CN103667432A - Improved sulfite sequencing method - Google Patents
Improved sulfite sequencing method Download PDFInfo
- Publication number
- CN103667432A CN103667432A CN201210351597.5A CN201210351597A CN103667432A CN 103667432 A CN103667432 A CN 103667432A CN 201210351597 A CN201210351597 A CN 201210351597A CN 103667432 A CN103667432 A CN 103667432A
- Authority
- CN
- China
- Prior art keywords
- dna
- add
- sulphite
- water
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a biologic DNA (Deoxyribonucleic Acid) methylation technique, and in particular relates to an improved sulfite sequencing method. The method comprises the following steps: purifying genome DNA through enzyme digestion, after purification, adding a sulfite modification liquid for melting and modifying, purifying, recycling and sequencing after modification so as to achieve sequencing on the genome DNA, wherein the sulfite modification liquid comprises 500-550 mu l or 100-120 mu l of NaOH, 0.5-0.6mg of water soluble vitamin E (Trolox), 10-15 mu l of triallyl isocyanurate, 0.037-0.040g of tetraethylenepentamine pentahydrochloride (TETRAEN), 37.5-40.0 mu L of guanidinium chloride solution, 0.3422-0.3822g of sodium metabisulfite, 20-30 mu L of hydroquinone and 100-120 mu l of sterile water, and the pH value is 5.0 to 5.1. By adopting the genome obtained by using the sequencing method, the conversion rate of the biologic genome DNA CG locus is improved. The method is rapid, accurate and high in conversion rate.
Description
Technical field
The present invention relates to biological DNA methylation technology, specifically a kind of improved sulphite sequence measurement.
Background technology
Research for biological DNA methylation, there are a lot of reports, comprise high performance liquid chromatography, sulphite sequencing, the responsive restriction enzyme that methylates is in conjunction with (Nan Nan, Zeng Fansuo etc.) such as Southern hybridization analysis method and MSAP (methylation-s ensitive ampli fied polymorphism) methods.High performance liquid chromatography (HPLC) method is to measure at present the method for the standard of 5-mC total amount in genomic dna, but can not understand methylated position and status information and to DNA purity requirement higher (Zhou Cuilan, Yin Yufang etc.).The restriction enzyme coupling Southern blot hybridization method that methylates responsive, this method can not reflect whole CpG island methylation state.Sulphite order-checking (bisulfite DNA sequencing), while utilizing the method, to notice that DNA should fully be processed by sodium bisulfite, have the non-methylated cytosine reporting near methylated CpG site to have the resistancing action of sulfurous acid oxygen sodium (Fan Baoxing).Bisulphite modified about genomic dna, mostly with reference to (1992) the classical modifying method such as Frommer (Dan Cunhai, Zhong Ming etc.).
Summary of the invention
The object of this invention is to provide a kind of improved sulphite sequence measurement.
For achieving the above object, the technical solution used in the present invention is:
An improved sulphite sequence measurement, cuts purifying by genomic dna through enzyme, adds sulphite decorating liquid to unwind and modify after purifying; After modifying, purifying reclaims order-checking, realizes the order-checking of genomic dna; Described sulphite decorating liquid is 500-550ul, 100-120 μ LNaOH, 0.5-0.6mg watermiscible vitamin E (Trolox), 10-15 μ L triallylcyanurate, 0.037-0.040g tetraethylene pentamine five hydrochlorides (TETRAEN), 37.5-40.0 μ L guanidine hydrochloride solution, 0.3422-0.3800g Sodium Metabisulfite, 20-30 μ L Resorcinol and 100-120ul sterilized water; PH=5.0-5.1.
To in genomic dna, add EcoR I enzyme, Hind III enzyme, damping fluid and sterilized water to bathe 24-30h in water at normal temperature, centrifugal collection supernatant liquor after the mixed solution that adds enzyme to cut the isopyknic chloroform of system and primary isoamyl alcohol after water-bath enzyme is cut mixes;
Wherein damping fluid is 100mM Tris-Hcl (pH7.5), 100mM MgCl
2, 10mM dithiothreitol (DTT) (Dithiothreitol), 500mM NaCl;
After then adding 3M NaAC, 40-60 μ g glycogen and the 3.5-4 of its volume 1/10-1/5 in supernatant liquor doubly the precooling dehydrated alcohol of described supernatant liquor volume mixing, in-20 ℃ of precipitation incubated overnight;
Centrifugal collecting precipitation after incubated overnight, and in precipitation, add the dehydrated alcohol of precooling intermittently to mix, then centrifugal collecting precipitation, after air seasoning, add sterilized water, stand-by.
Described after enzyme is cut purifying DNA at 93-95 ℃, through PCR, process 5-10min and make it become strand, by lysate static 1-5 minute in ice, after centrifugal 5-6S, add NaOH to mix after in 42-45 ℃ of water-bath 20-30min; After water-bath, in 30 μ L lysates, add 500 μ L sulphite decorating liquids to mix and carry out PCR processing modification.95 ℃ of reaction 3min in PCR instrument, 55 ℃ of 20min, 95 ℃ of 30s afterwards, 55 ℃ of 20min repeat three times, and last storage temperature is 20 ℃.
Tool of the present invention has the following advantages:
1. catalyzer and antioxidant (triallylcyanurate (TAC), watermiscible vitamin E (Trolox), tetraethylene pentamine five hydrochlorides (TETRAEN), guanidine hydrochloride solution have been added during gained sulphite decorating liquid of the present invention.Thereby shortened the modification time of sequence measurement, made the modification time shorten to 1.5h from 16h; Add Trolox to there is the reagent of antioxidation property, the oxidative stress that can prevent peroxidation sulphite to cause simultaneously; The Guanidinium hydrochloride aqueous solution adding has metaprotein function, in follow-up PCR, can effectively prevent the impact of albumen.
2. adopt sequence measurement gained genome of the present invention, improved the transformation efficiency in biological genome DNA CG site.
3. double-stranded DNA needed sex change before modifying, the methylated cytosine being only positioned on single stranded DNA could be transformed by sodium bisulfite, and therefore, DNA partially denaturing is the reason that causes that false positive is common, realize completely and transforming, the control of temperature and time is most important.In original modifying method, modify 12 to 16h for 55 ℃, under this condition, the integrity of most of DNA is destroyed, and the DNA of nearly 84%-96% is degraded.Carry out afterwards PCR detection and methylate, have shortcomings: first, the promoter region that amplification CG content is high is very difficult; Secondly, after processing with sodium bisulfite, increased the difficulty of follow-up PCR reaction, shown as: after 1. processing, DNA reduces in a large number, and template amount is few; 2. a large amount of uracil makes the DNA double chain can not complete complementary, and unstable increases; 3. primer, for the design of sense dna chain, is equivalent to strand amplification, and primer is easy and template mispairing, produces a large amount of non-specific amplification products.
Adopt the present invention only to have an appointment the time of modifying 1 hour 30 minutes, and the middle sex change time that has increased by three 95 ℃ of 30s.This kind of modification method, had both shortened the time of modifying greatly, was guaranteeing, on the basis of modifying completely, effectively to have protected the integrity of DNA simultaneously.Stability and the repeatability of carrying out afterwards pcr amplification all increase.
Accompanying drawing explanation
Fig. 1 is for adopting classical modifying method, and site figure methylates.Contrast standard is known, and Cd concentration is 0,0.5,5.0 coerce, and the site that methylates is respectively 5,5,4.(totally 11 CG sites, wherein the circle of black represents that this site methylates) do not have obvious variation tendency as shown in the figure.
The improved modifying method of employing that Fig. 2 provides for the embodiment of the present invention, site figure methylates.Contrast standard is known, and Cd concentration is 0,0.5,5.0 coerce, and the site that methylates is respectively 2,3,4.Can find out, along with Cd coerces the increase of concentration, methylation is in rising trend.(totally 11 CG sites, wherein the circle of black represents that this site methylates) as shown in the figure.
The 2% agarose gel electrophoresis figure that Fig. 3 provides for the embodiment of the present invention, wherein duct is from left to right followed successively by: Cd0, Cd0.5, Cd5.0, markerDL2000.
Embodiment
Embodiment 1
1. in the genomic dna of approximately 10 μ g, add 10 μ L EcoR I enzymes, 10 μ L Hand III enzymes and 20 μ L damping fluids, and add sterilized water to 200 μ L, in 37 ℃ of water-baths 24 hours, carry out enzyme and cut processing.
Described wherein damping fluid is 100mM Tris-Hcl (pH7.5), 100mM MgCl
2, 10mM dithiothreitol (DTT) (Dithiothreitol), 500mM NaCl;
2. after first water-bath finishes, add enzyme to cut chloroform and the primary isoamyl alcohol mixed solution of system equal-volume 200ul, intermittently mix 10 minutes; Then in 4 ℃, the centrifugal 10min of 12000r/min, draws supernatant liquor 180 μ L and transfers in a new 1.5ml centrifuge tube.
After next adds the dehydrated alcohol of precooling of NaAC (about 20ul), 40 μ g glycogens and 3.5 times of volumes of supernatant liquor (650 μ L-700ul) of the 3M of supernatant liquor 1/10 volume to mix, in 2-3 hours (or spending the night) of-20 ℃ of precipitations; Then with 4 ℃, the centrifugal 30min of 12000r/min.
Abandon supernatant liquor, in precipitation, add the dehydrated alcohol of 1ml precooling, intermittently mix 5min; Again with 4 ℃, the centrifugal 20min of 12000r/min; Gained precipitation mixes repeated centrifugation operation through the dehydrated alcohol of precooling again.
Finally will precipitate again centrifugal 8s under normal temperature, by being attached to ethanol raffinate on EP inside pipe wall to managing at the end, with sterilized filter paper, blot precipitation liquid around, air seasoning 3min, the time is not too long, otherwise is difficult for back dissolving.In dried DNA, add 50 μ L sterilized waters.
3. the preparation of sulphite decorating liquid: in the centrifuge tube of 2ml, add 600 μ L sterilized waters, simultaneously at the 6M NaOH that adds 100 μ L newly to join, 0.5mg watermiscible vitamin E (preparing rear final concentration is 0.5mg/ml), 10 μ L triallylcyanurate (final concentration is 1mM), 0.037g tetraethylene pentamine five hydrochlorides (TETRAEN) (final concentration is 0.1M), 37.5 μ L guanidine hydrochloride solutions (final concentration is 0.3M), the Resorcinol that adds 0.3422g Sodium Metabisulfite (final concentration is 3.6M) and 20 μ L newly to join; Adjusting PH is 5.0-5.1, adds sterilized water 100 μ L, and constant volume is to 1ml.
Described 6M NaOH is formulated as: 0.24g NaOH is dissolved in 1ml sterilized water; While matching while using.Being formulated as of 320mM Resorcinol: 0.007g Resorcinol is dissolved in 200 μ L sterilized waters; And at tinfoil paper parcel, lucifuge, water-bath is preserved stand-by at 55 ℃.The preparation of 0.1M triallylcyanurate: 0.0034g triallylcyanurate is dissolved in 200 μ L sterilized waters.
4. the DNA solution 25 μ L that step 3) enzyme cut after purifying are placed in PCR instrument, process 5min make it become strand at 95 ℃; Above-mentioned single stranded DNA is taken out, be placed in ice 1 minute, after centrifugal 5-6S, Xiang Guanzhong adds the NaOH of 5 μ L 6M, mixes water-bath 20min(final volume 30ul at 42 ℃ with rifle).
After water-bath finishes, in the DNA solution after unwinding to 30 μ L, add above-mentioned steps 3) preparation sulphite decorating liquid decorating liquid 500ul, now cumulative volume is 530 μ L; Then in packing PCR pipe, of short durationly modify after centrifugal, modification program is: 95 ℃ of reaction 3min in PCR instrument, and 55 ℃ of 20min, 95 ℃ of 30s afterwards, 55 ℃ of 20min repeat three times, and last storage temperature is 20 ℃.
5. the purifying of DNA after modifying is reclaimed and use wash-out purifying recovery DNA system to carry out purifying recycling
Be specially: after 1) modifying, close pipe in 1.5mLEP pipe, in pipe, add 200-250 μ L wash-out purifying to reclaim DNA resin, softly put upside down and mix, make DNA fully and resin-bonded.Clean-up resin should acutely shake up before use, otherwise resin settled is at the bottom of solution, impact reclaim quality (wash-out purifying reclaims DNA system, according to
dNA purification system system that company provides is carried out, and is specially Promega, A7280).
2) by the syringe of a 2.5mL injector for medical purpose and test kit (purchased from
dNA purification system company) the recovery pillar providing moves to said mixture in syringe with micropipet after closely connecting, and gets a little glass beaker of measuring and is placed on pillar bottom to facilitate reception waste liquid.Add pintle, pressurization, slowly extrudes liquid gently, now the pitch deposition of adularescent in visible pillar.
3) after syringe is separated with pillar, extract pintle, then syringe is connected with pillar, the aqueous isopropanol to adding 2mL 80% in syringe, inserts pintle, and pressurization, slowly extrudes liquid gently.This is washing step.Repeated washing 1 time again after washing.
4) syringe is separated with pillar, pillar is placed on the EP pipe of a discarded 1.5mL, normal temperature 10000g/min(g is relative centrifugal force, is not rotating speed r), centrifugal 2min, to get rid of remaining Virahol composition, makes resin drying.Now, modify rear DNA in the state with resin-bonded.
5) pillar is taken off and be placed on another clean 1.5mL EP pipe, and with micropipet, draw the prior 70 ℃ of preheated sterilized waters of 50 μ L and be placed in EP pipe, room temperature is placed 5min, modified DNA solution in pillar under the centrifugal 20s of normal temperature 10000g/min and then wash-out, elution process repetitive operation 2 times (each 50ul, guarantees that cumulative volume is 100ul after twice).After modifying in EP pipe after wash-out, DNA solution final volume is 100 μ L.
6. de-sulfonation: add the freshly prepared 6M NaOH of 5 μ L solution in above-mentioned 100 μ L elute solns, in 42 ℃ of water-bath 20min.The NH4AC that draws 160 μ L 4M after water-bath adds wherein, mixes, and pH is stabilized near 8.0, takes off sulfonation.(this step is de-sulfonation, and final volume is 265 μ L).
After de-sulfonation, add the dehydrated alcohol of-20 ℃ of low temperature precoolings of its 3 times of volumes (approximately 800 μ L), then add 40 μ g glycogens, be placed on 3 hours (or spending the night) of-20 ℃ of precipitations.Then, with the centrifugal 30min of 12000r/min at 4 ℃, remove supernatant liquor, collecting precipitation is in EP pipe and add 1ml Virahol, and the EP that softly tilts pipe, revolves and turn around, washing precipitation, rear 4 ℃ of centrifugal 10min of 12000r/min.Then repetitive operation centrifugal treating is again 1 time.
Outwell supernatant, be the centrifugal 8s of normal temperature, will be attached to ethanol raffinate on EP inside pipe wall to managing at the end, with aseptic filter paper bar carefully by residual liquid exhaustion, and under room temperature air seasoning 3min.When precipitation is become when transparent from opaque, with micropipet, add 60 μ L sterilized waters, dissolve 5-10min, be the DNA solution after modification herein.
7. DNA solution after above-mentioned modification is carried out to met-PCR; Adopt 25 μ L systems.Be that DNA consumption is respectively 150ng.PCR system composition is: 2.5ul 10*buffer, 2.0ul DNTP, 0.5ul rTaq, 0.8ul primer and 150ng DNA (5ul), add water to 25ul.
PCR program is: 94 ℃ of denaturation 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min 2 circles; Adopt touchdown PCR, every two circles of annealing temperature were once being reduced.Until annealing temperature is reduced to 47 ℃, 47 ℃ of annealing are set to 19 circles, and 72 ℃ are extended 10min; 4 ℃ of interruptions, amount to 35 circles.Then amplified production is used to conventional cloning and sequencing.
Embodiment 2
1. extract genomic dna:
First use 0.1%HgCl
2solution carries out 10min surface sterilization to the full Arabidopis thaliana seed of choosing, and then uses washed with de-ionized water 3 times, each 5min.After cleaning, seed is soaked in deionized water, in 4 ℃ of placement 3d, to break seed dormancy.The Arabidopis thaliana seed of equal amts (approximately 20～30) is placed in to the triangular flask after sterilizing, adds 100mL respectively containing 0,0.5 and 5.0mgL
-1cd(CdCl
2preparation) MS nutritive medium (Murashige and Skoog Basal Salt Mixture), sealing.Be placed in shaking table and carry out illumination cultivation (19～20 ℃ of temperature, light dark period 14/10h, light intensity 3000lx), after 21d, sample, with the separated Arabidopsis thaliana Seedlings leaf of blade and root thereof, after cleaning respectively 3 times, distilled water and sterilized water dry with filter paper, refrigerate in-80 ℃ of refrigerators stand-by.
Then with CTAB method extract through different concns cadmium (0,0.5,5.0mgL
-1) coerce Arabidopsis thaliana Seedlings genomic dna (leaching process is referring to the clock Ma Hui that rings, 2008, Biotechnology Experiment is instructed, Beijing: China Agricultyre University Press, ISBN:9787811172768),
2. in the said extracted gained genomic dna of approximately 10 μ g, add 10 μ L EcoR I enzymes, 10 μ L Hind III enzymes and 20 μ L M buffer, and add sterilized water to 200 μ L, in 37 ℃ of water-baths 24 hours, carry out enzyme and cut processing.
Described wherein damping fluid is 100mM Tris-Hcl (pH7.5), 100mM MgCl
2, 10mM dithiothreitol (DTT) (Dithiothreitol), 500mM NaCl;
3. after first water-bath finishes, add enzyme to cut chloroform and the primary isoamyl alcohol mixed solution of system equal-volume 200ul, intermittently mix 10 minutes; Then in 4 ℃, the centrifugal 10min of 12000r/min, draws supernatant liquor 180 μ L and transfers in a new 1.5ml centrifuge tube.
After next adds the dehydrated alcohol of precooling of 3M NaAC (about 20ul), 40 μ g glycogens and 3.5 times of volumes of supernatant liquor (650 μ L-700ul) of supernatant liquor 1/10 volume to mix, in 2-3 hours (or spending the night) of-20 ℃ of precipitations; Then with 4 ℃, the centrifugal 30min of 12000r/min.
Abandon supernatant liquor, in precipitation, add the dehydrated alcohol of 1ml precooling, intermittently mix 5min; Again with 4 ℃, the centrifugal 20min of 12000r/min; Gained precipitation mixes repeated centrifugation operation through the dehydrated alcohol of precooling again.
Finally will precipitate again centrifugal 8s under normal temperature, by being attached to ethanol raffinate on EP inside pipe wall to managing at the end, with sterilized filter paper, blot precipitation liquid around, air seasoning 3min, the time is not too long, otherwise is difficult for back dissolving.In dried DNA, add 50 μ L sterilized waters.
4. the preparation of sulphite decorating liquid: in the centrifuge tube of 2ml, adding 600 μ L sterilized waters, is simultaneously 0.1M at the 6M NaOH that adds 100 μ L newly to join, 0.5mg watermiscible vitamin E (preparing rear final concentration is 0.5mg/ml), 10 μ L triallylcyanurate (final concentration is 1mM), 0.037gTETRAEN(final concentration), 37.5 μ L guanidine hydrochloride solutions (final concentration is 0.3M), the Resorcinol that adds 0.3422g Sodium Metabisulfite (final concentration is 3.6M) and 20 μ L newly to join; Adjusting PH is 5.0-5.1, adds sterilized water 100 μ L, and constant volume is to 1ml.
Described 6M NaOH is formulated as: 0.24g NaOH is dissolved in 1ml sterilized water; While matching while using.Being formulated as of 320mM Resorcinol: 0.007g Resorcinol is dissolved in 200 μ L sterilized waters; And at tinfoil paper parcel, lucifuge, water-bath is preserved stand-by at 55 ℃.The preparation of 0.1M triallylcyanurate: 0.0034g triallylcyanurate is dissolved in 200 μ L sterilized waters.
5. the DNA solution 25 μ L that step 4) enzyme cut after purifying are placed in PCR instrument, process 5min make it become strand at 95 ℃; Above-mentioned single stranded DNA is taken out, be placed in ice 1 minute, after centrifugal 5-6S, Xiang Guanzhong adds the NaOH of 5 μ L 6M, mixes water-bath 20min(final volume 30ul at 42 ℃ with rifle).
After water-bath finishes, in the DNA solution after unwinding to 30 μ L, add above-mentioned steps 3) preparation sulphite decorating liquid decorating liquid 500ul, now cumulative volume is 530 μ L; Then in packing PCR pipe, of short durationly modify after centrifugal, modification program is: 95 ℃ of reaction 3min in PCR instrument, and 55 ℃ of 20min, 95 ℃ of 30s afterwards, 55 ℃ of 20min repeat three times, and last storage temperature is 20 ℃.
6. after modifying, the purifying of DNA reclaims and uses Wizard Clean-up DNA(wash-out purifying to reclaim DNA) system carries out purifying recycling.
Be specially: 1) the good DNA of above-mentioned modification is closed to pipe in 1.5mLEP pipe, add 200-250 μ L Wizard DNA Clean-up resin(wash-out purifying to reclaim DNA resin), softly put upside down and mix, make DNA fully and resin-bonded.(Clean-up resin should acutely shake up before use, otherwise resin settled is at the bottom of solution, affects and reclaims quality).
2) the recovery pillar syringe of a 2.5mL injector for medical purpose being provided with test kit moves to said mixture in syringe with micropipet after being closely connected, and gets a little glass beaker of measuring and is placed on pillar bottom to facilitate reception waste liquid.Add pintle, pressurization, slowly extrudes liquid gently, now the pitch deposition of adularescent in visible pillar.
3) after syringe is separated with pillar, extract pintle, then syringe is connected with pillar, the aqueous isopropanol to adding 2mL 80% in syringe, inserts pintle, and pressurization, slowly extrudes liquid gently.This is washing step.Repeated washing 1 time again after washing.
4) syringe is separated with pillar, pillar is placed on the EP pipe of a discarded 1.5mL, normal temperature 10000g/min(g is relative centrifugal force, is not rotating speed r), centrifugal 2min, to get rid of remaining Virahol composition, makes resin drying.Now, modify rear DNA in the state with resin-bonded.
5) pillar is taken off and be placed on another clean 1.5mL EP pipe, and with micropipet, draw the prior 70 ℃ of preheated sterilized waters of 50 μ L and be placed in EP pipe, room temperature is placed 5min, modified DNA solution in pillar under the centrifugal 20s of normal temperature 10000g/min and then wash-out, elution process repetitive operation 1 time.After modifying in EP pipe after wash-out, DNA solution final volume is 100 μ L.
7. de-sulfonation: add the freshly prepared 6M NaOH of 5 μ L solution in above-mentioned 100 μ L elute solns, in 42 ℃ of water-bath 20min.The NH4AC that draws 160 μ L 4M after water-bath adds wherein, mixes, and pH is stabilized near 8.0, takes off sulfonation.(this step is de-sulfonation, and final volume is 265 μ L).
After de-sulfonation, add the dehydrated alcohol of-20 ℃ of low temperature precoolings of its 3 times of volumes (approximately 800 μ L), then add 40 μ g glycogens, be placed on 3 hours (or spending the night) of-20 ℃ of precipitations.Then, with the centrifugal 30min of 12000r/min at 4 ℃, remove supernatant liquor, collecting precipitation is in EP pipe and add 1ml Virahol, and the EP that softly tilts pipe, revolves and turn around, washing precipitation, rear 4 ℃ of centrifugal 10min of 12000r/min.Then repetitive operation centrifugal treating is again 1 time.
Outwell supernatant, the centrifugal 8s of normal temperature, will be attached to ethanol raffinate on EP inside pipe wall to managing at the end, with aseptic filter paper bar carefully by residual liquid exhaustion, and under room temperature air seasoning 3min.When precipitation is become when transparent from opaque, with micropipet, add 60 μ L sterilized waters, dissolve 5-10min, be the DNA solution after modification herein.
8. DNA solution after above-mentioned modification is carried out to met-PCR; Adopt 25 μ L systems.Be that DNA consumption is respectively 150ng.PCR system composition is: 2.5ul 10*buffer, 2.0ul DNTP, 0.5ul rTaq, 0.8ul primer and 150ng DNA (5ul), add water to 25ul.
PCR program is: 94 ℃ of denaturation 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min 2 circles; Adopt touchdown PCR, every two circles of annealing temperature were once being reduced.Until annealing temperature is reduced to 47 ℃, 47 ℃ of annealing are set to 19 circles, and 72 ℃ are extended 10min; 4 ℃ of interruptions, amount to 35 circles; 2% agarose gel electrophoresis separation (referring to Fig. 3) for pcr amplification product
Separately, above-mentioned gained PCR product is checked order, by the sequencing result Locus Analysis in Shoots that methylates, bisulfite makes, in DNA, methylated cytosine(Cyt) deaminizating does not occur and is transformed into uridylic, and methylated cytosine(Cyt) remains unchanged, with not carrying out pcr amplification containing the primer in any CpG site, in order to avoid difference methylates or non-methylate DNA during amplification.After amplification, uridylic all changes into thymus pyrimidine, to PCR product check order and with undressed sequence comparison, according to base, change (it is still CG that CG site occurs methylated, and not occurring methylated is TG) and judge whether CpG site methylates.
Visible heavy metal Cd is coerced the impact on Arabidopsis thaliana Seedlings mismatch repair gene MutL-homologue1 (MLH1) promoter methylation.(referring to Fig. 2)
From Fig. 2, compared with contrast standard, Cd concentration is 0,0.5,5.0 coerce, and the site that methylates is respectively 2,3,4.Can find out, along with Cd coerces the increase of concentration, methylation is in rising trend.And the variation in CG site and Cd coerce concentration obvious dose-effect relationship.Totally 11 CG sites as shown in the figure, wherein the circle of black represents that this site methylates.
9. by the conventional cloning and sequencing of above-mentioned products therefrom, obtain:
CGCACCAATGACTGATTACGCCAGCTTGCATGCCTGCAGGTCGACGATTACCCAATTAAATTCTAAAAACCCACTAATAACCCAAATTTATTTAAAATTATAATTTATCATCATATATACCTTTTTCCTTTCCCTAAACTACAAAAAATCATTCATTATAAAAATTAAAACAATAACAACAATAATCTACAATCTTCCAAAAAATTTAATCAAAAAAATCATTTCTAAAATTCCTTTAAAATCTATAAAAACGATAAAATTAACTTACAAAACTTAAAACAATTTATCCAAAAATAAAAATTTTACGAAAATACACATTAATAAAATAACAACACCAACAAAAAATAAAAAAACTATAATAATCATAATAATACCTCACAAACTTTATTTAATAAACAATATCATCAACTTTAATCCATCTATAAAAATTAAAAATCAACTTTTCATTCACAATAATCTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACAT
The Cd drawing coerces the sequence map that concentration is 0 MLH1 gene promoter
CCCACATGACTGATTACGCCAGCTTGCATGCCTGCAGGTCGACGATTACCCAATTAAATTCTAAAAACCCACTAATAACCCAAATTTATTTAAAATTATAATTTATCATCATATATACCTTTTTCCTTTCCCTAAACTACAAAAAATCATTCATTATAAAAATTAAAACAATAACAACAATAATCTACAATCTTCCAAAAAATTTAATCAGAAAAATCATTTCTAAAATTCCTTTAAAATCTATAAAAACGATAAAATTAACTTACAAAACTTAAAACAATTTATCCAAAAATAAAAATTTTACGAAAATACACATTAATAAAATAACAACACCAACAAAAAATAAAGAGACTATAATAATCATAATAATACCTCACAAACTTTATTTAATAAACAATATCGTCAACTTTAATCCATCTATAAAAATTAAAAATCAACTTTTCATTCACAATAATCTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCT
The Cd drawing coerces the sequence map that concentration is 0.5 MLH1 gene promoter
ATGGACATGATTACGCCAGCTTGCATGCCTGCAGGTCGACGATTACCCAATTAAATTCTAAAAACCCACTAATAACCCAAATTTATTTAAAATTATACTTTATCATCATATATACCTTTTTCCTTTCCCTAAACTACAAAAAATCATTCATTATAAAAATTAAAACAATAACAACAATAATCTACAATCTTCCAAAAAATTTAATCAAAAAAATCATTTCCAAAATTCCTTTAAAATCTATAAAAACGATAAAATTAACTTACAAAACTTAAAACAATTTATCCAAAAATAAAAATTTTACGAAAATACACATTGATAAAATAACAACACCAACAAAAAATAAAGAAACTATAATAATCACAATAATACCTCACAAACTTTATTTAATAAACAGTATCGTCGACTTTAATCCATCTATAGAAATTAAAAATCAACTTTTCATTCACAATAATCTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGT
The Cd drawing coerces the sequence map that concentration is 5.0 MLH1 gene promoter.
Embodiment 3
Adopt the existing original sulphite order-checking Marianne Frommer (1992) that checks order equally simultaneously, A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands, Proc.Nati.Acad.Sci.USA 89,1827-1831.), (referring to Fig. 1)
From Fig. 1, compared with contrast standard, Cd concentration is 0,0.5,5.0 coerce, and the site that methylates is respectively 5,5,4.(totally 11 CG sites, wherein the circle of black represents that this site methylates) do not have obvious variation tendency as shown in the figure.
Claims (4)
1. an improved sulphite sequence measurement, is characterized in that: genomic dna is cut to purifying through enzyme, add sulphite decorating liquid to unwind and modify after purifying; After modifying, purifying reclaims order-checking, realizes the order-checking of genomic dna; Described sulphite decorating liquid is 500-550ul, 100-120 μ LNaOH, 0.5-0.6mg watermiscible vitamin E (Trolox), 10-15 μ L triallylcyanurate, 0.037-0.040g tetraethylene pentamine five hydrochlorides (TETRAEN), 37.5-40.0 μ L guanidine hydrochloride solution, 0.3422-0.3800g Sodium Metabisulfite, 20-30 μ L Resorcinol and 100-120ul sterilized water; PH=5.0-5.1.
2. by improved sulphite sequence measurement claimed in claim 1, it is characterized in that: will in genomic dna, add EcoR I enzyme, Hind III enzyme, damping fluid and sterilized water to bathe 24-30h in water at normal temperature, centrifugal collection supernatant liquor after the mixed solution that adds enzyme to cut the isopyknic chloroform of system and primary isoamyl alcohol after water-bath enzyme is cut mixes;
Wherein damping fluid is 100mM Tris-Hcl (pH7.5), 100mM MgCl
2, 10mM dithiothreitol (DTT) (Dithiothreitol), 500mM NaCl;
After then adding 3M NaAC, 40-60 μ g glycogen and the 3.5-4 of its volume 1/10-1/5 in supernatant liquor doubly the precooling dehydrated alcohol of described supernatant liquor volume mixing, in-20 ℃ of precipitation incubated overnight;
Centrifugal collecting precipitation after incubated overnight, and in precipitation, add the dehydrated alcohol of precooling intermittently to mix, then centrifugal collecting precipitation, after air seasoning, add sterilized water, stand-by.
3. by improved sulphite sequence measurement claimed in claim 1, it is characterized in that: described after enzyme is cut purifying DNA at 93-95 ℃, through PCR, process 5-10min and make it become strand, by lysate static 1-5 minute in ice, after centrifugal 5-6S, add NaOH to mix after in 42-45 ℃ of water-bath 20-30min; After water-bath, in 30 μ L lysates, add 500 μ L sulphite decorating liquids to mix and carry out PCR processing modification.
4. by improved sulphite sequence measurement claimed in claim 3, it is characterized in that: 95 ℃ of reaction 3min in PCR instrument, 55 ℃ of 20min, 95 ℃ of 30s afterwards, 55 ℃ of 20min repeat three times, and last storage temperature is 20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210351597.5A CN103667432B (en) | 2012-09-20 | 2012-09-20 | Improved sulfite sequencing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210351597.5A CN103667432B (en) | 2012-09-20 | 2012-09-20 | Improved sulfite sequencing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667432A true CN103667432A (en) | 2014-03-26 |
| CN103667432B CN103667432B (en) | 2015-03-04 |
Family
ID=50306201
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210351597.5A Expired - Fee Related CN103667432B (en) | 2012-09-20 | 2012-09-20 | Improved sulfite sequencing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667432B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105907854A (en) * | 2016-04-28 | 2016-08-31 | 浙江省肿瘤医院 | Method for methylation and sulfurization transformative modification of genes and kit using method |
| CN108265050A (en) * | 2018-03-13 | 2018-07-10 | 普迈德（北京）科技有限公司 | A kind of method and its application of the direct bisulfite conversion of blood plasma |
| CN111593092A (en) * | 2020-05-29 | 2020-08-28 | 武汉爱基百客生物科技有限公司 | Method for converting and purifying DNA bisulfite |
| WO2021213321A1 (en) * | 2020-04-20 | 2021-10-28 | Mgi Tech Co., Ltd. | Dna protection agent in dna imaging buffer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101802223A (en) * | 2007-08-15 | 2010-08-11 | 香港大学 | methods and compositions for high-throughput bisulphite dna-sequencing and utilities |
| CN102409408A (en) * | 2010-09-21 | 2012-04-11 | 深圳华大基因科技有限公司 | Method for accurate detection of whole genome methylation sites by utilizing trace genome DNA (deoxyribonucleic acid) |
-
2012
- 2012-09-20 CN CN201210351597.5A patent/CN103667432B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101802223A (en) * | 2007-08-15 | 2010-08-11 | 香港大学 | methods and compositions for high-throughput bisulphite dna-sequencing and utilities |
| CN102409408A (en) * | 2010-09-21 | 2012-04-11 | 深圳华大基因科技有限公司 | Method for accurate detection of whole genome methylation sites by utilizing trace genome DNA (deoxyribonucleic acid) |
Non-Patent Citations (1)
| Title |
|---|
| MARIANNE FROMMER: "A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands", 《PNAS》, no. 89, 31 December 1992 (1992-12-31) * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105907854A (en) * | 2016-04-28 | 2016-08-31 | 浙江省肿瘤医院 | Method for methylation and sulfurization transformative modification of genes and kit using method |
| CN108265050A (en) * | 2018-03-13 | 2018-07-10 | 普迈德（北京）科技有限公司 | A kind of method and its application of the direct bisulfite conversion of blood plasma |
| WO2021213321A1 (en) * | 2020-04-20 | 2021-10-28 | Mgi Tech Co., Ltd. | Dna protection agent in dna imaging buffer |
| US11761040B2 (en) | 2020-04-20 | 2023-09-19 | Mgi Tech Co., Ltd. | DNA protection agent in DNA imaging buffer |
| CN111593092A (en) * | 2020-05-29 | 2020-08-28 | 武汉爱基百客生物科技有限公司 | Method for converting and purifying DNA bisulfite |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667432B (en) | 2015-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10858647B2 (en) | Removal of DNA fragments in mRNA production process | |
| CN106893721B (en) | A kind of kit and its application method screened for nucleic acid purification or segment | |
| CN109022417A (en) | A kind of paramagnetic particle method nucleic acid extraction conversion reagent box and its application method | |
| Rietveld et al. | The three‐dimensional folding of the tRNA‐like structure of tobacco mosaic virus RNA. A new building principle applied twice | |
| CN103667432B (en) | Improved sulfite sequencing method | |
| EP2066792B1 (en) | Nucleic acid purification method using anion exchange | |
| CN105462960A (en) | DNA sulfite conversion and purification method | |
| WO2008079302A3 (en) | Purification of proteins | |
| Weil | Cytoplasmic and organellar tRNAs in plants | |
| CN105734055B (en) | A kind of purification process for mulberry tree phytoplasma genome | |
| EP4163371A1 (en) | Nucleic acid extraction method and application | |
| Heinhorst et al. | Plastid and nuclear DNA synthesis are not coupled in suspension cells of Nicotiana tabacum | |
| CN109022419A (en) | A kind of preparation method of fragmentation DNA | |
| CN105085687B (en) | A kind of low temperature resistant GAP-associated protein GAP IbICE1 of sweet potato and its encoding gene and application | |
| CN105986020B (en) | Construct the method and device of sequencing library | |
| MX2009000122A (en) | A method of modifying a macromolecule without prior extraction from a sample. | |
| EP2171098B1 (en) | Methods for extraction and purification of components of biological samples | |
| CN113846088B (en) | Kit and method for extracting plasmid DNA | |
| CN112752842A (en) | Alkaline phosphatase composition, and method for producing dephosphorylated nucleic acid and labeled nucleic acid | |
| CN105256379A (en) | Method for preparing novel genome simplified methylation sequencing library | |
| CN113480632B (en) | Purification process of recombinant protein rhCG expressed in CHO (Chinese hamster ovary) cells | |
| CN109852668A (en) | A kind of simplified gene order-checking library and its banking process | |
| CN114807154B (en) | Modified nucleic acid and application thereof | |
| CN108795918A (en) | A kind of circumscribed-type chondroitinase ABC and the preparation method and application thereof | |
| CN101220390B (en) | Method for rapidly extracting plants sample DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150304 Termination date: 20150920 |
|
| EXPY | Termination of patent right or utility model |