CN103609526B - The application of mitochondrial protein translation factor Guf1 in male sterile research - Google Patents

Abstract

The invention provides the purposes of model animals mouse in research male sterile mechanism knocking out Guf1 gene, more specifically, the invention provides the purposes of mouse model in research mankind arrenotoky, spermatogenesis and male sterile mechanism and treatment for Guf1 gene knockout, likely will become the male sterile a kind of diagnostic method of diagnosis.

Description

The application of mitochondrial protein translation factor Guf1 in male sterile research

Technical field

The present invention relates to the application of mitochondrial protein translation factor Guf1 in arrenotoky research.Particularly, the invention provides the purposes of model animals mouse in research male sterile process knocking out Guf1 gene, more specifically, the invention provides the purposes of mouse model in research mankind arrenotoky, spermatogenesis and male sterile mechanism and treatment for Guf1 gene knockout.

Background technology

At present, the whole world about has 15% married couple to be subject to infertile puzzlement, and azoospermia accounts for 19% in male sterility, become the common disease that affects male fertility because of.Sperm motility institute energy requirement is mainly from the oxidative phosphorylation of mitochondrial respiratory chain.If oxidation phosphorylation function is abnormal, enzymic activity or expression amount change and the variation etc. of Mitochondrial DNA all may cause plastosome energy dyssynthesis, reduce motility of sperm.Nineteen fifty-five, Hoffman-Berling first proving ATP is the energy derive of sperm tail motion, so mitochondrial structure and function state is one of important indicator evaluating sperm quality.The dependency of structure of mitochondria and dysfunction and low sperm activity causes concern in recent years.

Plastosome is the main cell device that cell carries out aerobic oxidation; every vital movement of cell is nearly all provide energy by Mitochondria; and the motion of sperm needs a large amount of energy supplies; therefore the oxidation phosphorylation function of mitochondria of sperms respiratory chain has vital effect to maintenance sperm normal vital; if its dysfunction directly may affect generation and the transmission of energy, cause sperm motility obstacle.At present, both at home and abroad some high oxygen consumptions, histoorgan that energy requirement is large are mainly concentrated on to the research of mitochondrial respiratory function and respiratory chain energy metabolism, as liver organization, cerebral tissue, cardiac muscular tissue etc., these high oxygen consumptions organize mitochondrial obstacle that membrane potential can be caused to decline, ATP generates and greatly reduces, and affects the function of histoorgan.And maintain sperm proper motion and need a large amount of Power supplies, therefore the research of mitochondria of sperms respiratory function and respiratory chain energy metabolism is just had great importance.

LepA can be combined the antiport causing tRNA as prokaryotic cell prokaryocyte protein translation elongation factor with rrna, can increase the fidelity of protein translation in vitro.The eukaryotic cell homologous protein Guf1 albumen of lepA is the albumen being positioned mitochondrial matrix guarded very much, the yeast cell having research that Guf1 protein mutation is described under cryogenic mitochondrial protein synthesis speed slows down, temperature raises mitochondrial cytochrome c oxidase activity and reduces, thus shows that Guf1 albumen is the fidelity factor important in mitochondrial protein synthesis process.Therefore the functional study of Guf1 albumen in higher animal body is even more important.

Summary of the invention

Our research finds that Guf1 albumen generates significant for mouse sperm.Guf1 protein knockout causes mouse sperm generating process to occur obstacle, and sperm number significantly reduces, and Sperm Motility declines, and further research finds that this is relevant with the Mitochondria functional defect of testis.Guf1 albumen causes mitochondrial protein to translate acceleration but translation product fidelity difference causes its degraded to accelerate to be likely the handicapped major reason of Mitochondria.

Our Late Cambrian Guf1 albumen in model animals mouse has important regulating and controlling effect to arrenotoky mitochondrial function.Knocking out of Guf1 protein coding gene can make mouse dyszoospermia, has a strong impact on spermatogenesis and the maturation of mouse, provides important target spot for studying arrenotokous mechanism and treating.

More specifically, the invention provides the following:

1. obtain an inhuman male sterile mammiferous method, described method comprises cultivate that Guf1 gene is knocked described mammiferous male.

2. the method according to 1, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

3. cause the method that inhuman boar is sterile, described method comprises the Guf1 abnormal gene expression making described boar.

4. the method according to 3, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

5.Guf1 gene is as the purposes of the target spot causing inhuman boar sterile.

6. the purposes according to 5, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

7. for the reagent that detects mammiferous Guf1 abnormal gene expression for the preparation of the purposes detected in described mammiferous male sterile diagnostic reagent.

8. the test kit for diagnosing boar sterile, described test kit comprises the reagent for detecting described mammiferous Guf1 gene unconventionality.

Accompanying drawing explanation

The strategy of Fig. 1: Guf1 gene knockout and PCR, protein immunoblot detect;

Fig. 2: the Guf1 male sterile pathological analysis caused knocked out;

Fig. 3: Guf1 knocks out increase spermoblast apoptosis, affects spermatogenesis;

The testis of Fig. 4: Guf1 knock-out mice and the transmission electron microscope observing of mitochondria of sperms;

Fig. 5: Guf1 albumen is on the impact of mitochondrial respiratory chain cpd function;

Fig. 6: Guf1 knocks out the impact on mitochondrial respiratory chain protein compound subunit;

Fig. 7: Guf1 knock out cause kytoplasm translate reduce and mTOR signal path reduction;

Fig. 8: Guf1 protein knockout copies plastosome, the impact of transcribing and translating.

Fig. 9: the preservation of human spermatogoa and the extraction of genomic dna thereof.

Embodiment

The strategy of embodiment 1, Guf1 gene knockout and PCR, protein immunoblot detect.

In order to study the function of Guf1 albumen in higher organism and which impact sudden change can produce to body.We select this model animals of mouse, use gene targeting to be knocked out by Guf1 albumen, and use the method for PCR and protein immunoblot to evaluate the efficiency knocked out.Fig. 1 is that the strategy of Guf1 protein knockout and PCR and protein immunoblot detect and knock out efficiency.Figure 1A shows that Guf1's knocks out the Guf1 knock out mice genotype that tactful Figure 1B represents PCR qualification.Figure 1B represents western blot and detects Guf1 knock out efficiency in mouse tissue.Result shows that Guf1 protein content significantly reduces in testis, prove further this albumen in mouse disallowable fall.

Concrete grammar:

The acquisition of Guf1 knock out mice:

The structure of Guf1 targeting vector: obtain Guf1 gene from the 129BAC (bMQ-420K22) clone (purchased from Welcome TrustSanger Institute) containing mouse Guf1 gene (nucleotide sequence of Guf1 gene is as shown in SEQ.ID.NO.1), as shown in Figure 1A.Loxp site (its sequence is GAATTCCTGCAGCCCAATTCCGATC) is added in this gene second to the 8th exon both sides, between exon 8 and exon 9, add the screening that neomycin resistance gene (neo gene, sequence is as shown in SEQ ID NO.2) carries out next step simultaneously.The sequence of targeting vector is as shown in SEQ ID NO.3.

The embryonic stem cell stage: after targeting vector has built, middle body target practice plasmid (about needing to prepare 100ug) electricity proceeds in embryonic stem cell mouse 129 cell (purchased from Nanjing biological medicine research institute) of homology, make the Guf1 gene on targeting vector and embryonic stem cell genome generation homologous recombination, namely on targeting vector, Guf1 exons 1 and exon 8 exchange with the identical sequence on embryonic stem cell Guf1 genome, and then are knocked out to exon 8 by the exon 2 of Guf1.Restructuring Embryonic stem cell clones is obtained, go forward side by side performing PCR and southernblot qualification by G418 and gancyclovir positive-negative selection.

Blastaea injection stage: the ES cell correctly hit that increases clones, microinjection is in the blastaea of C57BL/6 mouse (Nanjing biological medicine research institute), and this blastaea is transplanted to female mouse C57BL/6 (the Nanjing biological medicine research institute) intrauterine of replace-conceive, male and 2 the female Chi-meric mice of output 8.7 Male chimeras mouse and C57BL6 mouse hybrid, bear 20 hybrid mice (Guf1 ^flox/+).Hybrid mice Guf1 ^flox/+male and female mate, and produce offspring, and PCR qualification obtains Guf1 ^flox/foxmouse, carries out mating with EIIa-cre mouse (Military Medical Science Institute), obtains Guf1 and knocks out type and chimeric mice.

Clip and digestion mouse tail: mated by Guf1 genetic heterozygosis mouse, newborn wild, heterozygosis is with when knocking out the birth of type mouse to about 18 days, and from breast, point cage, gets out the scissors of sterilizing, tweezers, EP pipe, cotton ball soaked in alcohol.Deduct one section of about 0.5cm from newborn mice afterbody tip, put into EP pipe.Preparation mouse tail Digestive system (20mM Tris-HCl, 5mM EDTA, 0.4M sodium-chlor, 1% SDS, 400 μ g/ml Proteinase Ks), get 400 μ l and join in EP pipe, 55 degree of digestion are spent the night.

Extract mouse genome: by centrifugal for mouse Digestive system 11000rpm 5 minutes, supernatant is poured in a new EP pipe, adds 200 μ l saturated sodium-chlorides, teetertotter 200 times, place 10 minutes on ice, centrifugal 10 minutes of 14000rpm.Be poured into by supernatant in a new EP pipe, add 800 μ l dehydrated alcohols, centrifugal 5 minutes of 14000rpm, abandons supernatant, and precipitation DNA room temperature adds 50 μ l distilled waters after drying.

PCR identifies: synthesis PCR primers designed (the raw work synthesis in Shanghai), and primer sequence is as follows:

Loxpt F2：5’TTTGTCCTAAATGCGTGGTG 3’

Loxpt R2：5’CCCGCTCCCTAATAAAGATG 3’

Frtt R2：5’CGATCCCTGTACTCAAGACC 3’

Reaction system is as follows:

2x Taq mix：10μl

Loxpt F2：0.5μl

Loxpt R2(Frtt R2)：0.5μl

Genomic dna: 1.5 μ l

RT-PCR amplification condition: sex change-95 is spent, 5 minutes; Annealing-60 degree, 45 seconds; Extend-72 degree, 1 minute; Cycle index: 30 times; Finally extend condition-72 to spend, 10 minutes.PCR sample carries out agarose gel electrophoresis (gum concentration: 1%).

Protein immunoblot: mating is mated 6-8 wild-type in age in week that PCR qualification obtains and the Guf1 knock out mice neck that breaks and put to death, take out heart and testis tissue, PBS rinsing.Add RIPA lysate 1ml, put into tissue grinder's grinding, homogenate places 30 minutes on ice, centrifugal 30 minutes of 12000rpm, supernatant BCA kit measurement protein concentration.

Prepare 15% SDS-PAGE glue, will survey the sample of protein concentration, added the sample-loading buffer of certain volume, 95 degree of heating 15 minutes, get 50 μ g albumen and join in 15% SDS-PAGE glue, 100v constant voltage, runs 3 hours.

Transfer on pvdf membrane by the protein sample on glue, 5% skim-milk closes 1 hour, then adds the anti-Guf1 antibody (sigma) of 1:1000 dilution, overnight incubation.TBST washes film 5 times, each 5 minutes.Add the rabbit two anti-(JacksonImmunoResearch) of the horseradish peroxidase mark of 1:3000 dilution, hatch 1.5 hours.TBST (150mM NaCl, 20mM Tris-HCl, pH7.4, Tween-20 0.05%) adds the excess of imports quick ECL chemical illuminating reagent (green skies company) after washing film three times, puts into magazine and exposes.

The male sterile pathological analysis that embodiment 2, Guf1 gene knockout cause.

In order to the disappearance studying Guf1 further can cause those dysfunctions, we carry out pathological research to the reproduction of Guf1 knock out mice emphatically, comprise offspring's number, Sperm Motility, and the pathological section of testis and TEM (transmission electron microscope) analysis.Fig. 2 A represents the analysis of offspring's number, shows malely to knock out after type mouse and normal female mouse mate, and has mating behavior but does not produce offspring.Fig. 2 B adds up the sperm number of wild-type and Guf1 knock-out mice, shows that Guf1 knock-out mice sperm number significantly reduces.Fig. 2 C is that Testis Morphology is observed, and finds that the Testis Morphology of Guf1 knock-out mice diminishes.Fig. 2 D is confocal fluorescent microscopic examination sperm morphology, finds that knocking out type mitochondria of sperms sheath has disappearance, bending phenomenon, abnormalities.

Concrete grammar:

Arrenotoky capability analysis: get 6-8 week 20 wild-types in age respectively and Guf1 knocks out type mouse, the female mouse of CD1 in every mouse and two 6-7 age in week mates, every morning tests bolt, raise there being the mouse of cloudy bolt to take out separately, add up algebraically order thereafter, found that and 40 of wild-type mice mating female mouse, all see bolt, only have two not have offspring, all the other bear 4-12 only young mouse.And with knock out 40 female mouse of CD1 of type mouse mating, see bolt but there is no offspring.

Sperm number is added up: get 6-8 wild and knock out type mouse (n>3) for age in week, disconnected neck is put to death, and takes out epididymis, put into the plate that phosphate buffered saline buffer (PBS) is housed with scissors, pricked by epididymis broken with syringe, blood counting chamber counts.

Confocal fluorescent microscopic examination sperm morphology: get 6-8 wild and knock out type mouse (n>3) for age in week, disconnected neck is put to death, epididymis is taken out with scissors, epididymis is pricked broken by syringe, Hoechest and Mitotracker (invitrogen) PBS 1:10000 dilution, confocal fluorescent microscopic examination sperm.

Embodiment 3, Guf1 knock out increases spermoblast apoptosis, affects spermatogenesis.

In order to study the impact of Guf1 for mouse sperm generating process, we comprise testis to the reproductive organ that wild-type and Guf1 knock out male mouse and epididymis carries out section statining, and Sperm Motility analysis.Fig. 3 A, C are that the H & E knocking out type epididymis and testis dyes, and this result shows to knock out in type mouse epididymis and there is a large amount of prematurity spermoblasts.Fig. 3 B is the apoptosis phenomenon that TUNEL detects in testis and epididymis, shows produce obvious apoptosis phenomenon after Guf1 knocks out.Fig. 3 D, E are computer aided sperm analysis (computer assisted sperm analyzer, the CASA) analyses to Sperm Motility, and result shows that knock-out mice Sperm Motility obviously reduces.By the above pathological analysis knocked out Guf1, find that Guf1 knocks out and can cause spermatogenesis obstacle, cause male sterile.

Concrete grammar:

The H & E of epididymis and testis dyes:

Paraffin section: take off wild-type and Guf1 knock out mice testis and epididymis tissue, put into (the Polyfluoroalkoxy of fluoroalkyl compound excessively of 4%, PFA) fixing in, to prevent cell self-dissolving after death or the decomposition of bacterium, thus the morphological structure keeping cell original.

Dewater transparent: make dewatering agent with by lower concentration to the ethanol of high density, slough the moisture in tissue gradually.Then be put in transparent base dimethylbenzene transparent.

Waxdip embeds: will pour the paraffin melted in capsule into, and tissue is put in wherein, cooled and solidified.

Section and paster: be put in slicing machine by embedded wax stone, thinly slice, 5-8 μm, thin slice is put in the hot water of 42 degree and opens up sheet, is attached on slide glass, is put in thermostat container and dries.

Dewaxing dyeing: before dyeing, the paraffin section of oven dry is put in dimethylbenzene and sloughs paraffin, then via high density to low-concentration ethanol, finally join distilled water.Slice, thin piece is put in the phenodin aqueous solution several minutes that dyes, and running water adds distilled water for a moment after 1 hour, enter in 70% and 90% alcohol to dewater each 10 minutes.Add eosin stains liquid dyeing 2-3 minute.

Dewater transparent: after dyeing, section is through the ethanol dehydration of different concns, then makes section transparent through dimethylbenzene.

Sealing: upper natural gum is dripped in transparent good section, covered sealing.

TUNEL apoptosis detects:

Make the paraffin section of testis and epididymis, section dimethylbenzene embathes 2 times, each 5 minutes.Transparent good slice, thin piece is put in graded ethanol (100%, 95%, 90%, 80%, 70%) and respectively embathes 1 time, each 3 minutes.Slice, thin piece PBS washs 2 times.20 minutes are organized with the process of Proteinase K working fluid.PBS washs 2 times afterwards.Preparation TUNEL reaction mixture, the fluorescein-labeled dUTP liquid mixing of 50 μ l TdT+450 μ l.50 μ l TUNEL reaction mixtures are added, 37 degree of reactions 1 hour in dark wet box after slice, thin piece is dry.PBS rinsing 3 times.Take pictures.

Computer aided sperm analysis (CASA) evaluates the every kinematic parameter of sperm: get 6-8 wild-type in age in week and knock out each 4 of type mouse, its epididymis is taken out, sperm is placed in 37 degree of water-baths, counting cell puts pre-temperature on analyser temperature-constant plate, sperm sample post liquefaction is got mixing sample seminal fluid 1 and is dropped in the middle of sample pool, then analyzes.Section's computer-assisted semen analysis software (animal institute of the Chinese Academy of Sciences) in employing, analyzes semen parameters and motility of sperm and sperm averaged curve movement velocity (VCL), mean linear movement velocity (VSL), average path movement velocity (VAP), average beat frequency (BCF) etc.

Embodiment 4, the testis of Guf1 knock-out mice and the transmission electron microscope observing of mitochondria of sperms.

Research in the past shows, Guf1 is positioned mitochondrial albumen.In order to study the impact of Guf1 albumen on mitochondrial function, we study the structure of mitochondria of the reproductive organ of Guf1 knock-out mice and function.Fig. 4 is the impact that Guf1 knocks out on mouse testis and mitochondria of sperms form.Fig. 4 A, C represent spermatogonium and the spermatocyte transmission electron microscope of Guf1 protein knockout respectively, and result shows that Guf1 knock-out mice is grown spermatocyte Mitochondrial Shape and changed.Fig. 4 B, D represent the mitochondria of sperms sheath of Guf1 knock-out mice, and result display Guf1 disappearance can cause mitochondria of sperms form to occur obviously to change, and be embodied in mitochondria of sperms sheath plastosome and put irregular, interior ridge has defect.

Concrete grammar:

Testis and epididymis organize transmission electron microscope: testis and epididymis, from wild and knock out type mouse live body and take off, put into perosmic anhydride and fixed 1-2 hour.Fixing complete, dewater after 20 minutes with damping fluid rinsing.Dehydration gradient is followed successively by: 30% acetone, 50% acetone, 70% acetone, 80% acetone, 90% acetone, and every grade acts on 30 minutes.Pure acetone effect 3 times, each 30 minutes.Do ultrathin section(ing) after sample permeates, finally dye, first lead citrate dyes 10 minutes, goes the distilled water of carbonic acid gas to clean 3 times, then dyes 30 minutes with acetic acid uranium, and distilled water cleans 3 times.After ultrathin section(ing) drying, transmission electron microscope Tecnai Spirit (120KV) can be gone up and observe.

Embodiment 5, Guf1 albumen are on the impact of mitochondrial respiratory chain cpd function.

In order to study the impact of Guf1 for mitochondrial function further, we study Mitochondria system, in contrast with healthy tissues heart simultaneously.Fig. 3 A represents wild-type and knocks out the ATP level of type testis and epididymis, and result is presented at testis and epididymis ATP level when Guf1 knocks out and declines.Fig. 3 B represents the oxidasic activity of mitochondrial cytochrome c, and result shows that the activity of cytochrome c oxidase in the testis that Guf1 knocks out and epididymis reduces.Fig. 3 C represents each mixture of Blue native PAGE analytical line mitochondrial respiratory chain, and result shows that the amount of cytochrome c oxidase obviously reduces knocking out in type testis and epididymis.Fig. 3 D represents the BNG dyeing of cytochrome c oxidase, and result shows that the activity of cytochrome c oxidase obviously reduces.Fig. 3 E represents line grain composite I, the active coloring of Complex II and mixture V, and result shows composite I, the activity of V, II does not have considerable change.

Concrete grammar:

ATP level determination: get 6-8 wild-type in age in week and the testis, the epididymis that knock out type mouse, PBS washes three times.Testis removes tunica albuginea, and sterilizing blade is by testis, and epididymis shreds, the trysinization of 0.25%, each 5 minutes, totally 15 minutes.Obtain unicellular, after lysis, centrifugal 10 minutes of 13000rpm, supernatant BCA kit measurement protein concentration.Get 5 μ l samples and add 50 μ l ATP detection buffer, chemoluminescence microplate reader (Perkin Elmer, USA) detector detects.

Blue Native PAGE: according to plastosome separating kit (Abcam) separating mouse heart and testis plastosome, BCA kit measurement protein concentration.Get 400 μ g plastosome 12000rpm centrifugal 5 minutes, it is resuspended to add 40 μ l buffer A (50mM sodium-chlor, 50mM imidazoles/hydrochloric acid, 1mMEDTA, pH 7.0).Often pipe adds 12 μ l Digitonin, and mixing acts on 10 minutes on ice.100000g, 4 degree centrifugal 30 minutes, gets supernatant, adds 5 μ l glycerine and 6 μ l Xylene Brilliant Cyanine Gs.Get 20 μ l samples and carry out Blue-native PAGE separate mitochondria mixture, method sees reference document (Ilka Wittig etc., nature 2006).

Composite I is active: Blue-native PAGE separation gel is incubated in 50mM Tris-Hcl, (containing 0.5mM NBT (Nitroblue tetrazolium chloride in pH 7.4 damping fluid, chlorination nitro tetrazole), 5mM NADH (Nicotinamide adenine dinucleotide, Reduced nicotinamide-adenine dinucleotide)), room temperature effect 1 hour.

Complex II is active: Blue-native PAGE separation gel is incubated in 50mM Tris-Hcl, (0.2mM PMS (Methylphenaziniummethylsulfate in pH 7.4 damping fluid, phenazinium methyl sulfate), 84mM succsinic acid, 50mM NBT), room temperature effect 1 hour.

Complex IV is active: Blue-native PAGE separation gel is incubated in 50mM Tris-Hcl, in pH 7.4 damping fluid (containing 0.1% diaminobenzidine, 24 unit/ml catalases, 0.1% cytochrome c), and 37 degree of effect 3-6 hour.

Mixture V is active: by the clear water rinsing 10 minutes of Blue-native PAGE separation gel, and the glycine buffer (pH 8.6) putting into 0.1M acts on 1 hour.Again separation gel is put into the damping fluid containing following ingredients: 35mM Tris alkali, 270mM glycine, 14mM magnesium sulfate, 5mMATP, 0.2% Silver Nitrate, 37 degree of effect 3-6 hour.

Embodiment 6, Guf1 knock out the impact on mitochondrial respiratory chain protein compound subunit.

More than research shows that Guf1 knocks out the active obviously decline of the electron transport chain cytochrome c oxidase that can cause mouse testis and epididymis, so we study the amount of each complex subunit of mitochondrial electron transport chain, in contrast with healthy tissues heart simultaneously.Figure A represents the western blot result of each sub-albumen of composite I-V in heart and testis and epididymis, result display to knock out in the testis of type mouse and epididymis Cox IV (nuclear gene encoding) in complex IV, and the amount of Cox1, Cox2 (chondriogen group coding) significantly reduces.In composite I, ND2 amount reduces, and NDUFA9 amount is without any change.In Complex II I, the amount of cytochrome b (CYTB) reduces knocking out in type testis, and the Core2 amount of core coding is constant.In Complex II, the amount of 70kd Fp does not change.In mixture V, ATP5A amount does not also change.Figure B is that the result of Blue native western blot shows that the amount of mitochondrial complex IV reduces further.Figure C is that Blue-native 2D result illustrates that the amount of each sub-albumen of complex IV reduces more remarkable compared with each sub-protein content of other mixture.

Concrete grammar:

Protein immunoblot (western blot): get the 6-8 week wild-type in age and Guf1 and knock out the type mouse neck that breaks and put to death, take out mouse heart, testis and epididymis tissue, PBS rinsing.Add RIPA lysate 1ml, add proteinase inhibitor cocktail (Roche) simultaneously, put into tissue grinder and grind, homogenate places 30 minutes on ice, centrifugal 30 minutes of 12000rpm, supernatant BCA kit measurement protein concentration.

Prepare 15% SDS-PAGE glue, will survey the sample of protein concentration, add the albumen sample-loading buffer of certain volume, 95 degree of heating 15 minutes, get a certain amount of albumen and join in 15%SDS-PAGE glue, 100v constant voltage, electrophoresis 3 hours.

Transfer on pvdf membrane by the protein sample on glue, 5% skim-milk closes 1 hour, and then different primary antibodie (Abcam) is diluted to specifications, overnight incubation.TBST (150mM NaCl, 20mM Tris-HCl, pH7.4, Tween-20 0.05%) washes film 5 times, each 5 minutes.Two anti-1:3000 dilutions, hatch 1.5 hours.TBST adds the excess of imports quick ECL chemical illuminating reagent (green skies company) after washing film three times, puts into magazine and exposes.

Blue-native 2D: first carry out Blue native PAGE electrophoresis according to above experimental technique, is then placed in stationary liquid and fixes 1 hour, coomassie brilliant blue staining more than 2 hours by glue.Glue is cut, is put in 1% mercaptoethanol (trace tetrabromophenol sulfonphthalein) and places 1 hour.Preparation 10%Tricine-SDS-PAGE, is placed in the spacer gel of Tricine-SDS-PAGE, constant current 20mA, coomassie brilliant blue staining after electrophoresis by glue, decolouring.

Embodiment 7, Guf1 knock out and cause kytoplasm to translate reduction and the reduction of mTOR signal path.

In order to study the function of Guf1 gene in eukaryotic cell, we study signal path change that Guf1 causes and kytoplasm translation skill discloses Guf1 meaning in vivo with this.Fig. 4 A is the phosphorylation chip results of testis, and result display Guf1 is main relevant to cancer, and mTOR signal path correlative protein expression reduces simultaneously.Fig. 4 B is the expression that western blot verifies mTOR signal path associated protein, and result shows that the Thr37/46 phosphorylation level of the substrate 4E-BP in mTOR downstream declines, consistent with chip results.Fig. 4 C is that cytoribosome display technique observes kytoplasm translation skill, found that knocking out the translation of type mouse kytoplasm reduces.

Concrete grammar:

Protein immunoblot (western blot): get 6-8 wild-type in age in week and Guf1 and knock out the type mouse neck that breaks and put to death, take out mouse heart and testis tissue, PBS rinsing.Add RIPA lysate 1ml, add proteinase inhibitor cocktail (Roche) and inhibitors of phosphatases (Roche), put into tissue grinder's grinding, homogenate places 30 minutes on ice, centrifugal 30 minutes of 12000rpm, supernatant BCA kit measurement protein concentration.

Preparation 15%SDS-PAGE glue, will survey the sample of protein concentration, has added the albumen sample-loading buffer of certain volume, and 95 degree of heating 15 minutes, get a certain amount of albumen and join in 15%SDS-PAGE glue, 100v constant voltage, electrophoresis 3 hours.

Transfer on pvdf membrane by the protein sample on glue, 5% skim-milk closes 1 hour, and then different primary antibodie (Cell signal technology) is diluted, overnight incubation to specifications.After TBST (150mM NaCl, 20mM Tris-HCl, pH7.4, Tween-20 0.05%) washes film 5 times, two anti-(horseradish peroxidase-labeled) 1:3000 dilute, and hatch 1.5 hours.TBST adds the excess of imports quick ECL chemical illuminating reagent (green skies company) after washing film 5 times, puts into magazine and exposes.

Cytoribosome display technique:

Preparation TMK lysis buffer:

The 1M Tris-Cl of 10mM Tris-Cl, pH 7.4:1ml

The 1M magnesium chloride of 10mM magnesium chloride: 0.5ml

The 1M Repone K of 100mM Repone K: 10ml

1％(v/v)Triton X-100：1ml

0.5% (w/v) Sodium desoxycholate: 0.5g

1U/ml RNA enzyme inhibitors: 2.5 μ l 40U/ μ l

The 1M DTT of 2mM DTT:200 μ l

Cycloheximide: 0.1mg/ml

Add DEPC-H ₂o to 100ml.

Preparation 10%-50% sucrose: prepare with DEPC water at 4 degree.

The preparation (200ml) of 10% (w/v) sucrose solution:

Sucrose: 20g

The 1M Repone K of 100mM Repone K: 20ml

The magnesium chloride of 5mM magnesium chloride: 1ml

The 1M DTT of 2mM DTT:400 μ l

The 1M HEPES of 20mM HEPES, pH 7.4:4ml

The preparation (200ml) of 50% (w/v) sucrose solution:

Sucrose: 100g

The 1M Repone K of 100mM Repone K: 20ml

5mM magnesium chloride: 1ml of magnesium chloride

The 1M DTT of 2mM DTT:400 μ l

The 1M HEPES of 20mM HEPES, pH 7.4:4ml

With adding 2 μ l (40U/ μ l) RNA enzyme inhibitors and 50 μ l cycloheximides (100 μ g/ μ l) before in 50ml sucrose.Be put in gradient mix device preparation gradient.

Wild-type and Guf1 knock out the type mouse neck that breaks and put to death, and take out heart and testis immediately and are put in quick-frozen in liquid nitrogen, without the mortar grinder powdered of RNA enzyme, be poured in EP pipe, add TMK lysate, cracking on ice 5 minutes.Centrifugal 20 minutes of 13000g.Supernatant is laid in the saccharose gradient of 10%-50%.Centrifugal 4 hours of 26000rpm.Detection of nucleic acids instrument A260 detects.

Embodiment 8, Guf1 protein knockout copy plastosome, the impact of transcribing and translating.

Research in yeast shows, Guf1 is important mitochondrial protein translation factor.In order to study Guf1 impact on mitochondrial protein synthesis in eukaryotic cell further.We have done following research, and figure A measures the copy number that wild-type and Guf1 knock out the heart of type mouse, testis and epididymis Mitochondria DNA, and result shows that the copy number of Mitochondrial DNA increases to some extent.Figure C, E is the mRNA level in-site representing each complex proteins of plastosome, wherein C is the result of testis, E figure is heart result, result shows that the mRNA level in-site of each complex proteins of plastosome is in wild-type with knock out in type heart and testis and do not have considerable change, and Guf1 knocks out transcribing of not effect string mitochondrial DNA.Figure B is the amount change of mitochondrial ribosome large subunit L11 and small subunit ribosome S18, and the amount that result display knocks out L11 and S18 in type testis has increased slightly.Figure D is mitochondrial protein In Vitro Translation, and result shows in the testis knocked out at Guf1, and the in vitro translated amount of mitochondrial protein increases.

Concrete grammar:

The mensuration of mitochondria DNA copy number:

Extraction wild-type and Guf1 knock out the heart of type mouse and the DNA of testis, the primer of the cox1 gene primer that synthetic thread mitochondrial DNA (mtDNA) is encoded and the ndufv1 gene that nucleus DNA (nDNA) is encoded.With the genomic dna of heart and testis for template, qPCR increases cox1 and ndufv gene.The ratio of cox1 and ndufv represents mtDNA/nDNA.

Plastosome each complex proteins qPCR:Trizol reagent extraction wild-type and Guf1 knock out the total serum IgE of type mouse heart and testis, with 2 μ g total serum IgE for template, with moloney murine leukemia virus reversed transcriptive enzyme (Molony murine leukemia virus reverse transcriptase, MoMuLVRT) be template, with poly thymus pyrimidine (oligo (dT)) for primer synthesis cDNA. reference literature synthesis 16S rRNA, 12S rRNA, ND1, ND6, NDUFS3, NDUFS7, NDUFB6, NDUFA9 (nadh dehydrogenase subunit), Cox1, Cox2 (cytochrome oxidase subunit), CytB (cytochrome reductase subunit, cytochrome b), ATP6 (ATP synthetic enzyme subunit), EF-Tu (EF-T U) primer.RT-PCR reaction is carried out at ABIStepOne plus quantitative PCR apparatus with SYBR Green Master Mix (Takara, Japan) reagent.

Mitochondrial protein In Vitro Translation: extract with plastosome separating kit (Abcam) heart and the testis plastosome that wild-type and Guf1 knock out type mouse, BCA kit measurement mitochondrial protein concentration.100 μ g plastosome 12000g are centrifugal, precipitation reaction buffer 37 degree of reactions 1 hour.Reaction buffer composition is as follows: 25mM sucrose, 75mM sorbyl alcohol, 1mM magnesium chloride, 0.05mMEDTA, 10mM Tris-HCl, 10mM dipotassium hydrogen phosphate, 10mM glutaminate, 2.5mM oxysuccinic acid, 1mM ADP, 1mg/ml defatted bovine serum albumin, 100 μ g/ml sphingosyl galactosides, 100 μ g/ml cycloheximides, 0.2mM aminoacid mixture, the RNA enzyme inhibitors of 1 unit.

After having reacted, centrifugal 5 minutes of sample 12000g, with cold buffer liquid (320mM sucrose; 1mM EDTA; 10mM Tris-HCl, pH7.4) wash 3 times, precipitation adds 1x albumen sample-loading buffer 25 μ l, and 95 degree of heating 10 minutes, carry out 15%-20% SDS-PAGE electrophoresis.Make dry glue, pressure phosphorus screen.

The preservation of embodiment 9, human spermatogoa and the extraction of genomic dna thereof

The sperm (Tianjin hospital general) getting the sterile patient of 400 microlitre extracts genome, then checks order, Fig. 9 A represent extraction be numbered 1,2,3 patient's genome, result display extracts successfully.Checked order by above-mentioned DNA, Fig. 9 B represents sequencing result, and the 5 ' untranslated end that result is presented at the people guf1 gene of reproduction abnormality has the disappearance of two bases (TC).This experimental program that we adopt can successfully obtain sperm exonic DNA sequence, the site suddenlyd change by compare of analysis, therefore can become the basis that makes test kit.

Concrete grammar:

Sampling: room temperature water solubilisate (or 37 DEG C of water-bath liquefaction)

Frozen:

The sperm of liquefaction and frozen storing liquid are mixed by 1:1 and dropwise slowly adds, add while mix; 4 DEG C freezing 30 minutes, and liquid nitrogen 15 minutes is frozen.

Sperm DNA extracts:

1. get 200 μ l sperm+200 μ l Buffer X2 in 1.5ml centrifuge tube, 55 DEG C of water-baths at least 1 hour (1.5 hours), put upside down mixing every 10 minutes;

2. add Buffer AL (in QIAGEN DNA extraction kit composition) (may produce precipitation, 70 DEG C can the dissolve) vortex oscillation 15 seconds of 400 μ l, hatch 10 minutes for 70 DEG C, simply centrifugal, by the water droplet on lid from getting off;

3. add the ethanol (95%-100%) of 400 μ l, vortex oscillation mixes 15 seconds, simply from the water droplet (may produce precipitation, precipitate result without impact) on dry lid;

4. the 3rd step mixture is added in reaction column, centrifugal 1 minute of 8000rpm, change post (if from clean, recentrifuge) in a new 2ml collection tube;

5. add 500 μ l AW1 (in QIAGEN DNA extraction kit composition), centrifugal 1 minute of 8000rpm, change post in a new collection tube;

6. add 500 μ l AW2 (in QIAGEN DNA extraction kit composition), centrifugal 3 minutes of 14000rpm;

7. renew collection tube, centrifugal 1 minute of 14000rpm void column;

8. change a new 1.5ml centrifuge tube, add 100 μ l Buffer AE (in QIAGEN DNA extraction kit composition) or distilled water, room temperature places 1 minute, 8000rpm, centrifugal 1 minute (AE should add several times herein, guarantees that on pillar, the wash-out of DNA is abundant).

Table 1: the primer table of people guf1 gene extron order-checking

Primer label	Primer sequence	Order-checking exon
			1F	ACTGACAGTACACACACCACAG	1st exon
1R	AAGTTAGTGACTTGCCCAAGG	1st exon
			2F	CTGATTGGCCCTAAAAATTG	2 to the 4 exon
2R	ACTAGTCAATTCCAGAGAATGC	2 to the 4 exon
			3F	TGACCCCAAAGACATAAGTTG	5th exon
3R	GTGAGTTTCAGTTGCACTTCTG	5th exon
			4F	TATTGTAGAGGGGTCAGTTAGG	6th exon
4R	AGTGATAAAACCTTTGAGCCTC	6th exon
			5F	TACCCAGATTTCGAACTATTCC	7 to the 8 exon
5R	TCAACTGACGTTTCTATTGTCC	7 to the 8 exon
			6F	TAAGACCTGGTGTGTTCATTTG	9th exon
6R	AACACATCCTAAATGATCTCCC	9th exon
			7F	TTGGAGTGCAAATCTAGTTG	10th and 11 exons
7R_1	AATCCGCAACGTGAAACAG	10th exon
			7R_2	GTTCTTCATCATTAGCCATAGG	11st exon
8F	CATGTAAGTGGCAATCTGTTC	12nd exon
			8R	CTTTCCTTTGGGCTAACATATC	12nd exon

9F	TTTGGTAGCAAGCCTAATGC	13rd exon
			9R	TGTTCCAAGTCATTCTAACC	13rd exon
10F	GATGGAAACATATCTCTTTGGG	14th exon
			10R	GGTGAAGGGAAACATTTCTATG	14th exon
11F	TCCATTTGAACCTCCTTAAGAG	15th exon
			11R	AAACTGGAGAGCACCATCATAC	15th exon
12F	CAAGCCTTGACCATTTTTTC	16th exon
			12R	CATGGTCAAGCTGAAATTTACC	16th exon
13F	CTCCATCCAGATTAAATCCTG	17th exon
			13R	CATGGCTTCAAAATCTAAGCTC	17th exon

Reference:

1.Acin-Perez，R.，Fernandez-Silva，P.，Peleato，M.L.，Perez-Martos，A.，and Enriquez，J.A.(2008).Respiratory active mitochondrial supercomplexes.Mol Cell 32，529-539.

2.Ashley，T.，Gaeth，A.P.，Creemers，L.B.，Hack，A.M.，and de Rooij，D.G.(2004).Correlation of meiotic events in testis sections and microspreads of mouse spermatocytesrelative to the mid-pachytene checkpoint.Chromosoma 113，126-136.

3.Azia，A.，Unger，R.，and Horovitz，A.(2012).What distinguishes GroEL substratesfrom other Escherichia coli proteins？The FEBS journal 279，543-550.

4.Barrientos，A.，Barros，M.H.，Valnot，I.，Rotig，A.，Rustin，P.，and Tzagoloff，A.(2002).Cytochrome oxidase in health and disease.Gene 286，53-63.

5.Bauerschmitt，H.，Funes，S.，and Herrmann，J.M.(2008).The membrane-boundGTPase Guf1 promotes mitochondrial protein synthesis under suboptimal conditions.TheJournal of biological chemistry 283，17139-17146.

6.Bruno，C.，Martinuzzi，A.，Tang，Y.，Andreu，A.L.，Pallotti，F.，Bonilla，E.，Shanske，S.，Fu，J.，Sue，C.M.，Angelini，C.，et al.(1999).A stop-codon mutationin the human mtDNA cytochrome c oxidase I gene disrupts the functional structure ofcomplex IV.American journal of human genetics 65，611-620.

7.Caldas，T.，Laalami，S.，and Richarme，G.(2000).Chaperone properties of bacterialelongation factor EF-G and initiation factor IF2.The Journal of biological chemistry 275，855-860.

8.Collins，T.J.，Berridge，M.J.，Lipp，P.，and Bootman，M.D.(2002).Mitochondriaare morphologically and functionally heterogeneous within cells.The EMBO journal 21，1616-1627.

9.De Martino，C.，Floridi，A.，Marcante，M.L.，Malorni，W.，Scorza Barcellona，P.，Bellocci，M.，and Silvestrini，B.(1979).Morphological，histochemical and biochemicalstudies on germ cell mitochondria of normal rats.Cell and tissue research 196，1-22.

10.Enders，G.C.，and May，J.J.，2nd(1994).Developmentally regulated expression ofa mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male andfemale mice.Developmental biology 163，331-340.

11.Folgero，T.，Bertheussen，K.，Lindal，S.，Torbergsen，T.，and Oian，P.(1993).Mitochondrial disease and reduced sperm motility.Human reproduction 8，1863-1868.

12.Fontanesi，F.，Soto，I.C.，Horn，D.，and Barrientos，A.(2006).Assembly ofmitochondrial cytochrome c-oxidase，a complicated and highly regulated cellular process.American journal of physiology Cell physiology 291，C1129-1147.

13.Iadevaia，V.，Huo，Y.，Zhang，Z.，Foster，L.J.，and Proud，C.G.(2012).Rolesof the mammalian target of rapamycin，mTOR，in controlling ribosome biogenesis andprotein synthesis.Biochemical Society transactions 40，168-172.

14.Kao，S.，Chao，H.T.，and Wei，Y.H.(1995).Mitochondrial deoxyribonucleic acid4977-bp deletion is associated with diminished fertility and motility of human sperm.Biology of reproduction 52，729-736.

15.Koppen，M.，and Langer，T.(2007).Protein degradation within mitochondria：versatile activities of AAA proteases and other peptidases.Critical reviews in biochemistryand molecular biology 42，221-242.

16.Lee，I.，and Suzuki，C.K.(2008).Functional mechanics of the ATP-dependent Lonprotease-lessons from endogenous protein and synthetic peptide substrates.Biochimica etbiophysica acta 1784，727-735.

17.Li，Y.C.，Hu，X.Q.，Zhang，K.Y.，Guo，J.，Hu，Z.Y.，Tao，S.X.，Xiao，L.J.，Wang，Q.Z.，Han，C.S.，and Liu，Y.X.(2006).Afaf，a novel vesicle membrane protein，is related to acrosome formation in murine testis.FEBS Lett 580，4266-4273.

18.Luce，K.，Weil，A.C.，and Osiewacz，H.D.(2010).Mitochondrial protein qualitycontrol systems in aging and disease.Advances in experimental medicine and biology 694，108-125.

19.Meinhardt，A.，McFarlane，J.R.，Seitz，J.，and de Kretser，D.M.(2000).Activinmaintains the condensed type of mitochondria in germ cells.Molecular and cellularendocrinology 168，111-117.

20.Metodiev，M.D.，Lesko，N.，Park，C.B.，Camara，Y.，Shi，Y.，Wibom，R.，Hultenby，K.，Gustafsson，C.M.，and Larsson，N.G.(2009).Methylation of 12S rRNA isnecessary for in vivo stability of the small subunit of the mammalian mitochondrialribosome.Cell metabolism 9，386-397.

21.Mundy，A.J.，Ryder，T.A.，and Edmonds，D.K.(1995).Asthenozoospermia andthe human sperm mid-piece.Human reproduction 10，116-119.

22.Nakada，K.，Sato，A.，Yoshida，K.，Morita，T.，Tanaka，H.，Inoue，S.，Yonekawa，H.，and Hayashi，J.(2006).Mitochondria-related male infertility.Proceedingsof the National Academy of Sciences of the United States of America 103，15148-15153.

23.Pan，Y.，and Shadel，G.S.(2009).Extension of chronological life span by reducedTOR signaling requires down-regulation of Sch9p and involves increased mitochondrialOXPHOS complex density.Aging 1，131-145.

24.Piomboni，P.，Focarelli，R.，Stendardi，A.，Ferramosca，A.，and Zara，V.(2012).The role of mitochondria in energy production for human sperm motility.Int J Androl 35，109-124.

25.Qin，Y.，Polacek，N.，Vesper，O.，Staub，E.，Einfeldt，E.，Wilson，D.N.，and Nierhaus，K.H.(2006).The highly conserved LepA is a ribosomal elongation factor thatback-translocates the ribosome.Cell 127，721-733.

26.Rajender，S.，Rahul，P.，and Mahdi，A.A.(2010).Mitochondria，spermatogenesisand male infertility.Mitochondrion 10，419-428.

27.Ramalho-Santos，J.，Varum，S.，Amaral，S.，Mota，P.C.，Sousa，A.P.，and Amaral，A.(2009).Mitochondrial functionality in reproduction：from gonads and gametes toembryos and embryonic stem cells.Hum Reprod Update 15，553-572.

28.Reyes，J.G.，Farias，J.G.，Henriquez-Olavarrieta，S.，Madrid，E.，Parraga，M.，Zepeda，A.B.，and Moreno，R.D.(2012).The hypoxic testicle：physiology andpathophysiology.Oxidative medicine and cellular longevity 2012，929285.

29.Ruiz-Pesini，E.，Diez，C.，Lapena，A.C.，Perez-Martos，A.，Montoya，J.，Alvarez，E.，Arenas，J.，and Lopez-Perez，M.J.(1998).Correlation of sperm motility withmitochondrial enzymatic activities.Clinical chemistry 44，1616-1620.

30.Savel'ev，A.S.，Novikova，L.A.，Kovaleva，I.E.，Luzikov，V.N.，Neupert，W.，and Langer，T.(1998).ATP-dependent proteolysis in mitochondria.m-AAA proteaseand PIM1 protease exert overlapping substrate specificities and cooperate with the mtHsp70system.The Journal of biological chemistry 273，20596-20602.

31.Schieke，S.M.，Phillips，D.，McCoy，J.P.，Jr.，Aponte，A.M.，Shen，R.F.，Balaban，R.S.，and Finkel，T.(2006).The mammalian target of rapamycin(mTOR)pathwayregulates mitochondrial oxygen consumption and oxidative capacity.The Journal ofbiological chemistry 281，27643-27652.

32.Shoji，S.，Janssen，B.D.，Hayes，C.S.，and Fredrick，K.(2010).Translation factorLepA contributes to tellurite resistance in Escherichia coli but plays no apparent role in thefidelity of protein synthesis.Biochimie 92，157-163.

33.Smits，P.，Smeitink，J.，and van den Heuvel，L.(2010).Mitochondrial translationand beyond：processes implicated in combined oxidative phosphorylation deficiencies.Journal of biomedicine & biotechnology 2010，737385.

34.Spiropoulos，J.，Turnbull，D.M.，and Chinnery，P.F.(2002).Can mitochondrial DNAmutations cause sperm dysfunction？Molecular human reproduction 8，719-721.

35.St John，J.C.，Facucho-Oliveira，J.，Jiang，Y.，Kelly，R.，and Salah，R.(2010).Mitochondrial DNA transmission，replication and inheritance：a journey from the gametethrough the embryo and into offspring and embryonic stem cells.Hum Reprod Update 16，488-509.

36.Stiburek，L.，and Zeman，J.(2010).Assembly factors and ATP-dependent proteasesin cytochrome c oxidase biogenesis.Biochimica et biophysica acta 1797，1149-1158.

37.Suzuki，H.，Ueda，T.，Taguchi，H.，and Takeuchi，N.(2007).Chaperone propertiesof mammalian mitochondrial translation elongation factor Tu.The Journal of biologicalchemistry 282，4076-4084.

38.Tatsuta，T.(2009).Protein quality control in mitochondria.J Biochem 146，455-461.

39.Thorrez，L.，Van Deun，K.，Tranchevent，L.C.，Van Lommel，L.，Engelen，K.，Marchal，K.，Moreau，Y.，Van Mechelen，I.，and Schuit，F.(2008).Using ribosomalprotein genes as reference：a tale of caution.PloS one 3，e1854.

40.Tiranti，V.，Corona，P.，Greco，M.，Taanman，J.W.，Carrara，F.，Lamantea，E.，Nijtmans，L.，Uziel，G.，and Zeviani，M.(2000).A novel frameshift mutation of themtDNA COIII gene leads to impaired assembly of cytochrome c oxidase in a patientaffected by Leigh-like syndrome.Human molecular genetics 9，2733-2742.

41.Tsukihara，T.，Aoyama，H.，Yamashita，E.，Tomizaki，T.，Yamaguchi，H.，Shinzawa-Itoh，K.，Nakashima，R.，Yaono，R.，and Yoshikawa，S.(1996).The wholestructure of the 13-subunit oxidized cytochrome c oxidase at 2.8 A.Science 272，1136-1144.

42.Wallace，D.C.(1999).Mitochondrial diseases in man and mouse.Science 283，1482-1488.

43.Wang，X.，and Proud，C.G.(2006).The mTOR pathway in the control of proteinsynthesis.Physiology(Bethesda)21，362-369.

44.Wilson，K.S.，and Prochaska，L.J.(1990).Phospholipid vesicles containing bovineheart mitochondrial cytochrome c oxidase and subunit III-deficient enzyme：analysis ofrespiratory control and proton translocating activities.Archives of biochemistry andbiophysics 282，413-420.

Claims (8)

1. obtain an inhuman male sterile mammiferous method, described method comprises cultivate that Guf1 gene is knocked described mammiferous male.

2. method according to claim 1, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

3. cause the method that inhuman boar is sterile, described method comprises the Guf1 abnormal gene expression making described boar.

4. method according to claim 3, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

5.Guf1 gene is as the purposes of the target spot causing inhuman boar sterile.

6. purposes according to claim 5, wherein said Mammals is mouse, and the sequence of described Guf1 gene is as shown in SEQ ID NO:1.

7. for the reagent that detects mammiferous Guf1 abnormal gene expression for the preparation of the purposes detected in described mammiferous male sterile diagnostic reagent caused by Guf1 abnormal gene expression.

8., for diagnosing the sterile test kit of boar caused by Guf1 abnormal gene expression, described test kit comprises the reagent for detecting described mammiferous Guf1 gene unconventionality.