CN103571787B - Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products - Google Patents
Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products Download PDFInfo
- Publication number
- CN103571787B CN103571787B CN201310475345.8A CN201310475345A CN103571787B CN 103571787 B CN103571787 B CN 103571787B CN 201310475345 A CN201310475345 A CN 201310475345A CN 103571787 B CN103571787 B CN 103571787B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- grease
- production
- mevalonic acid
- intestinal bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products. The Escherichia coli disclosed by the invention is a recombinant bacterium obtained by introducing grease metabolic pathway from Ralstonia eutropha into an Escherichia coli, and an exogenous high-activity grease metabolic degeneration enzyme system is introduced into the Escherichia coli through genetic modification, thus improving the grease utilization ratio of the Escherichia coli. Using the constructed Escherichia coli for production of mevalonic acid through fermentation has the advantages of mild conversion process and high conversion rate, and effectively lowers the production cost; and the method lays a solid foundation for industrial application of mevalonic acid and isoprene biosynthesis.
Description
Technical field
The present invention relates to a kind of intestinal bacteria of efficient metabolism grease and the application in bio-based chemicals production thereof.
Background technology
Mevalonate pathway is widespread in nature, mevalonic acid and its downstream derivative thing such as isoprene and isoprenoid compounds can be obtained by the recombinase of expressing the mevalonate pathway of external source in engineering bacteria, as the utilizing works large intestine fermentative production mevalonic acid such as Tabata (Tabata et al., 2004Biotechnology Letters, 26:1487-1491), the Genencor company utilizing works Escherichia coli fermentation of the U.S. produces isoprene (Whited et al., 2010Industrial Biotechnology, 6:152), utilizing works intestinal bacteria synthesis isoprenoid compounds (the Piteta et al. such as Piteta, 2007Metabolic Engineering, 9:193-207), although the host that above-mentioned research and utilization is different and different enzymes carry out the fermentation of mevalonic acid and downstream derivative thing isoprenoid compounds, all having a common ground, is that raw material ferments exactly with sugar.In theory, the sugar of 1.5 molecules can only generate the mevalonic acid of 1 molecule by mevalonate pathway, and therefore Theoretical Mass transformation efficiency only has 52%, and lower to the fermentation yield of mevalonic acid downstream pathway product as isoprenoid compounds.Because the productive rate adopting sugar to produce isoprenoid compounds for raw material by engineering bacterium fermentation is lower, limit its commercial applications.
Summary of the invention
The invention provides a kind of intestinal bacteria of efficient metabolism grease, is in intestinal bacteria, introduce the recombinant bacterium that the fat metabolic approach from Ralstonia eutropha obtains.
The described fat metabolic approach from Ralstonia eutropha is numbered five genes of H16_A0460 to H16_A0464 in Ralstonia eutropha Ralstonia eutropha H16 genome (the NCBI number of logging in: NC_008313.1) (in NCBI, NC_008313.1 genome Locus tag numbers: H16_A0460, H16_A0461, H16_A0462, H16_A0463, H16_A0464).
The intestinal bacteria of FadR gene preferably five channel genes being numbered H16_A0460 to H16_A0464 in above-mentioned Ralstonia eutropha Ralstonia eutropha H16 genome are knocked out.
Described intestinal bacteria are any known intestinal bacteria, preferred standard bacterial strain BL21(DE3) or JM109(DE3).
Present invention also offers a kind of colibacillary construction process of efficient metabolism grease, is in intestinal bacteria, introduce the fat metabolic way from Ralstonia eutropha.
Further, described intestinal bacteria are the intestinal bacteria having knocked out FadR gene, have preferably knocked out the BL21(DE3 of FadR gene) or JM109(DE3).
Specifically, the colibacillary construction process of described efficient metabolism grease is as follows:
1) the knocking out of FadR gene, according to existing intestinal bacteria reference culture JM109(DE3) genomic information, find the gene order of each 500 bases of FadR gene upstream and downstream to merge into the sequence of 1,000 bases, and add the 15bp homology arm identical with plasmid pRE112 multiple clone site two ends at 5 ' end respectively with 3 ' end; According to sequence information chemosynthesis linear DNA fragment as shown in SEQ ID NO.1; The linear DNA fragment of universal suicide plasmid pRE112 and synthesis is reassembled as novel plasmid pJZ1, pJZ1 is proceeded to intestinal bacteria X7213 by heat-shock transformed method, and pJZ1 is imported JM109(DE3 by intestinal bacteria X7213 by the mode of being transduceed by bacterium) carry out FadR gene knockout;
2) H16_A1526 to H16_A1531 gene cluster is introduced in engineering strain, extract the genome (the NCBI number of logging in: NC_008313.1) of alcaligenes eutrophus Ralstoniaeutropha H16, according to the alcaligenes eutrophus Ralstonia eutropha H16 genomic information announced, design primer contains the DNA fragmentation of H16_A0460 to H16_A0464 gene from the genome amplification of alcaligenes eutrophus Ralstonia eutropha H16, add the homology arm sequence that 15bp is identical with plasmid pBBR1MCS-2 respectively respectively during synthesis at the two ends of sequence; By the partial sequence of recombination bunch fragment and universal expression plasmid pBBR1MCS-2, be reassembled as new expression vector pBBR-H16HZ1, sequence is as shown in SEQ ID NO.2;
3) recombination bacillus coli expression vector pBBR-H16HZ1 being proceeded to step 1) structure obtains intestinal bacteria ZM1.
Above-mentioned intestinal bacteria can efficient metabolism grease.
Present invention also offers a kind of method of fermentative production mevalonic acid, concrete steps are as follows:
1) from intestinal bacteria reference culture BL21(DE3) or JM109(DE3), knock out the FadR gene on its genome;
2) five the channel genes intestinal bacteria being numbered H16_A0460 to H16_A0464 in Ralstonia eutropha Ralstonia eutropha H16 genome are expressed;
3) will the enzyme channel genes step 2 of synthesis mevalonic acid) intestinal bacteria that obtain;
4) intestinal bacteria utilizing step 3) to obtain with vegetables oil or lipid acid for carbon source through fermentation production first hydroxyl penta.
Further, the intestinal bacteria that the present invention builds can transform lipid substrate efficiently and generate mevalonic acid, further for fermentative production isoprene, this conversion process under mild conditions (30-37 DEG C) is carried out, and carbon source is higher to the transformation efficiency of mevalonic acid and downstream derivative thing isoprene, effectively reduce production cost, the method is that the industrial applications of biosynthesizing mevalonic acid and isoprene lays a solid foundation.
Embodiment
Embodiment 1: for intestinal bacteria reference culture JM109(DE3) genomic genetic modification, the i.e. gene cluster knocked out and express from being numbered H16_A1526 to H16_A1531 gene in alcaligenes eutrophus H16 genome of FadR gene.
knocking out of FadR gene.Intestinal bacteria reference culture JM109(DE3) be used as basic bacterial strain and carry out genetic modification further.According to existing intestinal bacteria reference culture JM109(DE3) genomic information, find the gene order of each 500 bases of FadR gene upstream and downstream to merge into the sequence of 1,000 bases, and add the 15bp homology arm identical with plasmid pRE112 multiple clone site two ends at 5 ' end respectively with 3 ' end; According to the linear DNA fragment (SEQ IDNO.1) of sequence information chemosynthesis about 1 kilobase.Utilize In-Fusion HD test kit (Takara, article No. 639648) by universal suicide plasmid pRE112(Addgene company) and synthesis linear DNA fragment be reassembled as novel plasmid pJZ1, pJZ1 is proceeded to intestinal bacteria X7213(from German Culture Collection by traditional heat-shock transformed method).PJZ1 is imported JM109(DE3 by intestinal bacteria X7213 by the mode of then being transduceed by bacterium) carry out FadR gene knockout, this operation steps and consistent (the Edwards et al. of standard method using suicide plasmid to carry out gene knockout, 1998Gene, 207:149).
H16_A1526 to H16_A1531 gene cluster is introduced in engineering strain.Knock out the JM109(DE3 of FadR gene) be used as starting strain and carry out genetic modification further.Extract the genome (the NCBI number of logging in: NC_008313.1) of alcaligenes eutrophus Ralstonia eutropha H16, according to the alcaligenes eutrophus Ralstonia eutropha H16 genomic information announced, design primer (upstream primer CAGGAAACAGCTATGTCCAATTTCATCGTCAAGAAGG; Downstream primer AAATATTAACGCTTACTCGAACTTCGTAAAATCCGGC) DNA fragmentation (total length 5551bp) of H16_A0460 to H16_A0464 gene is contained from the genome amplification of alcaligenes eutrophus Ralstoniaeutropha H16, add the homology arm sequence that 15bp is identical with plasmid pBBR1MCS-2 respectively at the two ends of sequence respectively during synthesis.Then In-Fusion HD test kit (Takara is utilized, article No. 639648) recombination bunch fragment and universal expression plasmid pBBR1MCS-2(Centraalbureau preservation center, numbering NCCB3434) the partial sequence sequence of lacZ gene (not containing), be reassembled as new expression vector pBBR-H16HZ1(SEQ ID NO.2).
Expression vector pBBR-H16HZ1 is proceeded to by traditional heat-shock transformed method the JM109(DE3 knocking out FadR gene) building can the engineering colon bacillus ZM1 of efficient metabolism grease.
Cell growth assay proves that the engineering colon bacillus ZM1 of genetic modification possesses than starting strain JM109(DE3) stronger fat metabolic ability: by ZM1 and JM109(DE3) respectively picking mono-clonal access 10ml shake pipe and carry out bacterium cell growth experiment, leavening temperature 32 DEG C, pH value controls 7.0, nutrient media components does not add paraxin in the substratum of Table 1(ZM1, JM109(DE3) substratum does not add paraxin and kantlex), be that sole carbon source carries out thalli growth with peanut oil, shake pipe and put into microbiological incubator, cultivate after 12 hours for 220 turns, the cell density OD of ZM1
600reach 0.6, the cell density OD of contrast bacterium
600only have 0.1, when proving to take grease as sole carbon source, the growth of ZM1 is significantly better than contrast bacterium JM109(DE3), have higher fat metabolic ability.
Embodiment 2: build the engineering colon bacillus producing mevalonic acid and the engineering colon bacillus producing isoprene.
According to the enterococcus faecalis announced (Enterococcus faecalis) Hydroxymethylglutaryl list acyl coenzyme A(HMG-CoA) full length sequence information (the Tabata et al. of synthase gene and Hydroxymethylglutaryl list acyl coenzyme A reductase gene, 2004Biotechnology Letters, 26:1487-1491), with plasmid construction method (the Yanget al. that my laboratory has been announced in early-stage Study, 2012PLOS ONE, 7:e33509), construction expression plasmid pACY-mva.Expression vector pACY-mva is proceeded to restructuring by traditional heat-shock transformed method has the intestinal bacteria ZM1 of H16_A1526 to H16_A1531 gene to build to utilize grease substrate to produce the engineering colon bacillus ZM2 of mevalonic acid.
Embodiment 3: utilize the engineering colon bacillus that builds with vegetables oil or middle longer chain fatty acid (carbon chain lengths C8 to C18) for carbon source through fermentation production mevalonic acid.
Use engineering strain ZM2 with vegetables oil (peanut oil or sweet oil) for carbon source through fermentation production mevalonic acid.The condition of this strain fermentation mevalonic acid is used to be: to use the condition of this strain fermentation mevalonic acid to be: in 500 ml shake flask systems, use 100 milliliters of liquid amounts, inoculum size 5%, leavening temperature 32 DEG C, pH value controls 7.0, and nutrient media components is in table 1, and original plant oil addition is 2 grams per liters, stirring velocity is 300 to 600rpm, dissolved oxygen controls 20% to 40%, ferments after 60 hours, with different vegetables oil for the output of carbon source through fermentation mevalonic acid is in table 2.
Use engineering strain ZM2 with lipid acid (lauric acid, tetradecanoic acid, palmitinic acid) for carbon source through fermentation production mevalonic acid.The condition of this strain fermentation mevalonic acid is used to be: in 500 ml shake flask systems, use 100 milliliters of liquid amounts, inoculum size 5%, leavening temperature 32 DEG C, pH value controls 7.0, and nutrient media components is in table 1, and initial lipid acid addition is 2 grams per liters, stirring velocity is 300 to 600rpm, dissolved oxygen controls 20% to 40%, ferments after 60 hours, with different vegetables oil for the output of carbon source through fermentation mevalonic acid is in table 2.
Table 1 engineering colon bacillus ZM2 fermentation mevalonic acid nutrient media components table
* micro-liquid storage formula is: 15.00 grams per liter FeSO
4, 2.40 grams per liter MnSO
4, 2.40 grams per liter ZnSO
4, 0.48 grams per liter CuSO
4.
Table 2 engineering colon bacillus ZM2 fermentation mevalonic acid output
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (1)
1. intestinal bacteria for efficient metabolism grease, is characterized in that, five channel genes being numbered H16_A0460 to H16_A0464 have been knocked out the intestinal bacteria of FadR gene in Ralstonia eutropha Ralstonia eutropha H16 genome.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310475345.8A CN103571787B (en) | 2013-10-12 | 2013-10-12 | Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310475345.8A CN103571787B (en) | 2013-10-12 | 2013-10-12 | Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103571787A CN103571787A (en) | 2014-02-12 |
| CN103571787B true CN103571787B (en) | 2015-07-01 |
Family
ID=50044502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310475345.8A Active CN103571787B (en) | 2013-10-12 | 2013-10-12 | Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103571787B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154387B (en) * | 2010-12-27 | 2013-01-30 | 山东大学 | Method for producing succinic acid and polyhydroxyalkanoate (PHA) by using biodiesel byproducts |
-
2013
- 2013-10-12 CN CN201310475345.8A patent/CN103571787B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154387B (en) * | 2010-12-27 | 2013-01-30 | 山东大学 | Method for producing succinic acid and polyhydroxyalkanoate (PHA) by using biodiesel byproducts |
Non-Patent Citations (2)
| Title |
|---|
| 科学家通过细菌工程将CO2转化为燃料;中国气象局图书馆;《中国气象局图书馆网页》;20120906 * |
| 遗传改造微生物代谢途径生产新型柴油燃料的研究进展;付爱思等;《遗传》;20111030;第33卷(第10期);1121-1133 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103571787A (en) | 2014-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Streit et al. | Prospecting for biocatalysts and drugs in the genomes of non-cultured microorganisms | |
| Ravella et al. | Extracellular polysaccharide (EPS) production by a novel strain of yeast-like fungus Aureobasidium pullulans | |
| CN103602626B (en) | A kind of take grease as the method for raw material production mevalonic acid and the genetic engineering bacterium of structure thereof | |
| Jakob et al. | Comparison of novel GH 68 levansucrases of levan-overproducing Gluconobacter species | |
| Wang et al. | Genome shuffling and gentamicin-resistance to improve ε-poly-l-lysine productivity of Streptomyces albulus W-156 | |
| Okano et al. | Metabolic engineering of Lactobacillus plantarum for direct l‐lactic acid production from raw corn starch | |
| Muñoz et al. | Stable transformation of the green algae Acutodesmus obliquus and Neochloris oleoabundans based on E. coli conjugation | |
| Jeong et al. | Genetic engineering system for syngas-utilizing acetogen, Eubacterium limosum KIST612 | |
| Lv et al. | High-throughput system for screening of high l-lactic acid-productivity strains in deep-well microtiter plates | |
| Taweecheep et al. | In vitro thermal and ethanol adaptations to improve vinegar fermentation at high temperature of Komagataeibacter oboediens MSKU 3 | |
| CN105026548A (en) | D-glucaric acid-producing bacterium, and method for manufacturing d-glucaric acid | |
| Xu et al. | GlnR and PhoP directly regulate the transcription of genes encoding starch-degrading, amylolytic enzymes in Saccharopolyspora erythraea | |
| Boruta et al. | “Microbial wars” in a stirred tank bioreactor: Investigating the co-cultures of Streptomyces rimosus and Aspergillus terreus, filamentous microorganisms equipped with a rich arsenal of secondary metabolites | |
| Nützmann et al. | Regulatory cross talk and microbial induction of fungal secondary metabolite gene clusters | |
| van der Pol et al. | Precultivation of Bacillus coagulans DSM2314 in the presence of furfural decreases inhibitory effects of lignocellulosic by-products during l (+)-lactic acid fermentation | |
| Liu et al. | Production of caproic acid by Rummeliibacillus suwonensis 3B-1 isolated from the pit mud of strong-flavor baijiu | |
| Kumar et al. | Sustainable rhamnolipids production in the next decade–advancing with Burkholderia thailandensis as a potent biocatalytic strain | |
| CN103865869A (en) | Genetically engineered bacterium for producing alpha-ketobutyric acid and application of genetically engineered bacterium | |
| CN111607546B (en) | Genetic engineering bacterium for high-yield farnesene and construction method and application thereof | |
| CN102517303A (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| Johnston et al. | Informatic analysis reveals Legionella as a source of novel natural products | |
| CN103571787B (en) | Escherichia coli capable of efficiently metabolizing grease and application thereof in production of bio-based chemical products | |
| Kim et al. | Genome resequencing and analysis of D-lactic acid fermentation ability of Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | |
| CN107201375A (en) | Produce the construction method and its application of (R, R) 2,3 butanediol engineering strain | |
| CN104357495B (en) | Method for increasing cell phloroglucinol synthesis yield and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |