in SEQ ID NO:7 and SEQ ID NO:8, described positive reference substance is the mixing plasmid DNA that has codon 13 GGC > GAC and 13 GGC > CGC replacement mutations.

10. 8 kinds of sudden change fluorescence genotyping detection methods of a mankind K-ras gene, it is characterized in that: comprise the following steps: the genomic dna that extracts according to a conventional method sample to be detected, then divide 4 reaction tubess (A, B, C, D) to detect, first in each reaction tubes, add respectively in PCR mixed reaction solution, general upstream primer, wild-type and mark probe and wild-type downstream primer, then at reaction tubes A, add MGB probe and the ARMS downstream primer that detects codon 12 GGT > GAT and 12 GGT > AGT replacement mutations; At reaction tubes B, add MGB probe and the ARMS downstream primer that detects codon 12 GGT > GTT and 12 GGT > GCT replacement mutations; At reaction tubes C, add MGB probe and the ARMS downstream primer that detects codon 12 GGT > TGT and 12 GGT > CGT replacement mutations; At reaction tubes D, add MGB probe and the ARMS downstream primer that detects codon 13 GGC > GAC and 13 GGC > CGC replacement mutations, carry out the fluorescence quantitative PCR detection of sample of nucleic acid;

The sequence of described general upstream primer is as shown in SEQ ID NO:9;

In described wild-type, mark probe and wild-type downstream primer sequence are as shown in SEQ ID NO:18, SEQ ID NO:19;

The described MGB probe for detection of codon 12 GGT > GAT and 12 GGT > AGT replacement mutations and ARMS downstream primer sequence are as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:11;

The described MGB probe for detection of codon 12 GGT > GTT and 12 GGT > GCT replacement mutations and ARMS downstream primer sequence are as shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:13;

The described MGB probe for detection of codon 12 GGT > TGT and 12 GGT > CGT replacement mutations and ARMS downstream primer sequence are as shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:14, SEQ ID NO:15;

The described MGB probe for detection of codon 13 GGC > GAC and 13 GGC > CGC replacement mutations and ARMS downstream primer sequence are as shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:16, SEQ ID NO:17.