CN103695434A - Nucleic acid aptamer AFB1-04 of aflatoxin B1 and application of nucleic acid aptamer AFB1-04 - Google Patents
Nucleic acid aptamer AFB1-04 of aflatoxin B1 and application of nucleic acid aptamer AFB1-04 Download PDFInfo
- Publication number
- CN103695434A CN103695434A CN201410015325.7A CN201410015325A CN103695434A CN 103695434 A CN103695434 A CN 103695434A CN 201410015325 A CN201410015325 A CN 201410015325A CN 103695434 A CN103695434 A CN 103695434A
- Authority
- CN
- China
- Prior art keywords
- afb
- aptamer
- nucleic acid
- afb1
- acid aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a nucleic acid aptamer AFB1-04 of aflatoxin B1 and application of the nucleic acid aptamer AFB1-04, relates to a nucleic acid and an derivative of the nucleic acid aptamer AFB1-04 and particularly relates to a truncated nucleic acid aptamer as well as a preparation method and application thereof. The nucleic acid aptamer AFB1-04 of the aflatoxin B1 is screened and prepared by virtue of an affinity SELEX (systematic evolution of ligands by exponential enrichment) method based on agarose microbead separation-flow cytometry analysis. The nucleic acid aptamer AFB1-04 of the aflatoxin B1 and the derivative of the nucleic acid aptamer AFB1-04 are rich in base G, have stem loop structures, are high in stability, are free of toxicity, are easy to synthesize and mark and can be taken as latent detection reagents for the aflatoxin B1 in samples.
Description
Technical field
The present invention relates to a kind of nucleic acid, particularly application SELEX technology is prepared AFB
1aptamer and application thereof.
Background technology
In the biotic pollution problem of oil and foodstuffs, the pollution of mycotoxins is one of topmost factor, and aflatoxin (Aflatoxins, AF) is toxicity and the strongest natural pollutant of carinogenicity of finding so far.Aflatoxin is the one group of similar secondary metabolite of chemical structure being produced by Aspergillus flavus and Aspergillus parasiticus bacterium etc., has the basic structure of two furan nucleuss and coumarin (tonka bean camphor), has found at present kind more than 20, mainly comprises B
1, B
2, G
1, G
2, M
1and M
2deng.Wherein, AFB
1toxicity the strongest, amount is maximum, stability is also the highest, its toxicity is 10 times of potassium cyanide, 68 times of arsenic, Main Function, in organs such as livers, can bring out primary hepatocarcinoma, cancer of the stomach and lung cancer etc., and is a class carcinogens in the delimitation of 1993 cancer research mechanisms of the Nian Bei World Health Organization.AFB
1extensively be present in soil and animals and plants, plant food especially, as peanut, corn, rice, wheat, milk and various nuts etc.AFB
1physico-chemical property more stable, fat-soluble, heat-resisting, be difficult to detoxification, the health of humans and animals is produced to harm greatly.AFB
1content is must examine index in international food health and Agricultural Products Trade, and many countries have all formulated the national standard of its allowance in food.Therefore, to AFB
1carrying out effective, quick, highly sensitive detection has great importance.（1.Wogan,G.N.Chemical?nature?and?biological?effects?of?the?aflatoxins.Bacteriol?Rev1966,30,460-470;2.Shankaran,R.;Raj,H.G.;Venkitasubramanian,T.A.Biochemical?changes?in?liver?due?to?aflatoxin.Br?J?Exp?Pathol1970,51,487-491）。
At present, conventional AFB
1detection method overview gets up to mainly contain chemical analysis and immunoassay.Chemical analysis mainly contains thin-layer chromatography chromatography (TLC), high performance liquid chromatography (HPLC) and microtrabeculae method etc., these conventional sense methods have possessed higher detection sensitivity and accuracy, but have that numerous and diverse sample pre-treatments, separation detection are consuming time, the expensive heaviness of plant and instrument and be difficult to realize on-the-spot real-time analysis, need the shortcomings such as professional and technical personnel.Immunoassay is mainly a series of immunological detection methods of high-affinity based on aspergillus flavus resisting toxin monoclone antibody and high specific development, enzyme-linked immunosorbent assay wherein (ELISA) is highly sensitive, security good, interference is few, easy and simple to handle quick, be the most general current practical AFB
1detection method.But AFB
1being a kind of hypertoxic small molecules, there is larger difficulty in the preparation of its antibody, and the reagent life-span, shorter being difficult to ensure deposited, and differences between batches are also larger etc., these Bottleneck Restrictions range of application and fast development (the 3.Jin Hwan Do of immunological detection method; Dong-Kug Choi.Aflatoxins:Detection, Toxicity, and Biosynthesis.Biotechnology and Bioprocess Engineering2007,12,585-593; 4.Liu Z.; Gao J..Advances in research on detection methods for aflatoxins.Journal of Anhui Agricultural University2004,31,223-226).Therefore, towards AFB
1novel detection reagent and detection method urgently develop.
Aptamer (aptamer) is a class new type functional nucleic acid molecular probe, based on index concentration Fas lignand system evolution technology (SELEX) in-vitro screening from random oligonucleotide library, obtain, be described as " artificial antibody ", can be combined with target molecule high-affinity and high specific, have short, the convenient economy of chemosynthesis of screening cycle and high without lot size variance, stability, be easy to the plurality of advantages such as pinpoint modification, be potential antibody surrogate thing, at biochemical analysis detection field, demonstrate huge application prospect.At present, the identification based on aptamer and detection method become a kind of new blanket technology (5.Liu, J. gradually; Cao, Z.; Lu, Y.Functional nucleic acid sensors.Chem Rev2009,109,1948-1998; 6.Clark, S.L.; Remcho, V.T.Aptamers as analytical reagents.Electrophoresis2002,23,1335-1340).The biosensor that aptamer technology is applied to mycotoxins detection analysis is in active development development.For example, ochratoxin A (Ochratoxin A, OTA) and fumonisin B
1(Fumonisin B
1, FB
1) etc. the aptamer of multiple mycotoxins screened; and developed multiple detection system (7.Screening and Initial Binding Assessment of Fumonisin B1Aptamers Int.J.Mol.Sci.2010; 11; 4864-4881.8.Determination of Ochratoxin A with a DNA Aptamer.J.Agric.Food Chem.2008; 56; 10456 – 10461.9.Yang, C.; Wang, Y.; Marty, J.; Yang, X.Aptamer-Based Colorimetric Biosensing of Ochratoxin A using Unmodified Gold Nanoparticles Indicator.Biosens.Bioelectron.2010.10.Kuang, H.; Chen, W.; Xu, D.; Xu, L.; Zhu, Y.; Liu, L.; Chu, H.; Peng, C.; Xu, C.; Zhu, S.Fabricated Aptamer-Based Electrochemical " signal-Off " Sensor of Ochratoxin A.Biosens.Bioelectron.2010,26,710 – 716).Therefore, screening AFB
1specific nucleic acid fit and develop aptamer technology for AFB
1new detecting method there is important Research Significance and market using value.
Summary of the invention
The first object of the present invention is to provide AFB
1aptamer AFB
1-04, the sterile S ELEX technology screening of this aptamer application based on Agarose microbead separation-flow cytometry obtains, can high-affinity identification AFB
1.
The second object of the present invention is to provide AFB
1aptamer AFB
1-04 derivative, comprises its brachymemma aptamer.
The 3rd object of the present invention is to provide AFB
1aptamer AFB
1-04 and derivative as AFB in sample
1a kind of application of potential detection reagent.
Described AFB
1aptamer AFB
1-04, its sequence is as follows:
ATACCAGCTTATTCAATTACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGGAGATAGTAAGTG
CAATCT
Described AFB
1aptamer AFB
1-04 derivative, comprises the brachymemma aptamer with identical function purposes, respectively called after AFB
1-04-CUT1, AFB
1-04-CUT2, AFB
1-04-CUT3 and AFB
1-04-CUT4, its sequence is respectively:
AFB
1-04-CUT1：
ACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGGAGATAGTAAGTGCAATCT
AFB
1-04-CUT2：
ATACCAGCTTATTCAATTACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG
AFB
1-04-CUT3：
ACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG
AFB
1-04-CUT4：
TGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG
Described AFB
1aptamer AFB
1-04 and derivative be applied to AFB in sample
1detection analysis, AFB in preparing sample
1detection reagent in apply.A kind of specific features is that the auxiliary fit sensor of colorimetric of gold nano is (with AFB
1-04-CUT4 is example), can realize visual detection AFB
1, spectral detection sensitivity is 0.98 μ M, comprises the following steps:
(1) chemosynthesis gold nano grain (AuNPs);
(2) AFB
1aptamer and AFB
1fully hatch;
(3) above-mentioned (2) reaction mixture fully mixes and hatches with gold nano grain solution;
(4) in above-mentioned (3) reaction mixture, add NaCl, observe solution colour and change, on ultraviolet-visible spectrophotometer, detect, use A
601/ A
520for detection signal.
The invention has the advantages that: 1) aptamer obtains by the sterile S ELEX technology screening based on Agarose microbead separation-flow cytometry, in-vitro screening and detect easy fast; 2) aptamer itself is one section of oligonucleotide, chemosynthesis in a large number, and without lot size variance, good stability, is easy to preserve; 3) aptamer energy high-affinity identification AFB
1, can match in excellence or beauty with antibody; 4) aptamer is easy to pointed decoration mark, and application form is versatile and flexible, and AFB
1for organic molecule, itself has photoluminescent property, and both character combine and can develop a series of biosensors, is detecting having a extensive future of analysis field.5) aptamer carries out unmarked use, is combined with gold nano, realizes visual detection, simple and practical.
Accompanying drawing explanation
Fig. 1 is AFB
1the fluorescent microscope image of-beads.Figure a is the light field imaging of control group Control-beads, and figure b is sample sets AFB
1the light field imaging of-beads, figure c is the fluorescence details in a play not acted out on stage, but told through dialogues imaging of control group Control-beads, figure d is sample sets AFB
1the fluorescence details in a play not acted out on stage, but told through dialogues imaging of-beads.
Fig. 2 is AFB
1the fluorescence spectrum scintigram of-beads.Curve a is sample sets AFB
1-beads.Curve b is control group Control-beads.
Fig. 3 be in flow cytometry monitoring screening process the initial library of DNA for target molecule AFB
1the fluorescence deflection graph of-beads enrichment.Curve a is blank AFB
1-beads, curve b is the initial library of DNA, and curve c the 4th takes turns enrichment storehouse, and curve d the 6th takes turns enrichment storehouse, and curve e the 8th takes turns enrichment storehouse, and curve f is 11th round enrichment storehouse.
Fig. 4 be in flow cytometry monitoring screening process the initial library of DNA for the fluorescence deflection graph of anti-sieve element COOH-beads enrichment.Curve a is blank COOH-beads, and curve b is the initial library of DNA, and curve c the 4th takes turns enrichment storehouse, and curve d the 6th takes turns enrichment storehouse, and curve e the 8th takes turns enrichment storehouse, and curve f is 11th round enrichment storehouse.
Fig. 5 is Flow Cytometry Assay aptamer AFB
1-04 couple of target molecule AFB
1the binding curve figure of-beads.
Fig. 6 is Flow Cytometry Assay brachymemma aptamer AFB
1-04-CUT1 is to target molecule AFB
1the binding curve figure of-beads.
Fig. 7 is Flow Cytometry Assay brachymemma aptamer AFB
1-04-CUT2 is to target molecule AFB
1the binding curve figure of-beads.
Fig. 8 is Flow Cytometry Assay brachymemma aptamer AFB
1-04-CUT3 is to target molecule AFB
1the binding curve figure of-beads.
Fig. 9 is Flow Cytometry Assay brachymemma aptamer AFB
1-04-CUT4 is to target molecule AFB
1the binding curve figure of-beads.
Figure 10 is the brachymemma aptamer AFB of stream measuring competitive binding assay aptamer
1the specificity figure of-04-CUT4.A is target molecule AFB
1, b, c, d, e, f are respectively competition reagent A FB
2, AFG
1, AFG
2, AFM
1, AFM
2.
Figure 11 detects AFB based on the fit sensor of the auxiliary colorimetric of gold nano
1principle schematic.
Figure 12 is to AFB based on the auxiliary fit sensor of colorimetric of gold nano
1the colour developing picture of concentration gradient response.A, b, c, d, e and f represent respectively AFB in system
1concentration be 0,10,30,50,80 and 100 μ M.
Figure 13 is to AFB based on the auxiliary fit sensor of colorimetric of gold nano
1the uv-vis spectra scintigram of concentration gradient response.A, b, c, d, e, f, g, h, i, j, k and m represent respectively AFB in system
1concentration be 0,0.5,1,2,4,8,10,30,50,80,100 and 175 μ M.
Figure 14 is gold nano grain absorbancy ratio A
601/ A
520with analyte AFB
1change in concentration graph of relation.Embedded figure is A
601/ A
520with AFB
1concentration is good linear relationship chart within the scope of 0-80 μ M.
Embodiment
Embodiment 1 target AFB
1synthetic and the sign of-beads
Using Agarose microbead as the solid phase carrier of target molecule, be conducive to separation not in conjunction with or weak binding and non-specific binding sequence, and be applicable to Flow cytometry.By AFB
1the synthetic route that is coupled to Agarose microbead is specific as follows:
Get 7.6mg AFB
1be dissolved in 4mL pyridine, add 35mg carboxymethyl hydroxylamine hydrochloride, 80 ℃ of backflows are spent the night, and through vacuum concentration and silica gel column chromatography (chloroform/methanol=10:1), isolate AFB
1-oxime is also dissolved in 3mL anhydrous methylene chloride, adds 5.4mg NHS, 9.6mg dicyclohexylcarbodiimide and 5mg Dimethylamino pyridine, and magnet rotor stirs and to spend the night, and after filtration and evaporation concentration, obtains AFB
1-oxime Acibenzolar (11.Chu, F.S.; Hsia, M.T.; Sun, P.S.:Preparation and characterization of aflatox-n B1-1-(O-carboxymethyl) oxime.Journal-Association of Official Analytical Chemists1977,60,791-4.).Get 0.107g NHS-beads and be dispersed in 900 μ L dipotassium hydrogen phosphate damping fluids (50mM, pH9.0), add 100 μ L quadrols, magnet rotor stirs and spends the night.The centrifugal supernatant that goes, and obtain NH with PB damping fluid (0.1M, pH8.0) cleaning microballon
2-beads.By AFB
1-oxime Acibenzolar is dissolved in 0.8mL DMF, NH
2-beads is scattered in 0.8mL dipotassium hydrogen phosphate damping fluid (50mM, pH9.0), and both mix, and magnet rotor stirs and spends the night, and then with 50%DMF and PB buffer solution for cleaning microballon, obtains AFB
1-beads, 4 ℃ keep in Dark Place.By fluorescence spectrum, scan (Ex:365nm; Em:380-600nm) and fluorescent microscope imaging to AFB
1-beads characterizes (referring to Fig. 1 and 2).
(1) design of random oligonucleotide library is with synthetic
The random oligonucleotide library that designs and synthesizes two ends FX and be 18 Nucleotide, middle random area and be 45 Nucleotide is as follows: 5'-ATA CCA GCT TAT TCA ATT-N45-AGA TAG TAA GTG CAA TCT-3', storage capacity is 10
15.The primer sequence is respectively forward primer (FP): 5'-ATA CCA GCT TAT TCA ATT-3'; reverse primer (RP): 5'-AGA TTG CAC TTA CTA TCT-3'; fluorescent dye primer (FFP): 5'-FAM-ATA CCA GCT TAT TCA ATT-3'; biotin labeling primer (BRP): 5'-Bio-AGA TTG CAC TTA CTA TCT-3'(12.Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z.C.; Chen, H.W.; Mallikaratchy, P.; Sefah, K.; Yang, C.J.; Tan, W.Aptamers evolved from live cells as effective molecular probes for cancer study.Proc Natl Acad Sci USA2006,103,11838-11843).
(2) screening of aptamer
AFB
1-beads is as target molecule, and the COOH-beads that hydrolyzing N HS-beads forms is as anti-sieve element.
Get the initial library of 10nmol and be dissolved in 200 μ L binding buffer liquid (20mM Tris-HCl, pH8.0,100mM NaCl, 5mM KCl, 2mM MgCl
2, 1mM CaCl
2) in, 95 ℃ of 5min, ice bath 5min, room temperature 30min.200pmol is all used in inferior one-level library.Anti-sieve operation is from third round, by the library of denaturing treatment and 2 μ L COOH-beads incubated at room 5min.It filters collects liquid and 2 μ L AFB
1-beads incubated at room 60min.Use binding buffer liquid to clean microballon, in connection with the AFB of DNA
1-beads directly carries out PCR amplification and (uses FP and BRP, 94 ℃ of 3min; 94 ℃ of 15s; 50 ℃ of 15s; 72 ℃ of 15s; 72 ℃ of 3min), and adsorb and obtain single-chain nucleic acid library through the NaOH of 0.1M wash-out with streptavidin microballon, for next round, screening.Screening process increases proof strength by wheel, carries out altogether 11 and takes turns.By the enrichment condition (referring to Fig. 3 and 4) in Flow cytometry library.Finally enrichment is restrained to storehouse and carry out cloning and sequencing (13.Hu, J.; Wu, J.; Li, C.; Zhu, L.; Zhang, W.Y.; Kong, G.; Lu, Z.; Yang, C.J.A G-quadruplex aptamer inhibits the phosphatase activity of oncogenic protein Shp2in vitro.Chembiochem.2011,12,424-430).
The avidity of embodiment 3 aptamers and brachymemma aptamer characterizes
Aptamer molecule, at 5' end mark Fluoresceincarboxylic acid (FAM), is prepared to 0-7000nM gradient solution in 200 μ L binding buffer liquid, and thermally denature is processed, with 0.4 μ L AFB
1-beads incubated at room 30min.After cleaning with binding buffer liquid, be suspended in binding buffer liquid, by cells were tested by flow cytometry bead surface fluorescence intensity.With fluorescence intensity, to the mapping of aptamer concentration, use formula Y=Bmax X/ (K
d+ X) carry out the combination dissociation constant K of the matching mensuration aptamer of binding curve
d.Because the aptamer sequence obtaining is longer, after structural analysis, it is carried out to sequence brachymemma optimization, and characterize its avidity (referring to Fig. 5～9) with flow cytometer.
Preparation 100nM FAM-DNA solution, thermally denature is processed, in 30% methyl alcohol-binding buffer liquid with 0.4 μ L AFB
1free competition reagent (the AFB of-beads and 300 μ M
1, AFB
2, AFG
1, AFG
2, AFM
1, AFM
2) hatch 1h.After cleaning with binding buffer liquid, be suspended in binding buffer liquid, by cells were tested by flow cytometry bead surface fluorescence intensity.Calculate contention=(do not add and compete the microballon fluorescence intensity of reagent-the add microballon fluorescence intensity of competing after reagent)/do not add the microballon fluorescence intensity (referring to Figure 10) of competing reagent.
Embodiment 5 detects AFB based on the fit sensor of the auxiliary colorimetric of gold nano
1
Adopt the synthetic particle diameter 13nm gold grain of Trisodium Citrate reduction method.2mL1% chlorauric acid solution joins the ultrapure water of 46.5mL, after ebuillition of heated, adds rapidly 1.5mL4% sodium citrate solution, and solution colour finally becomes burgundy from the light yellow atropurpureus that becomes, and continues ebuillition of heated 20min left and right.Stop heating, after solution drops to room temperature, 4 ℃ save backup.Utilize UV, visible light spectrophotometric spectra and transmission electron microscope to characterize AuNPs(λ
m=520nm, burgundy, ε=2.7 * 10
8l/ (molcm)) (14.Liang Cui, Guoliang Ke, Wei Yun Zhang, Chaoyong James Yang.A universal platform for sensitive and selective colorimetric DNA detection based on Exo III assisted signal amplification.Biosensors and Bioelectronics.2011,26,2796 – 2800).Under the experiment condition of optimizing, containing 200nM AFB
1in 30% methyl alcohol of aptamer-binding buffer liquid, add the AFB of different concns
1after, incubated at room 30min; Then, reaction mixture and 10nM gold nano grain are at room temperature hatched 3h; Finally adding NaCl to regulate concentration is 30mM, incubated at room reaction 1h.Observation solution colour changes, and on ultraviolet-visible spectrophotometer, detects, and uses A
601/ A
520for detection signal.With random dna, replace aptamer, water replaces AFB
1carry out control experiment (referring to Figure 11～14).
Result
Embodiment 1 is according at AFB
1on add a carboxyl, with NH
2-beads carries out coupling and successfully synthesizes AFB by forming the basic ideas of stable amido linkage
1-beads, and by fluorescent microscope imaging and fluorescent scanning spectrum, its pattern and coupling content are characterized.As shown in Figure 1, in details in a play not acted out on stage, but told through dialogues fluorescence imaging, with respect to not having through AFB
1the Control-beads modifying, AFB
1-beads sends obvious fluorescence; As shown in Figure 2, under 365nm UV-irradiation, AFB
1-beads sends fluorescence at 425nm place, than the high 6 times of left and right of the fluorescent value of Control-beads.Hence one can see that, AFB
1-beads coupling success.AFB on Agarose microbead
1coupling content by measuring based on fluorescent scanning establishment of spectrum standard working curve, estimate the AFB for 4.5fmol
1/ beads.
The sterile S ELEX technology screening of embodiment 2 based on Agarose microbead separation-flow cytometry successfully obtains can high-affinity identification AFB
1aptamer.As shown in Figure 3, for just sieving target molecule AFB
1-beads, initial storehouse does not have obvious fluorescence skew, substantially not with AFB
1-beads combination, along with the increase of screening wheel number, the 4th, 6,8, the 11 fluorescence skews of taking turns enrichment storehouse increase gradually, and the fluorescence skew intensity in 11th round enrichment storehouse reaches 300 times of initial storehouse, illustrates in enrichment storehouse and AFB
1the sequence of-beads combination is enrichment gradually in screening process; As shown in Figure 4, for anti-sieve element COOH-beads, enrichment storehouse is taken turns in initial storehouse, the 4th, 6,8,11 does not all have obvious fluorescence skew, is not combined with COOH-beads.Explanation screens from random oligonucleotide library that enrichment has obtained and AFB
1the nucleotide sequence of-beads combination, therefore sends to cloning and sequencing by 11th round enrichment storehouse.
Embodiment 3 by Flow Cytometry Assay aptamer to target molecule AFB
1the binding ability of-beads.As shown in Fig. 5～9, AFB
1aptamer AFB
1-04 and brachymemma aptamer AFB
1-04-CUT1, AFB
1-04-CUT2, AFB
1-04-CUT3 and AFB
1the combination dissociation constant of-04-CUT4 is respectively 1.58 ± 0.28 μ M, 2.25 ± 0.33 μ M, 1.77 ± 0.37 μ M, 1.80 ± 0.40 μ M and 0.49 ± 0.015 μ M, has higher avidity.
Embodiment 5 is by setting up based on the auxiliary fit sensor of colorimetric of gold nano for detection of AFB
1verified that gained aptamer is as AFB in sample
1a kind of application of potential detection reagent.As shown in figure 11, be the work schematic diagram based on the auxiliary fit sensor of colorimetric of gold nano; As shown in figure 12, along with AFB
1the increase of concentration, gold nano grain solution gradually becomes purple from redness, AFB
1the variation of solution colour can detect by an unaided eye when concentration is 30 μ M; As shown in figure 13, gold nano grain solution and AFB
1the mixing solutions of aptamer has maximum absorption at 520nm place, along with the AFB adding
1the increase of concentration, the absorption peak that 520nm goes out is in a slight decrease, but changes not obviously, and increases gradually in wavelength 601nm place absorbancy, occurs absorption peak; As shown in figure 14, in 0～80 μ M concentration range, A
601/ A
520along with analyte AFB
1the increase gradually of concentration and increasing sharply, AFB
1concentration continues to increase, but A
601/ A
520increase slowly, be tending towards platform.A
601/ A
520with AFB
1concentration is good linear relationship within the scope of 0-80 μ M, and equation of linear regression is A
601/ A
520=0.0070C (μ M)+0.1977, R
2=0.9812, detect and be limited to 0.98 μ M.
Claims (8)
1. AFB
1aptamer AFB
1-04, it is characterized in that its sequence is as follows:
ATACCAGCTTATTCAATTACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGGAGATAGTAAGTG
CAATCT。
2. AFB as claimed in claim 1
1aptamer AFB
1-04 derivative, is characterized in that and described AFB
1aptamer AFB
1-04 has the brachymemma aptamer of identical function purposes, respectively called after AFB
1-04-CUT1, AFB
1-04-CUT2, AFB
1-04-CUT3 and AFB
1-04-CUT4, its sequence is respectively:
AFB
1-04-CUT1：
ACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGGAGATAGTAAGTGCAATCT
AFB
1-04-CUT2：
ATACCAGCTTATTCAATTACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG
AFB
1-04-CUT3：
ACTATGTCTACTGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG
AFB
1-04-CUT4：
TGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG。
3. AFB as claimed in claim 1
1aptamer AFB
1-04 is applied to AFB in sample
1detection analysis.
4. AFB as claimed in claim 1
1aptamer AFB
1-04 in preparing sample AFB
1detection reagent in apply.
5. application as claimed in claim 3, is characterized in that described detection analysis is for the auxiliary fit sensor of colorimetric of gold nano.
6. AFB as claimed in claim 2
1aptamer AFB
1-04 derivative is applied to AFB in sample
1detection analysis.
7. AFB as claimed in claim 2
1aptamer AFB
1-04 derivative AFB in preparing sample
1detection reagent in apply.
8. application as claimed in claim 6, is characterized in that described detection analysis is for the auxiliary fit sensor of colorimetric of gold nano.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410015325.7A CN103695434B (en) | 2014-01-14 | 2014-01-14 | AFB1Aptamer AFB1-04 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410015325.7A CN103695434B (en) | 2014-01-14 | 2014-01-14 | AFB1Aptamer AFB1-04 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103695434A true CN103695434A (en) | 2014-04-02 |
| CN103695434B CN103695434B (en) | 2016-05-25 |
Family
ID=50357098
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410015325.7A Expired - Fee Related CN103695434B (en) | 2014-01-14 | 2014-01-14 | AFB1Aptamer AFB1-04 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103695434B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104597258A (en) * | 2015-01-09 | 2015-05-06 | 上海交通大学 | Method for detecting 17beta-estradiol by employing colorimetric method based on nucleic acid aptamer |
| CN115728254A (en) * | 2022-11-08 | 2023-03-03 | 中国海洋大学 | Electrochemical colorimetric dual-signal sensor, and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517289A (en) * | 2011-11-25 | 2012-06-27 | 国家纳米技术与工程研究院 | Nucleic acid aptamer of aflatoxin B1 and application thereof |
| CN102952802A (en) * | 2012-09-29 | 2013-03-06 | 江南大学 | Group of oligonucleotides aptamers capable of specifically recognizing aflatoxin B1 |
-
2014
- 2014-01-14 CN CN201410015325.7A patent/CN103695434B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517289A (en) * | 2011-11-25 | 2012-06-27 | 国家纳米技术与工程研究院 | Nucleic acid aptamer of aflatoxin B1 and application thereof |
| CN102952802A (en) * | 2012-09-29 | 2013-03-06 | 江南大学 | Group of oligonucleotides aptamers capable of specifically recognizing aflatoxin B1 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104597258A (en) * | 2015-01-09 | 2015-05-06 | 上海交通大学 | Method for detecting 17beta-estradiol by employing colorimetric method based on nucleic acid aptamer |
| CN115728254A (en) * | 2022-11-08 | 2023-03-03 | 中国海洋大学 | Electrochemical colorimetric dual-signal sensor, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103695434B (en) | 2016-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | A sensitive, label free electrochemical aptasensor for ATP detection | |
| Song et al. | Label-free and non-enzymatic detection of DNA based on hybridization chain reaction amplification and dsDNA-templated copper nanoparticles | |
| Wang et al. | Dual-recognition aptazyme-driven DNA nanomachine for two-in-one electrochemical detection of pesticides and heavy metal ions | |
| CN107446929B (en) | Aptamer for specifically recognizing ochratoxin A and preparation method thereof | |
| Selvakumar et al. | Nano RNA aptamer wire for analysis of vitamin B12 | |
| CN103725686B (en) | AFB 1aptamer AFB 1-20 and application | |
| Diercks-Horn et al. | The ALGADEC device: a semi-automated rRNA biosensor for the detection of toxic algae | |
| US20090162888A1 (en) | Sample control for correction of sample matrix effects in analytical detection methods | |
| CN109142710B (en) | Method for rapidly and sensitively detecting tetrodotoxin TTX | |
| Chen et al. | Target-protecting dumbbell molecular probe against exonucleases digestion for sensitive detection of ATP and streptavidin | |
| CN107208140A (en) | Method for detecting and quantifying biological materials by using the activity of nucleic acid polymerases modulated by target materials | |
| CN103695433A (en) | Aptamer AFB1-01 of aflatoxin B1 and application of aptamer AFB1-01 | |
| Vishwakarma et al. | Aptamer-based approaches for the detection of waterborne pathogens | |
| Hu et al. | A carbon nanotubes based fluorescent aptasensor for highly sensitive detection of adenosine deaminase activity and inhibitor screening in natural extracts | |
| Ying et al. | Light-up RNA aptamer enabled label-free protein detection via a proximity induced transcription assay | |
| Xue et al. | A versatile platform for highly sensitive detection of protein: DNA enriching magnetic nanoparticles based rolling circle amplification immunoassay | |
| CN103725685B (en) | AFB 1aptamer AFB 1-14 and application | |
| Yan et al. | DNA aptamer folding on magnetic beads for sequential detection of adenosine and cocaine by substrate-resolved chemiluminescence technology | |
| Yan et al. | One-pot label-free dual-aptasensor as a chemiluminescent tool kit simultaneously detect adenosine triphosphate and chloramphenicol in foods | |
| Qiu et al. | Self-assembled bifunctional nanoflower-enabled CRISPR/Cas biosensing platform for dual-readout detection of Salmonella enterica | |
| CN103695434A (en) | Nucleic acid aptamer AFB1-04 of aflatoxin B1 and application of nucleic acid aptamer AFB1-04 | |
| Kuo et al. | Digital and absolute assays for low abundance molecular biomarkers | |
| Jiang et al. | A dual-labeled fluorescence quenching lateral flow assay based on one-pot enzyme-free isothermal cascade amplification for the rapid and sensitive detection of pathogens | |
| Liu et al. | Signal-amplification and real-time fluorescence anisotropy detection of apyrase by carbon nanoparticle | |
| Raab et al. | Transport and detection of unlabeled nucleotide targets by microtubules functionalized with molecular beacons |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160525 Termination date: 20220114 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |