CN103665141A - Protein interacted with clostridium difficile cytotoxin B - Google Patents

Protein interacted with clostridium difficile cytotoxin B Download PDF

Info

Publication number
CN103665141A
CN103665141A CN201310752493.XA CN201310752493A CN103665141A CN 103665141 A CN103665141 A CN 103665141A CN 201310752493 A CN201310752493 A CN 201310752493A CN 103665141 A CN103665141 A CN 103665141A
Authority
CN
China
Prior art keywords
cspg4
sequence
albumen
difficile
difficile infection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201310752493.XA
Other languages
Chinese (zh)
Other versions
CN103665141B (en
Inventor
魏文胜
袁鹏飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking University
Original Assignee
Peking University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking University filed Critical Peking University
Priority to CN201310752493.XA priority Critical patent/CN103665141B/en
Publication of CN103665141A publication Critical patent/CN103665141A/en
Application granted granted Critical
Publication of CN103665141B publication Critical patent/CN103665141B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4725—Proteoglycans, e.g. aggreccan
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4722—Proteoglycans, e.g. aggreccan

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a protein interacted with clostridium difficile cytotoxin B. The protein is chondroitin sulfate protein polysaccharide CSPG4 or a polypeptide formed by 640 amino acids at the N end of the CSPG4 protein. The invention firstly finds that the CSPG4 has the function of a clostridium difficile cytotoxin B cell receptor, the toxicity of the clostridium difficile cytotoxin B can be obviously reduced by restraining the expression or the function of the CSPG4, and a new thought is provided for treating the clostridium difficile infection.

Description

With the interactional albumen of G. difficile cytotoxin B
Technical field
The present invention relates to protein engineering field, specifically, relate to a kind of and interactional albumen of G. difficile cytotoxin B.
Background technology
Clostridium difficile (Clostridium difficile) is a kind of gram-positive microorganism of anaerobism, be found in the earliest nineteen thirty-five, until within 1978, find that this bacterium is relevant with the pseudomembranous enteritis that some microbiotic of clinical life-time service (penbritin, cephamycin, erythromycin, clindamycin etc.) causes, thereby come into one's own gradually.At present, scientific circles have generally acknowledged that C. difficile infection is the Etiological of antibiotic-associated diarrhea (antibiotic-associated diarrhoea, AAD) and pseudomembranous enterocolitis (pseudomenbranous colitis, PMC) clinically.(ANTIBIOTIC RESISTANCE THREATS in the United States in the file of Center for Disease Control and Prevention issue in 2013,2013) point out,, there are 250,000 people of surpassing on the Jin U.S. one ground every year by C. difficile infection, and wherein 14000 people are therefore dead.Every year because the required cost for the treatment of C. difficile infection is over 1,000,000,000 dollars.
Clostridium difficile is by two kinds of extracellular toxins of secretion, and enterotoxin A and cytotoxin B realize that it is pathogenic.Wherein, toxin B is considered to necessary extracellular toxin in C. difficile infection process (Lyras, 2009).Toxin B enters cell (Florin, 1983) by receptor-mediated endocytosis mechanism, further by glycosyl transferase activity, intracellular GTPase is lost activity, thereby make intestinal cells lost cell skeleton, cellular form changes, and intestinal cells function occurs abnormal, causes strong diarrhoea.
Because clostridium difficile has very strong resistance, there is no at present a kind of very effective method treatment C. difficile infection (Rupnik, 2009).At present, for the cell mechanism of C. difficile infection, know little, particularly toxin protein enters born of the same parents' mechanism, and applied host receptor albumen it be unclear that.
Summary of the invention
The object of this invention is to provide a kind of and interactional albumen of G. difficile cytotoxin B.
In order to realize the object of the invention, a kind of and the interactional albumen of G. difficile cytotoxin B of the present invention, it is chondroitin sulfate proteoglycan CSPG4, its aminoacid sequence is as shown in SEQID No.1, or this sequence is through replacing, lack or adding one or several amino acids formed aminoacid sequence with same function.
The interactional peptide C SPG4N1-640 of another kind of the present invention and G. difficile cytotoxin B, it is comprised of 640 amino acid of CSPG4 albumen n end, its aminoacid sequence is as shown in SEQ ID No.2, or this sequence is through replacing, lack or adding one or several amino acids formed aminoacid sequence with same function.
The present invention also provides a kind of medicine of anti-C. difficile infection, and its effective constituent is CSPG4 or CSPG4N1-640.
It is a kind of for diagnosing the reagent of C. difficile infection that the present invention also provides, and contains CSPG4 or CSPG4N1-640 in described reagent.
It is a kind of for diagnosing the test kit of C. difficile infection that the present invention also provides, and described test kit comprises mentioned reagent.
The present invention also provides the application of CSPG4 albumen in the anti-C. difficile infection medicine of preparation and diagnostic reagent.
The present invention also provides the application of peptide C SPG4N1-640 in the anti-C. difficile infection medicine of preparation and diagnostic reagent.
The present invention also provides CSPG4 gene targeting carrier, and its construction process comprises the following steps:
1) based on TALEN gene Knockout, adopt ULtiMATE method (Yang, 2013) assemble the DNA identification section for CSPG4 encoding sequence 5'-TCCAGCCCCCGGCCT-3' and 5'-CTGGCCAACATAGTC-3', and be finally cloned in pGL3-TALEN carrier;
2) gene knockout carrier based on CRISPR system, the CSPG4 encoding sequence 5'-TTGGCCAGACTTGCATCCG-3' of take is target sequence, by enzyme, cut, U6 promotor, target sequence and gRNA5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' are connected successively, and be cloned in pGL3-basic carrier, obtain CSPG4 gene targeting carrier.
The present invention also provides the host cell that contains above-mentioned targeting vector, its behaviour or mammalian cell.
The present invention finds that CSPG4 is the cell receptor of G. difficile cytotoxin B first.To CSPG4 expression inhibiting, can significantly reduce the toxicity of toxin B to cell.Consider the indispensable effect of toxin B in C. difficile infection, CSPG4 is by the important target spot that is treatment C. difficile infection.
CSPG4 gene (GenBank:NM_001897) is found as melanomatous mark at first, so far, has found that CSPG4 also brings into play certain effect in the growth of healthy tissues and function.The present invention finds that CSPG4 plays a key effect in toxic action at G. difficile cytotoxin B first.Suppress CSPG4 and express the toxicity that can significantly reduce G. difficile cytotoxin B.
The present invention, by building full genome shRNA library in conjunction with high throughput sequencing technologies, after cytotoxin B screening, finds that CSPG4 plays a crucial role in G. difficile cytotoxin B performance toxicity process first.By gene Knockouts such as TALEN and CRISPR, in HeLa and HT29 cell, suppress the expression of CSPG4 gene completely, obviously suppressed thus the toxicity of TcdB.Meanwhile, clone and expressed the N end peptide section CSPG4N1-640 of CSPG4 gene, and proved the cytotoxicity of this peptide section energy competitive inhibition toxin B.
Accompanying drawing explanation
Fig. 1 processes after 8 hours with 70pg/mL TcdB in the embodiment of the present invention 1, still contains and keeps obvious form, to the insensitive cell of TcdB in the cell of shRNA library.
Fig. 2 is that the shRNA that utilizes degree of depth order-checking to disclose for CSPG4 in the embodiment of the present invention 1 is suppressing to have obvious effect in TcdB toxicity.
Fig. 3 is wild-type HeLa in the embodiment of the present invention 2, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4 -/-/ CSPG4) under TcdB processes, cellular form changing conditions; Wherein, a. wild-type HeLa, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4-/-/CSPG4) metamorphosis situation after 0.1ng/mL TcdB processes eight hours; B. wild-type HeLa, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4 -/-/ CSPG4) metamorphosis situation when different concns TcdB processes.
Fig. 4 is wild-type HeLa in the embodiment of the present invention 2, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4 -/-/ CSPG4) under high density TcdB processes, necrocytosis situation.
Fig. 5 determines the relation of TcdB amount in CSPG4 expression amount and cytolemma by Western Blot in the embodiment of the present invention 3; Wherein, a. wild-type HeLa, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4 -/-/ CSPG4) CSPG4 expression amount is combined the amount of TcdB with cell surface; B. wild-type HeLa, CSPG4 gene knockout type HeLa(CSPG4 -/-) and CSPG4 cross expression type HeLa(CSPG4 -/-/ CSPG4) binding capacity of TcdB on CSPG4 expression amount and membrane structure in cell.
Fig. 6 is in the embodiment of the present invention 4 after SDS-PAGE electrophoresis, utilizes coomassie brilliant blue staining to identify the expression and purification situation of CSPG4N1-640.
Fig. 7 is that in the embodiment of the present invention 4, Pull-down detects proof TcdB and directly interaction of CSPG4N1-640 existence.The negative contrast of ANTXR1N-Fc.
Fig. 8 is used ImageXpress Micro XL Widefield High Content Screening System to observe the toxicity that CSPG4N1-640 can competitive inhibition TcdB in the embodiment of the present invention 5.
Embodiment
Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.If do not specialize, the conventional means that in embodiment, technique means used is well known to those skilled in the art, the raw materials used commercial goods that is.
The full genome shRNA library screening of embodiment 1
ShRNA library is purchased from Open-biosystem, and totally 65000 shRNA, for 20000 genes of the mankind.By slow virus system, this library is implemented in HeLa cell.Use the culture medium culturing 2 * 10 containing 70pg/mL TcdB 6individual HeLa cell, after 8 hours, is used pipettor to remove the cell being infected by TcdB, and is replaced by normal culture medium culturing 3 days.After repetitive operation 6 times, collection has the HeLa cell (Fig. 1) of resistance to TcdB, utilize primer (5'-ACGTCGAGGTGCCCGAAGGA-3' and 5'-TACATCTGTGGCTTCACTA-3') to carry out pcr amplification, further by the degree of depth, check order and determine the toxicity (Fig. 2) that can suppress TcdB for the shRNA of CSPG4.
Embodiment 2CSPG4 gene knockout
TALENs sequence for CSPG4 gene is as follows: 5'-TCCAGCCCCCGGCCT-3'(TALEN l), 5'-CTGGCCAACATAGTC-3'(TALEN r).The target sequence using in CRISPR system for CSPG4 gene is: 5'-TTGGCCAGACTTGCATCCG-3', gRNA sequence is: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3'.
TALENs or CRISPR system plasmid transfection are entered after cell, choose mono-clonal, and by Western Blot, determine the cell of CSPG4 gene knockout.Obtain after CSPG4 gene knockout clone, contrast wild-type HeLa cell, and CSPG4 crosses expression type Hela cell, uses TcdB to process, and by cell shape (Fig. 3) and necrocytosis (Fig. 4) isophenous, evaluates the toxicity of TcdB.
Embodiment 3CSPG4 expression amount directly affects the combination of TcdB and cell surface
After crossing expression HeLa cells Synchronous and cultivate by the HeLa cell of above-mentioned CSPG4 gene knockout with by the CSPG4 that slow virus is infected acquisition, with the substratum containing 10 μ g/mL TcdB, at 4 ℃, cultivate one hour.Further use PBS to clean 5 times, wash away the TcdB of not being combined with cell surface.After lysing cell, by Western Blot, determine that CSPG4 expression amount is combined the relation of TcdB amount with cell surface., with the substratum containing 10 μ g/mL TcdB, at 37 ℃, cultivate after half an hour meanwhile, use FractionPREP tMcell Fraction Kit isolated cell membrane structure, determines by Western Blot the relation (Fig. 5) that in CSPG4 expression amount and cytolemma, TcdB measures.
Embodiment 4CSPG4 albumen n end peptide section directly with TcdB interaction
The DNA sequence dna clone of front 640 amino acid polypeptides of coding CSPG4N end, from CSPG4cDNA, is loaded on pIRES2-Fc-eGFP carrier, after transfectional cell, can produce secretor type CSPG4N1-640Fc-tag fusion rotein and green fluorescent protein.This plasmid transfection is to Chinese hamster ovary celI, utilize flow cytometric sorting to go out the cell of expressing green fluorescent protein, these cells are collected substratum after continuing to cultivate, utilize HitrapProteinG pillar (GE) separation and purification obtain CSPG4N1-640 polypeptide (Fig. 6).
4 ℃ of overnight incubation in PBS by CSPG4N1-640 obtained above and TcdB, then use respectively ProteinA or Ni-NTA Superflow (QiaGen, 30450) absorption CSPG4N1-640 or TcdB, with PBS, wash after three times, by Western Blot, analyze interaction (Fig. 7) between the two.
The cytotoxicity of embodiment 5CSPG4 albumen n end peptide section competitive inhibition TcdB
By the good CSPG4N1-640(10 μ g/mL of purifying) and TcdB(100pg/mL) after 4 ℃ hatch 1 hour jointly, join in HeLa cell.With ImageXpress Micro XL Widefield High Content Screening System, by observation cellular form, change to evaluate the toxicity (Fig. 8) of TcdB.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements, all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Reference
Yang,J.,Yuan,P.,Wen,D.,Sheng,Y.,Zhu,S.,Yu,Y.,Gao,X.,and?Wei,W.(2013).ULtiMATE?system?for?rapid?assembly?of?customized?TAL?effectors.PLoS?One8,e75649.
Lyras,D.,O'Connor,J.R.,Howarth,P.M.,Sambol,S.P.,Carter,G.P.,Phumoonna,T.,Poon,R.,Adams,V.,Vedantam,G.,Johnson,S.,et?al.(2009).Toxin?B?is?essential?for?virulence?of?Clostridium?difficile.Nature458,1176-1179.
Florin,I.,and?Thelestam,M.(1983).Internalization?of?Clostridium?difficile?cytotoxin?into?cultured?human?lung?fibroblasts.Biochim?Biophys?Acta763,383-392.
Rupnik,M.,Wilcox,M.H.,&Gerding,D.N.(2009).Clostridium?difficile?infection:new?developments?in?epidemiology?and?pathogenesis.Nature?Reviews?Microbiology,7(7),526-536.
Figure IDA0000451218860000011
Figure IDA0000451218860000021
Figure IDA0000451218860000031
Figure IDA0000451218860000041
Figure IDA0000451218860000051
Figure IDA0000451218860000061
Figure IDA0000451218860000071
Figure IDA0000451218860000081
Figure IDA0000451218860000091
Figure IDA0000451218860000101

Claims (10)

1. with the interactional albumen of G. difficile cytotoxin B, it is characterized in that, it is chondroitin sulfate proteoglycan CSPG4, and its aminoacid sequence is as shown in SEQ ID No.1, or this sequence is through replacing, lack or adding one or several amino acids formed aminoacid sequence with same function.
2. with the interactional polypeptide of G. difficile cytotoxin B, it is characterized in that, it is comprised of 640 amino acid of CSPG4 albumen n end, its aminoacid sequence is as shown in SEQ ID No.2, or this sequence is through replacing, lack or adding one or several amino acids formed aminoacid sequence with same function.
3. a medicine for anti-C. difficile infection, is characterized in that, its effective constituent is polypeptide described in albumen or claim 2 described in claim 1.
4. for diagnosing a reagent for C. difficile infection, it is characterized in that, in described reagent, contain described in claim 1 polypeptide described in albumen or claim 2.
5. for diagnosing a test kit for C. difficile infection, it is characterized in that, described test kit comprises reagent described in claim 4.
The application of 6.CSPG4 albumen in the anti-C. difficile infection medicine of preparation and diagnostic reagent.
7. the application of polypeptide in the anti-C. difficile infection medicine of preparation and diagnostic reagent described in claim 2.
8.CSPG4 gene targeting carrier, its construction process comprises the following steps:
1), based on TALEN gene Knockout, adopt the assembling of ULtiMATE method for the DNA identification section of CSPG4 encoding sequence 5'-TCCAGCCCCCGGCCT-3' and 5'-CTGGCCAACATAGTC-3', and be finally cloned in pGL3-TALEN carrier;
2) gene knockout carrier based on CRISPR system, the CSPG4 encoding sequence 5'-TTGGCCAGACTTGCATCCG-3' of take is target sequence, by enzyme, cut, U6 promotor, target sequence and gRNA5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' are connected successively, and be cloned in pGL3-basic carrier, obtain CSPG4 gene targeting carrier.
9. the host cell that contains targeting vector described in claim 8.
10. host cell according to claim 9, is characterized in that, its behaviour or mammalian cell.
CN201310752493.XA 2013-12-31 2013-12-31 Albumen interactional with G. difficile cytotoxin B Active CN103665141B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310752493.XA CN103665141B (en) 2013-12-31 2013-12-31 Albumen interactional with G. difficile cytotoxin B

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310752493.XA CN103665141B (en) 2013-12-31 2013-12-31 Albumen interactional with G. difficile cytotoxin B

Publications (2)

Publication Number Publication Date
CN103665141A true CN103665141A (en) 2014-03-26
CN103665141B CN103665141B (en) 2015-09-16

Family

ID=50304001

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310752493.XA Active CN103665141B (en) 2013-12-31 2013-12-31 Albumen interactional with G. difficile cytotoxin B

Country Status (1)

Country Link
CN (1) CN103665141B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110088300A (en) * 2016-12-14 2019-08-02 默沙东公司 Human inheritance's marker relevant to the response for the treatment of of Clostridium difficile toxin B is targeted
CN116554300A (en) * 2023-04-27 2023-08-08 湖北医药学院 Polypeptide capable of interacting with clostridium difficile toxin TcdB and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010094970A1 (en) * 2009-02-20 2010-08-26 Health Protection Agency Antibodies to clostridium difficile toxins
CN103290033A (en) * 2013-06-20 2013-09-11 山东国际生物科技园发展有限公司 Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli
CN103388006A (en) * 2013-07-26 2013-11-13 华东师范大学 Method for constructing gene site-directed mutation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010094970A1 (en) * 2009-02-20 2010-08-26 Health Protection Agency Antibodies to clostridium difficile toxins
CN103290033A (en) * 2013-06-20 2013-09-11 山东国际生物科技园发展有限公司 Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli
CN103388006A (en) * 2013-07-26 2013-11-13 华东师范大学 Method for constructing gene site-directed mutation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BIRBRAIR,A.,ET AL.: "ACCESSION NO. NM_001897，Homo sapiens chondroitin sulfate proteoglycan 4(CSPG4),mRNA", 《GENBANK DATABASE》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110088300A (en) * 2016-12-14 2019-08-02 默沙东公司 Human inheritance's marker relevant to the response for the treatment of of Clostridium difficile toxin B is targeted
CN116554300A (en) * 2023-04-27 2023-08-08 湖北医药学院 Polypeptide capable of interacting with clostridium difficile toxin TcdB and application thereof
CN116554300B (en) * 2023-04-27 2023-10-24 湖北医药学院 Polypeptide capable of interacting with clostridium difficile toxin TcdB and application thereof

Also Published As

Publication number Publication date
CN103665141B (en) 2015-09-16

Similar Documents

Publication Publication Date Title
Peltier et al. Cyclic diGMP regulates production of sortase substrates of Clostridium difficile and their surface exposure through ZmpI protease-mediated cleavage
Sorg et al. Collective resistance in microbial communities by intracellular antibiotic deactivation
Kodani et al. The SapB morphogen is a lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces coelicolor
Kazemi‐Pour et al. The secretome of the plant pathogenic bacterium Erwinia chrysanthemi
Piepersberg et al. Effect of different mutaions in ribosomal protein S5 of Escherichia coli on translational fidelity
Berendt et al. Cell wall amidase AmiC1 is required for cellular communication and heterocyst development in the cyanobacterium Anabaena PCC 7120 but not for filament integrity
Uchida et al. Characterization of Actinoplanes missouriensis spore flagella
Nagar et al. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus
Xin et al. Three novel lantibiotics, ticins A1, A3, and A4, have extremely stable properties and are promising food biopreservatives
Sorokin et al. Wenzhouxiangella strain AB-CW3, a proteolytic bacterium from hypersaline soda lakes that preys on cells of gram-positive bacteria
Philippe et al. Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox
CN104830825A (en) Endolysin sourced from salmonella bacteriophage and application thereof
Gorasia et al. In situ structure and organisation of the type IX secretion system
Jackson et al. Identification of protein W, the elusive sixth subunit of the Rhodopseudomonas palustris reaction center-light harvesting 1 core complex
Gao et al. Cytophaga hutchinsonii gldN, encoding a core component of the type IX secretion system, is essential for ion assimilation, cellulose degradation, and cell motility
CN103665141B (en) Albumen interactional with G. difficile cytotoxin B
Vasilchenko et al. A novel high-molecular-mass bacteriocin produced by Enterococcus faecium: biochemical features and mode of action
Rebets et al. Characterization of sigma factor genes in Streptomyces lividans TK24 using a genomic library-based approach for multiple gene deletions
Suzuki et al. Isolation and structure determination of new linear azole-containing peptides spongiicolazolicins A and B from Streptomyces sp. CWH03
Fodor et al. Modular broad-host-range expression vectors for single-protein and protein complex purification
Liu et al. Analysis of the spore membrane proteome in Clostridium perfringens implicates cyanophycin in spore assembly
Zinger-Yosovich et al. Production and properties of the native Chromobacterium violaceum fucose-binding lectin (CV-IIL) compared to homologous lectins of Pseudomonas aeruginosa (PA-IIL) and Ralstonia solanacearum (RS-IIL)
Vasylkivska et al. Phenotypic and genomic analysis of Clostridium beijerinckii NRRL B-598 mutants with increased butanol tolerance
CN110452895B (en) Lysozyme from bacteriophage and gene and application thereof
Santamaria-Gomez et al. Sub-cellular localization and complex formation by aminoacyl-tRNA synthetases in cyanobacteria: evidence for interaction of membrane-anchored ValRS with ATP synthase

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant