CN103614495A - Joint detection kit for influenza viruses A and B and application thereof - Google Patents
Joint detection kit for influenza viruses A and B and application thereof Download PDFInfo
- Publication number
- CN103614495A CN103614495A CN201310638192.4A CN201310638192A CN103614495A CN 103614495 A CN103614495 A CN 103614495A CN 201310638192 A CN201310638192 A CN 201310638192A CN 103614495 A CN103614495 A CN 103614495A
- Authority
- CN
- China
- Prior art keywords
- influenza
- virus
- pcr
- probe
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention relates to the technical field of bio-detection, and in particular relates to a primer, a probe and a kit which jointly detect influenza viruses A and B in a single tube by a dual fluorescence PCR (Polymerase Chain Reaction) method. The nucleotide sequences of the primer and probe for dual fluorescence PCR detection of influenza viruses A and B are shown as SEQIDNO:1-6. The dual fluorescence PCR kit for jointly detecting the influenza viruses A and B comprises influenza viruses A and B detection mixed liquor which contains the primer and the probe. The influenza viruses A and B can be quickly detected by the kit and the probe provided by the invention, and the kit has the advantages of simplicity and convenience in operation, high sensitivity, good specificity and the like. Suspect cases can be immediately found and confirmed, so that the monitoring level on the diseases is improved.
Description
Technical field
The present invention relates to technical field of biological, be specifically related to a kind of double fluorescent PCR for A type and Influenza B virus and detect with primer, probe and test kit.
Background technology
Influenza Virus orthomyxoviridae family is RNA viruses.According to the difference of virus membrane antigen and nucleoprotein, influenza virus can be divided into first, second, the third three types.First, second, third has not only reflected that virus is found sequencing, has also reflected the size to the hazard rating of the mankind, animal.Influenza virus feature is easily to morph, and wherein influenza A virus the most easily morphs, and can infect people and many animals, and the para-influenzal main pathogen of behaving often causes and is very popular with medium and small popular.Can Influenza B virus variation be less, infect people other animals in addition so far uncertainly, causes outburst or little popular.The third type is more stable, can infect the mankind, mostly is Sporadic cases, has confirmed that at present pig also can be infected.According to virus surface hemagglutinin (HA) and the structure of neuraminidase (NA) and the difference of genetic characteristics thereof, can be divided into different subtype.Influenza A virus can be divided into 15 H hypotypes and 9 N hypotypes, and only 3 H hypotypes (H1, H2, H3) and 2 N hypotypes (N1, N2) are propagated in the human world.Some lower animals and avian species are natural reservoir (of bird flu viruses).Between Influenza B virus, have equally variation, but unallocated one-tenth hypotype changes.
Influenza virus mainly relies on laboratory definitely to diagnose, and traditional diagnostic method mainly comprises that serology detects and the separation of virus and two aspects of evaluation.In recent years, along with the fast development of Protocols in Molecular Biology, Protocols in Molecular Biology has also been widely used in the detection of influenza virus, wherein with fastest developing speed in influenza virus molecular diagnosis field with real-time fluorescence PCR technology again.Fluorescent RT-PCR technology is the new technology just growing up late nineteen nineties in last century, and the advantages such as it has fast, specificity, highly sensitive, cost is relatively low are widely used in all respects of clinical detection.But because influenza type is more, detect a sample and need to do the detection of multiple type influenza simultaneously, not only bothered but also cost of idleness, add that other detection method of single type can not meet the requirement that all influenza viruses detect, therefore set up the method that single tube multiple fluorescence PCR detects first, second, influenza virus C simultaneously and have very important significance
Summary of the invention
The object of the present invention is to provide a kind of utilize multiple fluorescence PCR method to A type and Influenza B virus in primer, probe, test kit and the detection method etc. of single tube joint-detection, can be used for clinical suspicious taint patient's etiology differential diagnosis.
First the present invention discloses a kind of double fluorescent PCR for A type and Influenza B virus and has detected with primer and probe, described primer and probe composed as follows:
Influenza A virus:
IFVA upstream primer: 5 '-GCTCTCATGGAGTGGMTA-3 ' (SEQ ID NO:1)
IFVA downstream primer: 5 '-CGTGAACACAAAYCCYAA-3 ' (SEQ ID NO:2)
IFVA probe: 5 '-fluorescence report group-ACAAGACCAATCCTGTCACCTCTG-fluorescent quenching group-3 ' (SEQ ID NO:3)
Influenza B virus
IFVB upstream primer: 5 '-GTTGGTTTGGTGGGAAAG-3 ' (SEQ ID NO:4)
IFVB downstream primer: 5 '-GATAAGGGYTCTGTGATGAA-3 ' (SEQ ID NO:5)
IFVB probe: 5 '-fluorescence report group-TGACCTAGACTCTGCCTTGGAATG-fluorescent quenching group-3 ' (SEQ ID NO:6);
Wherein, M=A/C, Y=T/C.
Double fluorescent PCR detection for A type and Influenza B virus specifically comprises two pairs of primers and each self-corresponding probe thereof with primer, and influenza A virus and Influenza B virus increase respectively.
Probe of the present invention be designed to prior art, probe one end is marked with fluorescence report group, the probe the other end is marked with fluorescent quenching group.Preferably, the fluorescence report group of described IFVA probe mark is FAM fluorophor, and the fluorescence report group of IFVB probe mark is VIC fluorophor; Described fluorescent quenching group is BHQ1.
Second aspect present invention discloses a kind of A type and Influenza B virus combined detection kit, comprises that first Influenza B virus detects mixed solution, and described first Influenza B virus detects in mixed solution and contains aforesaid primer and probe.
Preferably, described first Influenza B virus detects in mixed solution and also contains RT-PCR MIX and H
2o.
Optimum, described first Influenza B virus detects consisting of of mixed solution: IFVA upstream primer 0.75 μ l/test; IFVA downstream primer 0.75 μ l/test; IFVA probe 0.1 μ l/test; IFVB upstream primer 0.75 μ l/test; IFVB downstream primer 0.75 μ l/test; IFVB probe 0.1 μ l/test; RT-PCR MIX12.5 μ l/test; Distilled water 3.3 μ l/test.
Described first Influenza B virus detects in the composition of mixed solution, IFVA upstream primer, IFVA downstream primer, IFVB upstream primer, and the concentration of IFVB downstream primer is respectively 600nM/L, the concentration of IFVA probe and IFVB probe is respectively 100nM/L.
Preferably, in described double PCR detection kit, also comprise RT-PCR enzyme, negative control product (DEPC-H
2o), at least one in positive reference substance.
Positive reference substance of the present invention is the plasmid that contains IFVA object amplified fragments shown in SEQ ID NO:7, and/or the plasmid that contains IFVB object amplified fragments shown in SEQ ID NO:8.
And the sequence of IFVA object amplified fragments is:
5’-GCTCTCATGGAGTGGATAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTGTGTTCACG-3’ (SEQID NO：7)
The sequence of IFVB object amplified fragments is:
5’-GTTGGTTTGGTGGGAAAGAATTTGACCTAGACTCTGCCTTGGAATGGATAAAAAACAAAAGATGCTTAACTGATATACAAAAAGCACTAATTGGTGCCTCTATATGCTTTTTAAAACCCAAAGACCAGGAAAGAAAAAGAAGATTCATCACAGAGCCCTTATC-3’(SEQ ID NO：8)
The PCR detection system of the fluorescent PCR method that preferably, the double PCR test kit of A type of the present invention and Influenza B virus joint-detection adopts is as follows:
First Influenza B virus detects mixed solution 19 μ l
RT-PCR enzyme 1 μ l
Product to be tested 5 μ l
Reaction is totally 25 μ l.
Preferably, in the PCR system of test kit of the present invention, described product to be tested is sample nucleic acid extraction liquid, positive reference substance or negative control product (DEPC-H
2o).
In positive reference substance of the present invention, IFVA plasmid and IFVB plasmid can be packed separately, also can be hybrid packed.
The preparation method of sample nucleic acid extraction liquid of the present invention can be with reference to existing viral RNA extractive technique, specifically can adopt following method specifically to prepare: to get 100 μ l samples and be placed in 1.5ml centrifuge tube, add 300 μ l lysates (Trizol), add 100 μ l chloroforms, on vortex mixer, vibration mixes 5s or puts upside down and mixes 15 times again; The centrifugal 15min of 13000rpm, draws supernatant liquid, adds equal-volume Virahol, puts upside down and mixes the standing 10min of room temperature, and the centrifugal 10min of 13000rpm, removes supernatant gently; Add 700 μ l75% ethanol, put upside down washing, the centrifugal 5min of 13000rpm, remove gently supernatant, be inverted on thieving paper, abandon the centrifugal 5s of most liquid or 4000rpm, residual liquid on tube wall is thrown to pipe bottom, with micro sample adding appliance, blots liquid as far as possible, add 20 μ l DEPC-H
2o dissolves RNA, obtains sample nucleic acid extraction liquid.
Prepare the sample of sample nucleic acid extraction liquid of the present invention from human body nasal cavity or pharyngeal secretory product.
The pcr amplification program of test kit of the present invention is: 45 ℃ of 10min; 95 ℃ of 15min; 95 ℃ of 15sec and 60 ℃ of 60sec alternate cycles 45 times.Single-point fluoroscopic examination is at 60 ℃.
Fluorescence channel detects selects FAM and VIC passage.
Remarks: as used ABI Prism7500 real-time fluorescence PCR instrument, do all select " none " in passive reference and quencher place.
The using method of test kit of the present invention, comprises the following steps:
1) preparation of sample nucleic acid extraction liquid;
2) reagent preparation: detect in mixed solution and add RT-PCR enzyme to first Influenza B virus, vibration, centrifugal, obtains reaction mixture;
3) reaction mixture application of sample: by step 2) is placed in PCR pipe, sample nucleic acid extraction liquid, positive reference substance or negative control product are added respectively to the different PCR pipes that reaction mixture is housed, obtain corresponding sample reaction tubes, positive reaction pipe and negative control reaction tubes;
4) pcr amplification: reaction tubes is placed on quantitative fluorescence PCR instrument, and loop parameter is set, carries out pcr amplification;
5), after PCR reaction finishes, detect the fluorescent signal value of PCR reaction system, threshold setting principle with threshold line just above DEPC-H
2the vertex of O, fluorescence channel is selected FAM passage and VIC passage.
Test kit quality control: each reference substance of test kit must reach the requirement in following table 1, otherwise experiment be considered as invalid.
Table 1 test kit quality standard
The judging criterion of sample nucleic acid extraction liquid result is as shown in table 2:
Table 2 detected result judging criterion
If sample Ct value to be checked is between 42～45, need replication, as still between 42～45, be judged to lower than detectability, be reported as feminine gender.
The present invention finally discloses the aforementioned double fluorescent PCR for A type and Influenza B virus and has detected the application in preparing influenza A virus and/or B-mode avian flu virus detection reagent with primer and probe, aforementioned A type and Influenza B virus combined detection kit.
The present invention relates to two pairs of PCR primers specific amplification influenza A virus and Influenza B virus gene order respectively, 2 pairs of PCR primers can increase in same PCR reaction tubes simultaneously, realize double check, greatly shorten detection time, easy and simple to handle.Auele Specific Primer and and the design of probe guaranteed high conservative and the specificity of primer and probe, avoided between two pairs of primers and probe without complementary pairing or the situation of amplification of intersecting.The wavelength of fluorescence of two fluorophors that the present invention selects differs large and strength of signal is close, has avoided the phase mutual interference between signal.
Accompanying drawing explanation
Fig. 1: FAM passage influenza A sensitivity amplification curve diagram
Fig. 2: VIC passage second type influenza virus sensitivity amplification curve diagram
Fig. 3: sample 1 amplification curve diagram
Fig. 4: sample 2 amplification curve diagrams
Fig. 5: sample 3 amplification curve diagrams
Fig. 6: sample 4 amplification curve diagrams
Fig. 7: sample 5 amplification curve diagrams
Fig. 8: sample 6 amplification curve diagrams
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention, should be understood that following examples are only not used in and limit the scope of the invention for the present invention is described.
Embodiment 1 A type and B-mode double fluorescent PCR detection kit detect the design of primer probe and synthesize
At 5 ' flag F AM fluorophor of IFVA probe, 3 ' mark BHQ1 fluorescent quenching group of IFVA probe; At 5 ' mark VIC fluorophor of IFVB probe, 3 ' mark BHQ1 fluorescent quenching group of IFVB probe.Primer and the probe of synthetic IFVA and IFVB.
Influenza A virus
IFVA upstream primer: 5 '-GCTCTCATGGAGTGGMTA-3 ' (SEQ ID NO:1)
IFVA downstream primer: 5 '-CGTGAACACAAAYCCYAA-3 ' (SEQ ID NO:2)
IFVA probe: FAM-ACAAGACCAATCCTGTCACCTCTG-BHQ13 ' (SEQ ID NO:3)
Influenza B virus
IFVB upstream primer: 5 '-GTTGGTTTGGTGGGAAAG-3 ' (SEQ ID NO:4)
IFVB downstream primer: 5 '-GATAAGGGYTCTGTGATGAA-3 ' (SEQ ID NO:5)
IFVB probe: 5 ' VIC-TGACCTAGACTCTGCCTTGGAATG-BHQ1-3 ' (SEQ ID NO:6)
Wherein, the upstream and downstream primer of IFVA is degenerate primer, in degenerate primer, and M=A/C; Y=T/C.
By IFVA upstream primer 0.75 μ l/test; IFVA downstream primer 0.75 μ l/test; IFVA probe 0.1 μ l/test; IFVB upstream primer 0.75 μ l/test; IFVB downstream primer 0.75 μ l/test; IFVB probe 0.1 μ l/test; RT-PCR MIX(is purchased from Qiagen company) 12.5 μ l/test; Distilled water 3.3 μ l/test mix and are first Influenza B virus detection mixed solution.The described first Influenza B virus of preparation detects in the composition of mixed solution, IFVA upstream primer, IFVA downstream primer, IFVB upstream primer, be respectively 600nM/L with the final concentration of IFVB downstream primer, the final concentration of IFVA probe and IFVB probe is respectively 100nM/L.
The sensitivity analysis of the double PCR test kit of embodiment 3 A types and Influenza B virus joint-detection
1, experimental technique
1) preparation of sample:
The construction process of IFVA plasmid: adopt PCR method to increase to the nucleic acid of influenza A virus sample, obtain the nucleic acid fragment containing influenza A virus object extension increasing sequence (sequence shown in SEQID NO:7), primer sequence is as shown in SEQ ID NO:1-2.By after the fragment purification of amplification, by TA, be cloned on pMD8-T carrier, through order-checking, to identify, the correct recombinant vectors of sequencing result is transformed into DH5 α, and amplification obtains IFVA plasmid.
The construction process of IFVB plasmid: adopt PCR method to increase to the nucleic acid of Influenza B virus sample, obtain the nucleic acid fragment containing IFVB object extension increasing sequence (sequence shown in SEQID NO:8), primer sequence is as shown in SEQ ID NO:4-5.By after the fragment purification of amplification, by TA, be cloned on pMD8-T carrier, through order-checking, to identify, the correct recombinant vectors of sequencing result is transformed into DH5 α, and amplification obtains IFVB plasmid.
Get 2 * 10
6the influenza A positive reference substance of copies/ml (IFVA plasmid) and 2 * 10
6the second type influenza virus positive reference substance of copies/ml (IFVB plasmid) equal-volume mixes, and obtains 1 * 10
6copies/ml detects sample S1.Press 1:10,1:100,1:1000 dilution, obtain S2(1 * 10
5copies/ml), S3(1 * 10
4copies/ml), S4(1 * 10
3copies/ml).Using S1-S4 totally 4 parts as detecting sample.
2) reagent preparation:
Get the first Influenza B virus detection mixed solution of n * 19 μ l embodiment 2 and the RT-PCR enzyme of n * 1 μ l (purchased from Life technology company, trade(brand)name One-Step RT-PCR test kit), vibration mixes several seconds, centrifugal several seconds of 3000rpm (n is reaction tubes number).
3) application of sample:
Get each 20 μ l of above-mentioned each mixed solution and be placed in PCR pipe, then each 5 μ l of S1-S4 are added respectively in PCR reaction tubes, build PCR reaction tubes lid, carry out immediately pcr amplification reaction.
4) pcr amplification:
Reaction tubes is placed on quantitative fluorescence PCR instrument, recommends loop parameter setting:
45 ℃ * 10min; 95 ℃ * 15min; By 95 ℃ * 15sec → 60 ℃ * 60sec, circulate 45 times again; Single-point fluoroscopic examination is at 60 ℃.Reaction system is 25 μ l.
Fluorescence channel detects selects FAM and VIC passage.
Remarks: as used ABI Prism7500 real-time fluorescence PCR instrument, do all select " none " in passive reference and quencher place.
2. detected result:
Table 3 test kit sensitivity detected result
Fluorescent PCR amplification curve the results are shown in Fig. 1-2, and detected result is in Table 3.This experimental result shows: S1-S4 is all positive at FAM and the detection of VIC passage, shows that the detection sensitivity of test kit detection influenza A and second type influenza virus can reach 1 * 10
3copies/ml.
The use of embodiment 4 A types and Influenza B virus double fluorescent PCR detection kit
1, experimental technique
1) sample source:
6 routine samples are carried out to A type, Influenza B virus detection of nucleic acids.6 routine sample number 1-6,1-4 sample confirms to be respectively influenza A virus H1 hypotype, influenza A virus H3 hypotype, Influenza virus H1N1, Influenza B virus through order-checking; 5-6 sample is that influenza virus is negative.
2) sample process:
Get 100 μ l samples, be placed in 1.5ml centrifuge tube, add 300 μ l lysates (Trizol), then add 100 μ l chloroforms, on vortex mixer, vibration mixes 5sec or puts upside down and mixes 15 times; The centrifugal 15min of 13000rpm, draws supernatant liquid, adds equal-volume Virahol, puts upside down and mixes the standing 10min of room temperature, and the centrifugal 10min of 13000rpm, removes supernatant gently; Add 700 μ l75% ethanol, put upside down washing, the centrifugal 5min of 13000rpm, remove gently supernatant, be inverted on thieving paper, abandon the centrifugal 5sec of most liquid or 4000rpm, residual liquid on tube wall is thrown to pipe bottom, with micro sample adding appliance, blots liquid as far as possible, add 20 μ lDEPC-H
2o dissolves RNA, obtains sample nucleic acid extraction liquid.
3) reagent preparation:
Get n * 19 μ l first Influenza B virus and detect mixed solution (n is reaction tubes number) and n * 1 μ l RT-PCR enzyme (purchased from Life technology company, trade(brand)name One-Step RT-PCR test kit), vibration mixes several seconds, centrifugal several seconds of 3000rpm.
4) application of sample:
Get above-mentioned each mixed solution 20 μ l and be placed in PCR pipe, then each 5 μ l of 1-6 sample nucleic acid extraction liquid are added respectively in PCR reaction tubes, build PCR reaction tubes lid, carry out immediately pcr amplification reaction.
5) pcr amplification:
Reaction tubes is placed on quantitative fluorescence PCR instrument, recommends loop parameter setting:
45 ℃ * 10min; 95 ℃ * 15min; By 95 ℃ * 15sec → 60 ℃ * 60sec, circulate 45 times again; Single-point fluoroscopic examination is at 60 ℃.Reaction system is 25 μ l.
Fluorescence channel detects selects FAM and VIC passage.
Remarks: as used ABI Prism7500 real-time fluorescence PCR instrument, do all select " none " in passive reference and quencher place.
6) threshold setting:
Threshold setting principle with threshold line just above DEPC-H
2the vertex of O.
2, test-results:
Table 4 test kit detected result
Fluorescent PCR amplification curve the results are shown in Figure 3-8, and detected result is in Table 4.The multiple fluorescence PCR detected result of visible A type of the present invention and Influenza B virus combined detection kit is consistent with sequencing result, and primer of the present invention, probe and test kit can be used for the Identification and detection of influenza A virus and Influenza B virus.
Claims (10)
1. for the double fluorescent PCR of A type and Influenza B virus, detect with primer and a probe, it is characterized in that, described primer and probe composed as follows:
Influenza A virus
IFVA upstream primer: 5 '-GCTCTCATGGAGTGGMTA-3 '
IFVA downstream primer: 5 '-CGTGAACACAAAYCCYAA-3 '
IFVA probe: 5 '-fluorescence report group-ACAAGACCAATCCTGTCACCTCTG-fluorescent quenching group-3 '
Influenza B virus
IFVB upstream primer: 5 '-GTTGGTTTGGTGGGAAAG-3 '
IFVB downstream primer: 5 '-GATAAGGGYTCTGTGATGAA-3 '
IFVB probe: 5 '-fluorescence report group-TGACCTAGACTCTGCCTTGGAATG-fluorescent quenching group-3 '
Wherein, M=A/C, Y=T/C.
2. an A type and Influenza B virus combined detection kit, comprise that first Influenza B virus detects mixed solution, described first Influenza B virus detects and in mixed solution, contains the double fluorescent PCR for A type and Influenza B virus described in claim 1 and detect with primer and probe.
3. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, described first Influenza B virus detects in mixed solution and also contains RT-PCR MIX and H
2o.
4. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, described first Influenza B virus detects consisting of of mixed solution: IFVA upstream primer 0.75 μ l/test; IFVA downstream primer 0.75 μ l/test; IFVA probe 0.1 μ l/test; IFVB upstream primer 0.75 μ l/test; IFVB downstream primer 0.75 μ l/test; IFVB probe 0.1 μ l/test; RT-PCR MIX12.5 μ l/test; Distilled water 3.3 μ l/test.
5. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, described double PCR detection kit also comprises at least one in RT-PCR enzyme, negative control product, positive reference substance.
6. A type as claimed in claim 5 and Influenza B virus combined detection kit, it is characterized in that, described positive reference substance is the plasmid that contains IFVA object amplified fragments shown in SEQ ID NO:7, and/or the plasmid that contains IFVB object amplified fragments shown in SEQ ID NO:8.
7. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, the PCR detection system of the fluorescent PCR method that described double PCR test kit adopts is as follows:
First Influenza B virus detects mixed solution 19 μ l
RT-PCR enzyme 1 μ l
Product to be tested 5 μ l
Reaction is totally 25 μ l.
8. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, described product to be tested is sample nucleic acid extraction liquid, positive reference substance or negative control product.
9. A type as claimed in claim 2 and Influenza B virus combined detection kit, is characterized in that, the pcr amplification program of described test kit is: 45 ℃ of 10min; 95 ℃ of 15min; 95 ℃ of 15sec and 60 ℃ of 60sec alternate cycles 45 times.
10. described in claim 1, for the double fluorescent PCR of A type and Influenza B virus, detect with primer and probe A type and the application of Influenza B virus combined detection kit in preparation A type and/or Influenza B virus detection reagent described in the arbitrary claim of claim 2-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310638192.4A CN103614495B (en) | 2013-12-02 | 2013-12-02 | Joint detection kit for influenza viruses A and B and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310638192.4A CN103614495B (en) | 2013-12-02 | 2013-12-02 | Joint detection kit for influenza viruses A and B and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103614495A true CN103614495A (en) | 2014-03-05 |
| CN103614495B CN103614495B (en) | 2014-12-10 |
Family
ID=50165210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310638192.4A Active CN103614495B (en) | 2013-12-02 | 2013-12-02 | Joint detection kit for influenza viruses A and B and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103614495B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111748649A (en) * | 2020-06-13 | 2020-10-09 | 上海同进基因科技有限公司 | Fluorescent quantitative detection kit for simultaneously detecting human influenza virus and novel coronavirus |
| CN112410467A (en) * | 2020-11-23 | 2021-02-26 | 深圳市赛格诺生物科技有限公司 | Freeze-dried fluorescent RT-PCR reagent and method for detecting influenza A and B viruses |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942525A (en) * | 2010-05-06 | 2011-01-12 | 广州市华南医学病毒学研究所 | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit |
| CN102251061A (en) * | 2011-08-05 | 2011-11-23 | 江苏硕世生物科技有限公司 | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus |
-
2013
- 2013-12-02 CN CN201310638192.4A patent/CN103614495B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942525A (en) * | 2010-05-06 | 2011-01-12 | 广州市华南医学病毒学研究所 | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit |
| CN102251061A (en) * | 2011-08-05 | 2011-11-23 | 江苏硕世生物科技有限公司 | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus |
Non-Patent Citations (1)
| Title |
|---|
| 徐昌平等: "双重荧光定量RT-PCR快速检测A、B型流感病毒的研究", 《中国卫生检验杂志》, vol. 17, no. 9, 30 September 2007 (2007-09-30), pages 38 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111748649A (en) * | 2020-06-13 | 2020-10-09 | 上海同进基因科技有限公司 | Fluorescent quantitative detection kit for simultaneously detecting human influenza virus and novel coronavirus |
| CN112410467A (en) * | 2020-11-23 | 2021-02-26 | 深圳市赛格诺生物科技有限公司 | Freeze-dried fluorescent RT-PCR reagent and method for detecting influenza A and B viruses |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103614495B (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | CRISPR-Cas13a nanomachine based simple technology for avian influenza A (H7N9) virus on-site detection | |
| EP4012050A1 (en) | Composition, kit and method for detecting and typing viruses causing respiratory tract infection and application of composition, kit and method | |
| CN103275862A (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| AU2010244131B2 (en) | Generic assays for detection of influenza viruses | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| Qiu et al. | A reverse transcription-PCR for subtyping of the neuraminidase of avian influenza viruses | |
| CN101633964B (en) | RNA detection kit for influenza A H1N1 virus | |
| Tang et al. | A multiplex RT-PCR assay for detection and differentiation of avian H3, H5, and H9 subtype influenza viruses and Newcastle disease viruses | |
| Zhang et al. | Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses | |
| CN101649356B (en) | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof | |
| CN103740863B (en) | RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) kit for detecting avian influenza virus subtype H7N9 | |
| CN103276109A (en) | Avian influenza H7N9 virus RT-PCR (reverse transcription-polymerase chain reaction) detecting kit and detecting method | |
| CN104498622B (en) | For detecting the primer of influenza virus typing, probe and method | |
| CN108239677A (en) | A kind of influenza A genes parting detecting reagent | |
| Johnson et al. | Subtyping influenza A virus with monoclonal antibodies and an indirect immunofluorescence assay | |
| CN103320530B (en) | H1N1/H5N1 type avian influenza virus detection kit and application thereof | |
| CN103614495B (en) | Joint detection kit for influenza viruses A and B and application thereof | |
| CN102071263B (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN102649985B (en) | Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1N2 avian influenza viruses | |
| CN104593357A (en) | Nucleic acid for enterovirus detection, and applications thereof | |
| Guo et al. | Development and application of a recombinase-aided amplification and lateral flow assay for rapid detection of pseudorabies virus from clinical crude samples | |
| CN102230023A (en) | Dual fluorescence quantification RT-PCR detection kit and application thereof | |
| CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit | |
| CN101875979B (en) | Multi-PCR (Polymerase Chain Reaction) detection method of H5 subtype avian influenza virus variant strain | |
| Kuriakose et al. | Detection of avian influenza viruses and differentiation of H5, H7, N1, and N2 subtypes using a multiplex microsphere assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |