CN103562382A - Method for degrading or converting cellulosic material - Google Patents

Method for degrading or converting cellulosic material Download PDF

Info

Publication number
CN103562382A
CN103562382A CN201280025435.0A CN201280025435A CN103562382A CN 103562382 A CN103562382 A CN 103562382A CN 201280025435 A CN201280025435 A CN 201280025435A CN 103562382 A CN103562382 A CN 103562382A
Authority
CN
China
Prior art keywords
seq
polypeptide
mature polypeptide
enzyme
cellulose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201280025435.0A
Other languages
Chinese (zh)
Inventor
黄鸿志
任海彧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novo Nordisk AS
Original Assignee
Novo Nordisk AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk AS filed Critical Novo Nordisk AS
Priority to CN202211254624.7A priority Critical patent/CN115927509A/en
Priority to CN201280025435.0A priority patent/CN103562382A/en
Priority to CN201810257103.4A priority patent/CN108467877A/en
Priority claimed from PCT/CN2012/073040 external-priority patent/WO2012130120A1/en
Publication of CN103562382A publication Critical patent/CN103562382A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y111/00—Oxidoreductases acting on a peroxide as acceptor (1.11)
    • C12Y111/01—Peroxidases (1.11.1)
    • C12Y111/01006—Catalase (1.11.1.6)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Provided are methods for degrading or converting a cellulosic material, comprising: treating the cellulosic material with an enzyme composition in the presence of a polypeptide having catalase activity; and enzyme composition used for degrading or converting a cellulosic material comprising one or more (e.g., several) enzymes having cellulolytic and/or hemicellulolytic activity and a polypeptide having catalase activity.

Description

For degrading or transforming the method for cellulose materials
To quoting of sequence table
The sequence table that the application comprises computer-reader form, described computer-reader form is incorporated to herein by carrying stating.
Background of invention
Background technology
Catalase [hydrogen peroxide: peroxidation hydrogen-oxygen is enzyme (EC1.11.1.6) also] is catalyzing hydrogen peroxide (H 2o 2) be converted into oxygen (O 2) and water (H 2o) enzyme.These ubiquitous enzymes are from many animals tissue, plant and microorganism purifying (Chance and Maehly, 1955, Methods Enzymol.2:764-791).
Catalase prepared product commercially, for diagnosing with enzyme reagent kit, produces gluconic acid sodium salt from glucose enzyme process, in and H 2o 2refuse, removes H from textile fabric 2o 2, and for removing H at F&B 2o 2and/or generation O 2.
Mierocrystalline cellulose is that monose passes through the covalently bound polymkeric substance of β-Isosorbide-5-Nitrae-key.The enzyme of the dextran of many microorganisms hydrolysis β-connections.These enzymes comprise endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.Endoglucanase, at random site digest cellulose polymkeric substance, makes it be exposed to cellobiohydrolase and attacks (attack).Cellobiohydrolase sequentially discharges the molecule of cellobiose from the end of cellulose polymer compound.Cellobiose is the glucose dimer of water miscible β-Isosorbide-5-Nitrae-connection.Beta-glucosidase enzyme is hydrolyzed into glucose by cellobiose.
The conversion of lignocellulosic material has following advantage: large content of starting materials is ready-made available, and can avoid ideally burning or embedding material.Timber, agricultural residue, draft crop and municipal solid waste are considered to raw material.These material three major polymers: celluloses, hemicellulose and xylogen form.Once ligno-cellulose is changed into for example glucose of monose, described monose can be further converted to many useful materials, such as fuel, drinking alcohol, tunning and/or chemical (such as acid, alcohol, ketone, gas etc.).
It can be favourable improving in the art for the method for degrading or transform cellulose materials.
Technical field
The present invention relates to degraded or transform the method for cellulose materials, and for degrading or transforming the enzyme composition of cellulose materials.
Summary of the invention
The present invention relates to for degrading or transforming the method for cellulose materials, it comprises: under the existence of polypeptide with catalase activity, with enzyme composition, process cellulose materials.
The present invention also relates to the method for generation of tunning, and it comprises:
(a) under the existence of polypeptide with catalase activity, use enzyme composition diastatic fiber cellulosic material;
(b) for example, with the fermentation of one or more (several) organism of fermentation through the cellulose materials of saccharification to produce tunning; With
(c) from fermentation, reclaim tunning.
The invention further relates to the method for fermented cellulose material, it comprises: for example, with one or more (several) organism of fermentation described cellulose materials that ferments, wherein said cellulose materials is hydrolyzed with enzyme composition under the existence of polypeptide with catalase activity.
The invention still further relates to for degrading or transforming the enzyme composition of cellulose materials, it comprises the enzyme with cellulolytic activity and/or lignin degradation activity and the polypeptide with catalase activity; And the purposes of said composition.
Accompanying drawing explanation
Fig. 1 shows a kind of genomic dna sequence (SEQ ID NO:3) and and aminoacid sequence (SEQ ID NO:4) of Talaromyces stipitatus catalase gene.
Fig. 2 shows genomic dna sequence (SEQ ID NO:5) and and the aminoacid sequence (SEQ ID NO:6) of a kind of Humicola insolens (Humicola insolens) catalase gene.
Fig. 3 shows a kind of genomic dna sequence (SEQ ID NO:7) and and aminoacid sequence (SEQ ID NO:8) of Penicillium emersonii catalase gene.
Definition
Catalase activity: term " catalase activity " is defined as hydrogen peroxide in this article: peroxidation hydrogen-oxygen is enzymic activity (EC1.11.1.6) also, its catalysis 2H 2o 2to O 2+ 2H 2the conversion of O.With regard to object of the present invention, catalase activity is according to U.S. Patent number 5,646, and 025 measures.The catalase activity of Yi Ge unit equals the enzyme amount of the oxidation of catalysis 1 μ mol hydrogen peroxide under condition determination.
In one aspect, for catalase of the present invention, there is the mature polypeptide of SEQ ID NO:2, the mature polypeptide of SEQ ID NO:4, the mature polypeptide of SEQ ID NO:6, or the catalase activity of the mature polypeptide of SEQ ID NO:8 at least 20%, for example at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100%.
Acetyl xylan esterase: term " acetyl xylan esterase " means catalysis from the Carboxylesterase (EC3.1.1.72) of polymerization xylan, acetylize wood sugar, acetyl glucose, acetic acid α-naphthylacetate (alpha-napthyl acetate) and acetic acid p-nitrophenyl acetate (p-nitrophenyl acetate) hydrolysis acetyl group.For the present invention, acetyl xylan esterase activity is to use to contain 0.01%TWEEN tM0.5mM acetic acid p-nitrophenyl acetate in the 50mM sodium acetate pH5.0 of 20 (polyoxyethylenesorbitan monolaurates) is determined as substrate.The acetyl xylan esterase of Yi Ge unit is defined as can be at pH5, and 25 ℃ of per minutes discharge the enzyme amount of 1 micromole's p-NP negatively charged ion (p-nitrophenolate anion).
α-l-arabfuranglycosidase: term " α-l-arabfuranglycosidase " means the Arabic furans lytic enzyme (EC3.2.1.55) of α-L-arbinofuranose glycosides, the hydrolysis of its catalysis to the end irreducibility α-L-arbinofuranose glycosides residue in α-L-arabinose glycosides.This enzyme works to α-L-arbinofuranose glycosides, the α-L-arabinan, araboxylan and the arabogalactan that contain (1,3)-and/or (1,5)-connect.α-l-arabfuranglycosidase is also referred to as arabinofuranosidase/xylosidase, α-arabinofuranosidase/xylosidase, α-L-arabinose glycosides enzyme, α-arabinofuranosidase, polysaccharide α-l-arabfuranglycosidase, α-L-arbinofuranose glycosides lytic enzyme, L-arabinose glycosides enzyme or α-L-arabanase.For the present invention, α-l-arabfuranglycosidase activity is to use medium-viscosity wheat araboxylan (the Megazyme International Ireland of 5mg in the 100mM sodium acetate pH5 of every ml, Ltd., Bray, Co.Wicklow, Ireland), cumulative volume 200 μ l, at 40 ℃, carry out 30 minutes, then pass through
Figure BDA0000421832260000031
hPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA) carries out that pectinose analysis determines.
Alpha-glucuronidase: term " alpha-glucuronidase " means α-D-glucuronide glucuronic acid lytic enzyme (alpha-D-glucosiduronate glucuronohydrolase) (EC3.2.1.139), its catalysis α-D-glucuronic acid glycoside hydrolysis is D-glucuronic acid and alcohol.For the present invention, alpha-glucuronidase activity is according to de Vries, and 1998, J.Bacteriol.180:243-249 determines.The alpha-glucuronidase of Yi Ge unit equals can be at pH5, and 40 ℃ of per minutes discharge the enzyme amount of 1 micromole's glucuronic acid or 4-O-methylglucuronic acid.
Beta-glucosidase enzyme: term " beta-glucosidase enzyme " means β-D-glucoside glucose lytic enzyme (beta-D-glucoside glucohydrolase) (E.C.No.3.2.1.21), the hydrolysis of the non-reduced β-D-Glucose of its catalysis end residue, and discharge β-D-Glucose.For the present invention, beta-glucosidase enzyme is according to Venturi etc., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var.coprophilum:production, purification and some biochemical properties, the method for J.Basic Microbiol.42:55-66 is used p-nitrophenyl-β-D-glucose pyranoside to measure as substrate.The beta-glucosidase enzyme of Yi Ge unit is defined as at 25 ℃, and pH4.8 is containing 0.01%
Figure BDA0000421832260000041
in 20 50mM Trisodium Citrate, per minute produces 1.0 micromole's p-NP negatively charged ion from the 1mM p-nitrophenyl-β-D-glucose pyranoside as substrate.
Xylobiase: term " xylobiase " means β-D-xyloside wood sugar lytic enzyme (β-D-xyloside xylohydrolase) (E.C.3.2.1.37), and the outer hydrolysis of the short β of its catalysis (1 → 4) wood oligose (xylooligosaccharide) is to remove continuous D-xylose residues from non-reducing end.The xylobiase of ，Yi Ge unit is defined as at 40 ℃ for the present invention, and pH5 is containing 0.01%
Figure BDA0000421832260000042
in 20 100mM Trisodium Citrate, per minute produces 1.0 micromole's p-NP negatively charged ion from the 1mM p-nitrophenyl-β-D-xyloside as substrate.
CDNA: term " cDNA " means the DNA molecular that can prepare by reverse transcription from deriving from the mRNA molecule ripe, montage of eucaryon or prokaryotic cell prokaryocyte.CDNA lacks the intron sequences that may exist in corresponding genomic dna.Initial (initial), elementary rna transcription thing are the precursors of mRNA, and it is processed by comprising a series of step of montage, and then the mRNA as ripe montage occurs.
Cellobiohydrolase: term " cellobiohydrolase " means 1, 4-callose cellobiohydrolase (1, 4-beta-D-glucan cellobiohydrolase) (E.C.3.2.1.91 and E.C.3.2.1.176), its catalyse cellulose, cell-oligosaccharide, or any β-1 that comprises, in the polymkeric substance of the glucose that 4-connects 1, the hydrolysis that 4-β-D-glucosides connects, from reduction or the non-reduced end of chain, discharge cellobiose (Teeri, 1997, Crystalline cellulose degradation:New insight into the function of cellobiohydrolases, Trends in Biotechnology15:160-167, Teeri etc., 1998, Trichoderma reesei cellobiohydrolases:why so efficient on crystalline cellulose, Biochem.Soc.Trans.26:173-178).Cellobiohydrolase activity is according to Lever etc., 1972, Anal.Biochem.47:273-279; Van Tilbeurgh etc., 1982, FEBS Lette rs149:152-156; Van Tilbeurgh and Claeyssens, 1985, FEBS Letters187:283-288; And Tomme etc., the method that 1988, Eur.J.Biochem.170:575-581 describes is determined.In the present invention, the method for Tomme etc. can be used for determining cellobiohydrolase activity.
Cellulose materials: term " cellulose materials " means any cellulosic material that comprises.Topmost polysaccharide in the primary cell wall of biomass (primary cell wall) is Mierocrystalline cellulose, second abundant be hemicellulose, the 3rd is pectin.The secondary cell wall (secondary cell wall) producing after cell stops growing contains polysaccharide equally, and is strengthened in the polymerization xylogen of hemicellulose by covalent cross-linking.Mierocrystalline cellulose is the homopolymer of anhydro cellobiose, therefore be a kind of straight chain β-(1-4)-D-dextran, and hemicellulose comprises multiple compounds, for example xylan, xyloglucan (xyloglucan), araboxylan and mannosans, form and have diversified substituent complex branches structure.Although Mierocrystalline cellulose is multiform normally, Mierocrystalline cellulose in plant tissue mainly occurs with the form of the insoluble crystal substrate of parallel dextran chain.Hemicellulose is connected with hydrogen bond with Mierocrystalline cellulose and other hemicellulose conventionally, helps stabilized cell wall matrix.
Mierocrystalline cellulose sees for example stem, leaf, shell, skin and the cob of plant conventionally, or the leaf of trees, branch and timber.Cellulose materials can be; but be not limited to; agricultural residue, draft material (comprising energy crop), municipal solid waste, paper pulp and paper mill resistates, waste paper and timber (comprising forestry resistates) (referring to; for example, Wiselogel etc., 1995; in Handbook on Bioethanol (Charles E.Wyman volume); pp.105-118, Taylor & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology50:3-16; Lynd, 1990, Applied Biochemistry and Biotechnology24/25:695-719; Mosier etc., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T.Scheper chief editor, Volume65, pp.23-40, Springer-Verlag, New York).It should be understood that in this article Mierocrystalline cellulose can be the form with ligno-cellulose, ligno-cellulose is a kind of Plant cell wall material of the mixed-matrix that comprises xylogen, Mierocrystalline cellulose and hemicellulose.One preferred aspect, cellulose materials is any biological material.Another preferred aspect, described cellulose materials is ligno-cellulose, it comprises Mierocrystalline cellulose, hemicellulose and xylogen.
In one aspect, cellulose materials is agricultural residue.In yet another aspect, cellulose materials is draft material (comprising energy crop).In yet another aspect, cellulose materials is municipal solid waste.In yet another aspect, cellulose materials is paper pulp and paper mill resistates.In yet another aspect, cellulose materials is waste paper.In yet another aspect, cellulose materials is timber (comprising forestry resistates).
In yet another aspect, cellulose materials is giantreed (arundo).In yet another aspect, cellulose materials is bagasse (bagasse).In yet another aspect, cellulose materials is bamboo (bamboo).In yet another aspect, cellulose materials is corn cob (corn cob).In yet another aspect, cellulose materials is zein fiber.In yet another aspect, cellulose materials is maize straw.In yet another aspect, cellulose materials is Chinese silvergrass platymiscium (miscanthus).In yet another aspect, cellulose materials is orange peel.In yet another aspect, cellulose materials is rice straw.In yet another aspect, cellulose materials is switchgrass (switch grass).In yet another aspect, cellulose materials is straw.
In yet another aspect, cellulose materials is white poplar (aspen).In yet another aspect, cellulose materials is eucalyptus.In yet another aspect, cellulose materials is fir (fir).In yet another aspect, cellulose materials is pine tree.In yet another aspect, cellulose materials is willow.In yet another aspect, cellulose materials is dragon spruce.In yet another aspect, cellulose materials is willow.
In yet another aspect, cellulose materials is algae Mierocrystalline cellulose.In yet another aspect, cellulose materials is bacteria cellulose.In yet another aspect, cellulose materials is velveteen (cotton linter).In yet another aspect, cellulose materials is filter paper.In yet another aspect, cellulose materials is Microcrystalline Cellulose.In yet another aspect, cellulose materials is the acid-treated Mierocrystalline cellulose of phosphorus.
In yet another aspect, cellulose materials is hydrobiont matter.As for herein, " hydrobiont matter " means the biomass that produced by photosynthesis process in aquatic environment.Hydrobiont matter can be algae, emergent (emergent plant), floatingleaved plant (floating-leaf plant) or submerged plant (submerged plant).
Cellulose materials in statu quo (as is) is used or carries out pre-treatment, uses ordinary method known in the art, as described herein.One preferred aspect, pretreatment of fiber cellulosic material.
Cellulolytic enzyme or cellulase: term " cellulolytic enzyme " or " cellulase " mean the enzyme of one or more (for example several) hydrolysis fiber cellulosic material.This fermentoid comprises endoglucanase, cellobiohydrolase, beta-glucosidase enzyme, or its combination.Two kinds of basic skills measuring cellulolytic activity comprise: (1) measures total fiber element degrading activity, (2) measure independent cellulolytic activity (endoglucanase, cellobiohydrolase and beta-glucosidase enzyme), as Zhang etc., Outlook for cellulase improvement:Screening and selection strategies, 2006, Biotechnology Advances24:452-481 summarizes.Total fiber element degrading activity typically uses that insoluble substrate measures, and described substrate comprises Whatman1 filter paper, Microcrystalline Cellulose, bacteria cellulose, algae Mierocrystalline cellulose, cotton, pretreated ligno-cellulose etc.Modal total fiber element degrading activity assay method is to use Whatman1 filter paper as the filter paper assay method of substrate.This assay method is to be established by International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl.Chem.59:257-68).
For the present invention, cellulose decomposition enzymic activity is determined by measuring the increase of the cellulosic material hydrolysis being undertaken by cellulolytic enzyme under the following conditions: Mierocrystalline cellulose in the PCS of cellulose decomposition zymoprotein/g of 1-50mg (or other pretreated cellulose materials) is in suitable temperature, for example 50 ℃, 55 ℃ or 60 ℃ are carried out 3-7 day, compare with the hydrolysis that contrasts of not adding cellulose decomposition zymoprotein.Representative condition is: 1ml reaction solution, and through washing or unwashed PCS, 5% insoluble solid, 50mM sodium acetate pH5,1mM MnSO 4, 50 ℃, 55 ℃ or 60 ℃, 72 hours, by
Figure BDA0000421832260000061
hPX-87H post (Bio-Rad Laboratories, Inc., Hercules, CA, USA) carries out glycan analysis.
Encoding sequence: term " encoding sequence " means directly to specify the polynucleotide of the aminoacid sequence of polypeptide.The border of encoding sequence determines by open reading frame conventionally, and described open reading frame starts as ATG, GTG or TTG with initiator codon, and finishes as TAA, TAG or TGA with terminator codon.Encoding sequence can be genomic dna, cDNA, synthetic DNA or its combination.
Regulating and controlling sequence (control sequence): term " regulating and controlling sequence " refer to the to encode polynucleotide of mature polypeptide of the present invention are expressed necessary nucleotide sequence.Each regulating and controlling sequence can be (that is, from different genes) of natural (that is, from same gene) or external source for the polynucleotide of the described mature polypeptide of coding, or each regulating and controlling sequence is for can be natural or external source each other.These regulating and controlling sequences include but not limited to leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal peptide sequence and transcription terminator.At least, regulating and controlling sequence comprises promotor and the termination signal of transcribing and translating.Regulating and controlling sequence can possess joint, is convenient to being connected of polynucleotide encoding district of regulating and controlling sequence and coded polypeptide for introducing specificity restriction site.
Endoglucanase: term " endoglucanase " means inscribe-Isosorbide-5-Nitrae-(1,3; 1,4)-callose 4-glucan hydrolase (endo-1,4-β-D-glucan4-glucanohydrolase) (E.C.3.2.1.4), for example, in its catalyse cellulose, derivatived cellulose (carboxymethyl cellulose and Natvosol), moss starch (lichenin) 1, β-1 of 4-β-D-glycosidic link, mixing, 3 dextran are the interior hydrolysis (endohydrolysis) of the β-Isosorbide-5-Nitrae key in cereal callose or xyloglucan and other vegetable material of containing cellulosic component for example.Endoglucanase activity can be by measuring the minimizing of substrate viscosity or being increased and determined by the definite reducing end of reducing sugar test method (Zhang etc., 2006, Biotechnology Advances24:452-481).For the present invention, according to Ghose, the method for 1987, Pure and Appl.Chem.59:257-268, at pH5,40 ℃ are used carboxymethyl cellulose (CMC) to determine endoglucanase activity as substrate.
Express: term " expressions " comprises any step relating in polypeptide generation, include but not limited to transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.
Expression vector: term " expression vector " means DNA molecular linear or ring-type, the polynucleotide that it comprises coded polypeptide, and described polynucleotide are operably connected with the regulating and controlling sequence that is provided for its expression.
Family's 61 glycoside hydrolases: term " the 61 glycoside hydrolase ”Huo“ GH61 of family of family " or " GH61 " are defined as the B. according to Henrissat in this article, 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem.J.280:309-316, and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem.J.316:695-696 belongs to the polypeptide of glycoside hydrolysis enzyme family 61.Proenzyme in this family is the very weak inscribe-Isosorbide-5-Nitrae-β-D dextranase activity based on measuring a family member and be classified as glycoside hydrolysis enzyme family first.The structure of these enzymes and binding mode are non-classical, and they cannot be considered as real (bona fide) Glycosylase.Yet, based on them, when together being used, the mixture with cellulase or cellulase strengthens the ability that ligno-cellulose decomposes, and they are retained in CAZy classification.
Feruloyl esterase: term " feruloyl esterase (feruloyl esterase) " means 4-hydroxy-3-methoxy cinnyl-glycosylhydrolase (EC3.1.1.73), its catalysis 4-hydroxy-3-methoxy cinnyl (asafoetide acyl) group is from the hydrolysis of the sugar (it is generally pectinose " natural " substrate) of esterification, to produce forulic acid (Ferulic acid).Feruloyl esterase is also referred to as feruloyl esterase (ferulic acid esterase), hydroxyl cinnamoyl esterase, FAE-III, laurate lytic enzyme, FAEA, cinnAE, FAE-I or FAE-II.For the present invention, ferulaic acid esterase activity is to use the 0.5mM forulic acid p-nitrophenyl ester in 50mM sodium acetate pH5.0 to determine as substrate.The feruloyl esterase of Yi Ge unit equals can be at pH5, and 25 ℃ of per minutes discharge the enzyme amount of 1 micromole's p-NP negatively charged ion.
Fragment: term " fragment " for example means, from the amino acid whose polypeptide of the amino of mature polypeptide main body (main) and/or carboxyl-terminal deletion one or more (several); Wherein said fragment has catalase activity.In one aspect, at least 632 amino-acid residues that described fragment contains SEQ ID NO:2, for example at least 670 amino-acid residues, or at least 608 amino-acid residues.In yet another aspect, at least 622 amino-acid residues that described fragment contains SEQ ID NO:4, for example at least 659 amino-acid residues, or at least 696 amino-acid residues.In yet another aspect, at least 652 amino-acid residues that described fragment contains SEQ ID NO:6, for example at least 689 amino-acid residues, or at least 727 amino-acid residues.In yet another aspect, at least 614 amino-acid residues that described fragment contains SEQ ID NO:8, for example at least 650 amino-acid residues, or at least 686 amino-acid residues.
Hemicellulose lytic enzyme or hemicellulase: term " hemicellulose lytic enzyme " or " hemicellulase " mean the enzyme of one or more (for example several) hydrolyzed hemicellulose materials.Referring to, for example Shallom D. and Shoham Y.Microbial hemicellulases.Current Opinion In Microbiology, 2003,6 (3): 219-228).Hemicellulase is the key component in Degrading plant biomass.The example of hemicellulase includes but not limited to acetyl mannan esterase, acetyl xylan esterase, arabanase, arabinofuranosidase, coumaric acid esterase, feruloyl esterase, tilactase, glucuronidase, glucuronic acid esterase, mannonase mannosidase, zytase and xylosidase.The substrate of these enzymes, hemicellulose, is the heterogeneous group of branching polysaccharide and straight-chain polysaccharide, and these polysaccharide are the cellulose micro-fibers in plant cell wall by hydrogen bonding, and cross-linking is the network of robust (robust).Hemicellulose also covalently invests xylogen, with the Mierocrystalline cellulose structure of height of formation complexity together.The variable structure of hemicellulose and organizational form need the synergy of many enzymes to make it degradable.The catalytic module of hemicellulase is the glycoside hydrolase (GH) of hydrolysis sugar glycosidic bond, or the sugar ester enzyme (CE) of the ester of hydrolysis acetic acid or forulic acid side group connection.These catalytic module, the homology based on its primary structure, can be assigned as GHHe CE family.Some families have similarly folding on the whole, can further classify as clan (clan), with alphabetic flag (for example, GH-A).Tool informedness and the up-to-date classification of these sugared organized enzymes and other sugared organized enzymes can obtain at Carbohydrate-Active Enzymes (CAZy) database.Hemicellulose lytic enzyme activity can be according to Ghose and Bisaria, and 1987, Pure & Appl.Chem.59:1739-1752 is in suitable temperature, and for example 50 ℃, 55 ℃ or 60 ℃, and pH, for example 5.0 or 5.5 measure.
High stringent condition: term " high stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 50% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 65 ℃, solid support material finally to be washed three times, each 15 minutes.
Host cell: term " host cell " mean any allow use the cell type comprise the transforming of the catalatic nucleic acid construct of the present invention or expression vector, transfection, transduction etc.It is any because the sudden change copying middle generation is different from the offspring of parental cell that parental cell contained in term " host cell ".
Low stringency condition: term " low stringency condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 25% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 50 ℃, solid support material finally to be washed three times, each 15 minutes.
Mature polypeptide: term " mature polypeptide " means the polypeptide that the final form after translation and any posttranslational modification exists with it, the processing of described modification such as N-end, the brachymemma of C-end, glycosylation, phosphorylation etc.In one embodiment, mature polypeptide is the amino acid/11 to 746 of SEQ ID NO:2.In another embodiment, according to the amino acid/11 to 19 of SignalP program prediction SEQ ID NO:4, are signal peptides, mature polypeptide is the amino acid 20 to 733 of SEQ ID NO:4.In another embodiment, according to the amino acid/11 to 19 of SignalP program prediction SEQ ID NO:6, are signal peptides, mature polypeptide is the amino acid 20 to 765 of SEQ ID NO:6.In another embodiment, according to the amino acid/11 to 19 of SignalP program prediction SEQ ID NO:8, are signal peptides, mature polypeptide is the amino acid 20 to 741 of SEQ ID NO:8.Be known in the art the mixture that host cell can produce two or more different mature polypeptides (having different C end and/or N terminal amino acid) of being expressed by identical polynucleotide.
Mature polypeptide encoded sequence: term " mature polypeptide encoded sequence " means the polynucleotide that coding has the mature polypeptide of catalase activity.In one embodiment, mature polypeptide encoded sequence is Nucleotide 1 to 2351 or its cDNA sequence of SEQ ID NO:1.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of SignalP program prediction SEQ ID NO:3, mature polypeptide encoded sequence is Nucleotide 58 to 2418 or its cDNA sequence of SEQ ID NO:3.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of prediction SignalP program SEQ ID NO:5, mature polypeptide encoded sequence is Nucleotide 58 to 3040 or its cDNA sequence of SEQ ID NO:5.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of SignalP program prediction SEQ ID NO:7, mature polypeptide encoded sequence is Nucleotide 58 to 2476 or its cDNA sequence of SEQ ID NO:7.
Medium stringent condition: term " medium stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 35% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 55 ℃, solid support material finally to be washed three times, each 15 minutes.
Medium-Gao stringent condition: term " medium-Gao stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 35% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 60 ℃, solid support material finally to be washed three times, each 15 minutes.
Nucleic acid construct: term " nucleic acid construct " means such strand or double-stranded nucleic acid molecule, its separation is from naturally occurring gene, or it did not modifiedly contain the section of nucleic acid not originally to be present in the mode of (not otherwise exist) occurring in nature, or it is for what synthesize, it comprises one or more regulating and controlling sequences.
Be operably connected: term " is operably connected " and means such configuration, and wherein regulating and controlling sequence is placed in the appropriate location with respect to the encoding sequence of polynucleotide, makes regulating and controlling sequence instruct the expression of encoding sequence.
The polypeptide with cellulolytic enhancing activity: term " has the polypeptide that cellulose decomposition strengthens " and means catalysis to having the GH61 polypeptide of the enzyme of cellulolytic activity to the enhancing of the hydrolytic action of cellulose materials.For the present invention, by measure due to cellulolytic enzyme under the following conditions the reducing sugar increase due to hydrolysis fiber cellulosic material or the total amount increase of cellobiose and glucose determine cellulolytic enhancing activity: Mierocrystalline cellulose in 1-50mg total protein/g PCS, the cellulose decomposition zymoprotein that wherein total protein comprises 50-99.5%w/w, and the protein of the GH61 polypeptide with cellulolytic enhancing activity of 0.5-50%w/w, in suitable temperature, for example 50 ℃, 55 ℃ or 60 ℃ and pH, for example 5.0 or 5.5 last 1-7 days, with total protein heap(ed) capacity by equivalent and cellulose-less decomposes the hydrolysis that contrasts that enhanced activity (Mierocrystalline cellulose in 1-50mg cellulose decomposition albumen/gPCS) carries out and compares.One preferred aspect, use under the cellulase protein heap(ed) capacity existence of the aspergillus oryzae beta-glucosidase enzyme (generations of recombinate in aspergillus oryzae according to WO02/095014) of 2-3% of total protein weight or the Aspergillus fumigatus beta-glucosidase enzyme of the 2-3% of total protein quality (restructuring generation in aspergillus oryzae as described in WO2002/095014)
Figure BDA0000421832260000101
1.5L (Novozymes A/S,
Figure BDA0000421832260000102
denmark) mixture is as the source of cellulolytic activity.
Having the amount that the GH61 polypeptide of cellulolytic enhancing activity reaches the required cellulolytic enzyme of same hydrolysis level by reduction strengthens by the hydrolysis with the enzymatic cellulose materials of cellulolytic activity, preferably reduce at least 1.01 times, for example at least 1.05 times, at least 1.10 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, or at least 20 times.
Pretreated maize straw: term " PCS " or " pretreated maize straw " mean from maize straw by processing by heat and dilute sulphuric acid, alkali pre-treatment or neutral pre-treatment acquisition cellulose materials.
Sequence identity: parameter " sequence identity " is described the dependency between two aminoacid sequences or between two nucleotide sequences.
For the present invention, sequence identity degree between two aminoacid sequences is used as EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite, Rice etc., 2000, Trends Genet.16:276-277), preferably 5.0.0 version or more performed Needleman-Wunsch algorithm in the Needle program of highest version (Needleman and Wunsch, 1970, J.Mol.Biol.48:443-453) measure.The parameter of using is opened point penalty (gap open penalty) 10 for breach, and breach extends point penalty (gap extension penalty) 0.5 and EBLOSUM62 (the EMBOSS version of BLOSUM62) substitution matrix.Use Needle is labeled as the Output rusults (using " nobrief " option to obtain) of " the highest identity (longest identity) " as identity per-cent, and is calculated as follows:
(identical residue * 100)/(sum of breach in comparison length-comparison)
For the present invention, sequence identity degree between two nucleotide sequences is used as EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite, Rice etc., 2000, see above), preferably 5.0.0 version or more performed Needleman-Wunsch algorithm in the Needle program of highest version (Needleman and Wunsch, 1970, see above) measure.The parameter of using is opened point penalty 10 for breach, and breach extends point penalty 0.5 and EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix.Use Output rusults (acquisition of use-nobrief option) that Needle is labeled as " the highest identity " as identity per-cent, and be calculated as follows:
(identical deoxyribonucleotide * 100)/(sum of breach in comparison length-comparison)
Variant: term " variant " means for example, to comprise change, the polypeptide with catalase activity that replaces, inserts and/or lack in one or more (several) position.Replace and mean to occupy the different amino acid replacement for amino acid of certain position; Disappearance means to remove the amino acid that occupies certain position; And insert mean in abutting connection with and and then occupy the amino acid of certain position after add amino acid.
Very high stringent condition: term " very high stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 50% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 70 ℃, solid support material finally to be washed three times, each 15 minutes.
Unusual low stringency condition: term " very low stringency condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 25% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 45 ℃, solid support material finally to be washed three times, each 15 minutes.
Containing xylan material: term " containing xylan material " means the material of any plant cell wall polysaccharides that comprises the xylose residues skeleton that contains β-(1-4) connect.The xylan of terrestrial plant is the heteropolymer with β-(1-4)-xylopyranose skeleton, and it is by short sugar chain branch.They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose and/or the multiple oligosaccharides that comprises D-wood sugar, L-arabinose, D-or L-semi-lactosi and D-Glucose.The polysaccharide of xylan type can be divided into equal xylan (homoxylan) and Heteroxylan (heteroxylan), the latter comprises glucuronoxylan, (Arab) glucuronoxylan, (glucuronic acid) araboxylan, araboxylan and compound Heteroxylan.Referring to, such as Ebringerova etc., 2005, Adv.Polym.Sci.186:1-67.
In technique of the present invention, can use any material that contains xylan.One preferred aspect, described containing xylan material be ligno-cellulose.
Xylan degrading activity or xylan degrading activity: term " xylan degrading is active " or " xylan degrading activity " mean hydrolysis containing the biologic activity of xylan material.Two kinds of basic methods of measuring xylan degrading activity comprise: (1) measures total pentosan degrading activity, and (2) measure independent xylan degrading activity (for example endo-xylanase, xylobiase, arabinofuranosidase, alpha-glucuronidase, acetyl xylan esterase, feruloyl esterase and α-glucuronic acid esterase (α-glucuronyl esterase)).The nearest in-progress summary in xylanase clastic enzyme assay method is in several open source literatures, comprise Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and Agriculture86 (11): 1636-1647; Spanikova and Biely, 2006, Glucuronoyl esterase-Novel carbohydrate esterase produced by Schizophyllum commune, FEBS Letters580 (19): 4597-4601; Herrmann, Vrsanska, Jurickova, Hirsch, Biely, and Kubicek, 1997, The beta-D-xylosidase of Trichoderma reesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal321:375-381.
Total pentosan degrading activity can be measured by determining from the reducing sugar of polytype xylan formation, described xylan comprises for example oat wheat (oat spelt), beech wood (beechwood) and Larch (larchwood) xylan, or can determine that the xylan fragment of the dyeing discharging from the xylan of multiple covalency dyeing measures by light-intensity method.The 4-O-methylglucuronic acid xylan of modal total pentosan degrading activity assay method based on from poly produces reducing sugar, as Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology23 (3): described in 257-270.Xylanase activity also available 0.2%AZCL-araboxylan as substrate at 37 ℃ 0.01%
Figure BDA0000421832260000131
in X-100 (4-(1,1,3,3-tetramethyl butyl) phenyl-polyoxyethylene glycol) and 200mM sodium phosphate buffer pH6, determine.The xylanase activity of Yi Ge unit is defined as at 37 ℃, and pH6 produces 1.0 micromole's azurins (azurine) from the 0.2%AZCL-araboxylan per minute as substrate in 200mM sodium phosphate pH6 damping fluid.
For the present invention, xylan degrading activity is birch xylan (the Sigma Chemical Co. being caused under following usual conditions by xylanolytic enzyme by measuring, Inc., St.Louis, MO, USA) increase of hydrolysis is determined: 1ml reaction system, 5mg/ml substrate (total solid), 5mg xylan decomposing protein/g substrate, 50mM sodium acetate, pH5, 50 ℃, 24 hours, as Lever, 1972, A new reaction for colorimetric determination of carbohydrates, described in Anal.Biochem47:273-279, use P-hydroxybenzoic acid hydrazides (PHBAH) assay method to carry out glycan analysis.
Zytase: term " zytase " means Isosorbide-5-Nitrae-β-D-xylan-wood sugar lytic enzyme (Isosorbide-5-Nitrae-β-D-xylan-xylohydrolase) (E.C.3.2.1.8), the interior hydrolysis of Isosorbide-5-Nitrae-β-D-wood sugar glycosidic bond in its catalysis xylan.For the present invention, xylanase activity is to use 0.2%AZCL-araboxylan to exist as substrate in X-100 and 200mM sodium phosphate pH6 damping fluid 37 ℃ definite.The xylanase activity of Yi Ge unit is defined as at 37 ℃, and pH6 produces 1.0 micromole's azurins from the 0.2%AZCL-araboxylan per minute as substrate in 200mM sodium phosphate pH6 damping fluid.
Detailed Description Of The Invention
The method of processing fiber cellulosic material
The present invention relates to for degrading or transforming the method for cellulose materials, it comprises: under the existence of polypeptide with catalase activity, with enzyme composition, process cellulose materials.In one aspect, the method method also comprises the cellulose materials reclaiming through degraded or conversion.
The present invention also relates to the method for generation of tunning, and it comprises:
(a) under the existence of polypeptide with catalase activity, use enzyme composition diastatic fiber cellulosic material;
(b) for example, with the fermentation of one or more (several) organism of fermentation through the cellulose materials of saccharification to produce tunning; With
(c) from fermentation, reclaim tunning.
The invention further relates to the method for fermented cellulose material, it comprises: for example, with one or more (several) organism of fermentation described cellulose materials that ferments, wherein said cellulose materials is hydrolyzed with enzyme composition under the existence of polypeptide with catalase activity.In one aspect, the fermentation of described cellulose materials produces tunning.In yet another aspect, described method further comprises from fermentation recovery tunning.
In aforesaid method, to compare with not there is not the polypeptide with catalase activity, the existence with the polypeptide of catalase activity increases the hydrolysis of described cellulose materials.
Method of the present invention can be for becoming fermentable sugars by cellulose materials saccharification, and fermentable sugars is changed into a lot of useful tunnings, such as fuel, drinking alcohol and/or platform chemicals (platform chemical) (such as acid, alcohol, ketone, gas etc.).The tunning that produces expectation from cellulose materials is usually directed to pre-treatment, enzymic hydrolysis (saccharification) and fermentation.
According to the processing of cellulose materials of the present invention, can use the ordinary method of this area to complete.In addition, technique of the present invention can be used any conventional biomass processing equipment being configured to according to invention operation to carry out.
Hydrolysis (saccharification) and fermentation, minute other or simultaneously, include but not limited to, hydrolysis and the common fermentation (HHCF) of separated hydrolysis and fermentation (SHF), synchronous glycosylation and fermentation (SSF), synchronous glycosylation and common fermentation (SSCF), the hydrolysis that mixes and fermentation (HHF), separated hydrolysis and common fermentation (SHCF), mixing, with direct microbial transformation (DMC), sometimes also referred to as associating biological processing (consolidated bioprocessing, CBP).First SHF is used independent treatment step is fermentable sugars by enzymatic hydrolysis of cellulosic material, for example, glucose, cellobiose, procellose and pentose monomer, then become ethanol by fermentable sugars fermentation.In SSF, the enzymic hydrolysis of cellulose materials and sugar become the fermentation of ethanol and in a step, combine (Philippidis, G.P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol:Production and Utilization, Wyman, C.E compiles, Taylor & Francis, Washington, DC, 179-212).SSCF comprises the common fermentation (Sheehan of multiple sugar, J. and Himmel, M., 1999, Enzymes, energy and the environment:A strategic perspective on the U.S.Department of Energy ' sresearch and development activities for bioethanol, Biotechnol.Prog.15:817-827).HHF comprises independent hydrolysing step, also comprises synchronous saccharification and hydrolysing step, and described step can be carried out in same reactor.Step in HHF process can be carried out in different temperature,, carries out the saccharification of high temperature enzyme process that is, and the lesser temps that then can tolerate at fermentation strain carries out SSF.DMC for example, has combined all three processes (enzyme produces, is hydrolyzed and fermentation) in one or more (several) step, wherein use identical organism to produce for cellulose materials being changed into fermentable sugars and fermentable sugars being changed into the enzyme (Lynd of end product, L.R., Weimer, P.J., van Zyl, W.H., and Pretorius, I.S., 2002, Microbial cellulose utilization:Fundamentals and biotechnology, Microbiol.Mol.Biol.Reviews66:506-577).Herein, be understandable that, any method as known in the art, comprises pre-treatment, enzymic hydrolysis (saccharification), fermentation, or their combination, all can be used for implementing method of the present invention.
Conventional equipment comprises that feed supplement criticizes formula stirred reactor, batch-type stirred reactor, has the Continuous Flow stirred reactor of ultrafiltration and/or continuous piston flow column reactor (Fernanda de Castilhos Corazza, Fl á vio Faria de Moraes, Gisella Maria Zanin and Ivo Neitzel, 2003, Optimal control in fed-batch reactor for the cellobiose hydrolysis, Acta Scientiarum.Technology25:33-38, Gusakov, A.V. and Sinitsyn, A.P., 1985, Kinetics of the enzymatic hydrolysis of cellulose:1.A mathematical model for a batch reactor process, Enz.Microb.Technol.7:346-352), griding reaction device (Ryu, S.K. and Lee, J.M., 1983, Bioconversion of waste cellulose by using an attrition bioreactor, Biotechnol.Bioeng.25:53-65), or there is the intensively stirred reactor (Gusakov being caused by electromagnetic field, A.V., Sinitsyn, A.P., Davydkin, I.Y., Davydkin, V.Y., Protas, O.V., 1996, Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreactor with intensive stirring induced by electromagnetic field, Appl.Biochem.Biotechnol.56:141-153).Other type of reactor comprises: fluidized-bed, up-flow layer (upflow blanket), immobilization and the reactor of extruding type for being hydrolyzed and/or fermenting.
pre-treatment.In the enforcement of method of the present invention; can use any preprocessing process known in the art to destroy the cellulose materials component (Chandra etc. of plant cell wall; 2007, Substrate pretreatment:The key to effective enzymatic hydrolysis of lignocellulosics Adv.Biochem.Engin./Biotechnol.108:67-93; Galbe and Zacchi, 2007, Pretreatment of lignocellulosic materials for efficient bioethanol production, Adv.Biochem.Engin./Biotechnol.108:41-65; Hendriks and Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol.100:10-18; Mosier etc., 2005, Features of promising technologies for pretreatment of lignocellulosic biomass, Bioresource Technol.96:673-686; Taherzadeh and Karimi, 2008, Pretreatment of lignocellulosic wastes to improve ethanol and biogas production:A review, Int.J.of Mol.Sci.9:1621-1651; Yang and Wyman, 2008, Pretreatment:the key to unlocking low-cost cellulosic ethanol, Biofuels Bioproducts and Biorefining-Biofpr.2:26-40).
Cellulose materials also can be used method as known in the art to carry out particle size reduction, pre-soaking, soak, wash and/or conditioning (conditioning) before pre-treatment.
Conventional pre-treatment includes but not limited to, steam pre-treatment (following or do not follow explosion), dilute acid pretreatment, hot-water pretreatment, alkaline pre-treatment, Calx preconditioning, wet oxidation, wet explosion, the explosion of ammonia fiber, organic solvent pre-treatment and Biological Pretreatment.Other pre-treatment comprises ammonia diafiltration, ultrasonic, electroporation, microwave, supercritical CO 2, overcritical H 2o, ozone, ionic liquid and gamma-radiation pre-treatment.
Pretreatment of fiber cellulosic material before can and/or fermenting in hydrolysis.Pre-treatment is preferably carried out before hydrolysis.Or pre-treatment can carry out discharging fermentable sugars with enzymic hydrolysis, as glucose, wood sugar and/or cellobiose simultaneously.In most of the cases, pre-treatment step itself makes some Wood Adhesives from Biomass become fermentable sugars (even in the situation that not there is not enzyme).
Steam pre-treatment.In steam pre-treatment, heating cellulose materials, to destroy plant cell wall composition, comprises xylogen, hemicellulose and Mierocrystalline cellulose, makes enzyme can contact Mierocrystalline cellulose and other fraction, for example, and hemicellulose.Cellulose materials is led to or made it pass through reaction vessel, wherein injecting steam to be to be warming up to the temperature and pressure needing, and keeps therein the reaction times of expectation.Steam pre-treatment is preferably at 140-230 ℃, more preferably 160-200 ℃, and most preferably 170-190 ℃ carry out, wherein optimum temperature range depends on the interpolation of any chemical catalyst.The preferred 1-30 minute of the residence time of steam pre-treatment, more preferably 1-15 minute, even more preferably 3-12 minute, 4-10 minute most preferably, wherein the optimum residence time is depended on the interpolation of temperature range and any chemical catalyst.Steam pre-treatment allows relatively high solid heap(ed) capacity, to such an extent as to cellulose materials little bit moist mostly just in preprocessing process.Steam pre-treatment often combines with the explosion blowing (explosive discharge) of pretreated material; this is called steam explosion;; material changes to normal atmosphere and turbulent flow fast; with surface-area (Duff and the Murray that can contact by broken increase; 1996, Bioresource Technology855:1-33; Galbe and Zacchi, 2002, Appl.Microbiol.Biotechnol.59:618-628; U.S. Patent application No.20020164730).In steam pre-treatment process, hemicellulose acetyl group is cut, and the sour autocatalysis hemicellulose partial hydrolysis producing becomes monose and oligosaccharides.The degree that xylogen is removed is limited.
Before the steam pre-treatment of being everlasting, add catalyzer as H 2sO 4or SO 2(common 0.3 to 5%w/w), can reduce the time, reduces temperature, increases the rate of recovery, and improves enzymic hydrolysis (Ballesteros etc., 2006, Appl.Biochem.Biotechnol.129-132:496-508; Varga etc., 2004, Appl.Biochem.Biotechnol.113-116:509-523; Sassner etc., 2006, Enzyme Microb.Technol.39:756-762).
Chemical Pretreatment: term " chemical treatment " refers to promote any chemical treatment of Mierocrystalline cellulose, hemicellulose and/or lignin separation and/or release.The example of suitable Chemical Pretreatment technique comprises for example dilute acid pretreatment, Calx preconditioning, wet oxidation, ammonia fiber/freezing explosion (AFEX), ammonia diafiltration (APR), ionic liquid and organic solvent pre-treatment.
In dilute acid pretreatment, by cellulose materials and diluted acid (H normally 2sO 4) and water mix to form slurry, by the temperature that is steam heated to expectation, and after one period of residence time, change to rapidly normal atmosphere.Can carry out dilute acid pretreatment by a lot of type of reactor, for example, plug flow reactor, counter-current reactor or continuous countercurrent shrink bed bioreactor (Duff and Murray, 1996, supra; Schell etc., 2004, Bioresource Technol.91:179-188; Lee etc., 1999, Adv.Biochem.Eng.Biotechnol.65:93-115).
Can also use several pretreatment processs under alkaline condition.These alkali pre-treatment include, but not limited to Calx preconditioning, wet oxidation, ammonia diafiltration (APR) and ammonia fiber/freezing blast (AFEX).
Calcium carbonate, sodium hydroxide or ammonia for Calx preconditioning, carry out at the low temperature of 85-150 ℃, and the residence time was from 1 hour to several days (Wyman etc., 2005, Bioresource Technol.96:1959-1966; Mosier etc., 2005, Bioresource Technol.96:673-686).WO2006/110891, WO2006/110899, WO2006/110900 and WO2006/110901 disclose the pretreatment process that uses ammonia.
Wet oxidation is hot pre-treatment, conventionally at 180-200 ℃, carries out 5-15 minute, adds oxygenant as hydrogen peroxide or overvoltage oxygen (Schmidt and Thomsen, 1998, Bioresource Technol.64:139-151; Palonen etc., 2004, Appl.Biochem.Biotechnol.117:1-17; Varga etc., 2004, Biotechnol.Bioeng.88:567-574; Martin etc., 2006, J.Chem.Technol.Biotechnol.81:1669-1677).Pre-treatment is with preferred 1-40% dry-matter, more preferably 2-30% dry-matter, and most preferably 5-20% dry-matter carries out, and owing to adding alkali as sodium carbonate, initial pH usually can increase.
The amending method of wet oxidation pretreatment process, is called wet explosion (combination of wet oxidation and steam explosion), can process the dry-matter that is up to 30%.In wet explosion, in preprocessing process, after certain residence time, introduce oxygenant.Then by changing to rapidly normal atmosphere, finish pre-treatment (WO2006/032282).
Ammonia fiber blast (AFEX) relates in mild temperature if 90-100 ℃ and high pressure are as 17-20bar; with liquid state or gaseous ammonia, cellulose materials is processed to 5-10 minute; wherein dry matter content can be up to 60% (Gollapalli etc.; 2002, Appl.Biochem.Biotechnol.98:23-35; Chundawat etc., 2007, Biotechnol.Bioeng.96:219-231; Alizadeh etc., 2005, Appl.Biochem.Biotechnol.121:1133-1141; Teymouri etc., 2005, Bioresource Technol.96:2014-2018).AFEX pre-treatment causes the partial hydrolysis of cellulosic depolymerization and hemicellulose.Xylogen-saccharide complex is cut.
Organic solvent pre-treatment is by using aqueous ethanol (40-60% ethanol) 160-200 ℃ of extraction 30-60 minute and by cellulose materials delignification (Pan etc., 2005, Biotechnol.Bioeng.90:473-481; Pan etc., 2006, Biotechnol.Bioeng.94:851-861; Kurabi etc., 2005, Appl.Biochem.Biotechnol.121:219-230).Often add sulfuric acid as catalyzer.In organic solvent pre-treatment, most of hemicellulose is removed.
Other examples of suitable pretreatment process are as Schell etc., 2003, Appl.Biochem and Biotechn.Vol.105-108:69-85, with Mosier etc., 2005, the Bioresource Technology96:673-686 ，He U.S. openly applies for described in 2002/0164730.
In one aspect, Chemical Pretreatment is preferably as acid treatment, and more preferably as diluted acid and/or weak acid continuously, processes and carry out.Acid is sulfuric acid normally, but also can use other acid, as acetic acid, citric acid, nitric acid, phosphoric acid, tartrate, succsinic acid, hydrogenchloride or its mixture.Weak acid (mild acid) is processed at preferred 1-5, more preferably 1-4, and most preferably the pH scope of 1-3 is carried out.In one aspect, acid concentration is in preferably 0.01 to 20wt% acid, more preferably 0.05 to 10wt% acid, even more preferably 0.1 to 5wt% acid, and the scope of 0.2 to 2.0wt% acid most preferably.Acid is contacted with cellulose materials, and at preferred 160-220 ℃, more preferably the temperature of 165-195 ℃ of scope keeps the several seconds to several minutes, for example the time of 1 second to 60 minutes.
In yet another aspect, pre-treatment is carried out as ammonia fiber explosion step (AFEX pre-treatment step).
In yet another aspect, pre-treatment occurs in aqueous slurry.Aspect preferred, in preprocessing process cellulose materials with preferred 10-80wt%, more preferably 20-70wt%, and 30-60wt% most preferably, the amount of 50wt% exists according to appointment.Pretreated cellulose materials can not wash, or uses any known method washing in this area, for example, washes with water.
Mechanical pretreatment: term " mechanical pretreatment " refers to various types of grinding (grinding) or pulverizes (milling) (for example, dry grinding, wet-milling or vibratory milling).
Physics pre-treatment: term " physics pre-treatment " refers to that any promotion Mierocrystalline cellulose, hemicellulose and/or xylogen are from the pre-treatment of the separated and/or release of cellulose materials.For example, physics pre-treatment can relate to radiation (for example microwave radiation), decatize/steam explosion, aquathermolysis (hydrothermolysis), and combination.
Physics pre-treatment can relate to high pressure and/or high temperature (steam explosion).In one aspect, high end finger is preferably approximately 300 to about 600psi, and more preferably from about 350 to about 550psi, and most preferably from about 400 to about 500psi scope, the according to appointment pressure of 450psi.In yet another aspect, high temperature refers to approximately 100 to 300 ℃, preferably the temperature of approximately 140 to approximately 235 ℃ of scopes.One preferred aspect, mechanical pretreatment is carried out in using the batchwise process formula vapor gun hydrolyzer system (for example, from Sunds Defibrator AB, the Sunds Hydrolyzer of Sweden) of high temperature and high pressure as defined above.
The physics and chemistry pre-treatment of combination.Cellulose materials can not only be subject to physics pre-treatment but also be subject to Chemical Pretreatment.For example, pre-treatment step can relate to diluted acid or weak acid pre-treatment and high temperature and/or pre-press.Described physics and chemistry pre-treatment can optionally sequentially be carried out or carry out simultaneously.Optionally, also can comprise mechanical pretreatment.
Therefore, one preferred aspect, cellulose materials is carried out to machinery, chemistry or physics pre-treatment, or their any combination, to promote the separated of Mierocrystalline cellulose, hemicellulose and/or xylogen and/or to discharge.
Biological Pretreatment: term " Biological Pretreatment " refers to any Biological Pretreatment that can promote that Mierocrystalline cellulose, hemicellulose and/or xylogen are separated from cellulose materials and/or discharge.Biological Pretreatment Techniques can comprise apply dissolved lignin microorganism (referring to, for example, Hsu; T.-A.; 1996, Pretreatment of biomass, in Handbook on Bioethanol:Production and Utilization; Wyman; C.E compiles, Taylor & Francis, Washington; DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic/microbial conversion of lignocellulosic biomass, Adv.Appl.Microbiol.39:295-333; McMillan, J.D., 1994; Pretreating lignocellulosic biomass:a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel; M.E., Baker, J.O.; and Overend, R.P., compiles; ACS Symposium Series566, American Chemical Society, Washington; DC, the 15th chapter; Gong, C.S., Cao; N.J., Du, J.; and Tsao, G.T., 1999; Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper; T., compile Springer-Verlag BerlinHeidelberg; Germany, 65:207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz.Microb.Tech.18:312-331; With Vallander and Eriksson, 1990, Production of ethanol from lignocellulosic materials:State of the art, Adv.Biochem.Eng./Biotechnol.42:63-95).
saccharification.In hydrolysing step (also referred to as saccharification), cellulose materials (for example pretreated cellulose materials) is hydrolyzed so that Mierocrystalline cellulose and/or hemicellulose are decomposed to saccharogenesis, as glucose, cellobiose, wood sugar, xylulose, pectinose, seminose, semi-lactosi and/or soluble oligosaccharides.Described sugar, and/or soluble oligosaccharides can be further used for (for example producing alcohol, arabitol, propyl carbinol, isopropylcarbinol, ethanol, glycerine, methyl alcohol, ethylene glycol, 1,3-PD (propylene glycol), butyleneglycol, glycerol, sorbyl alcohol and Xylitol); Alkane (for example pentane, hexane, heptane, octane, nonane, decane, undecane and dodecane); Naphthenic hydrocarbon (for example pentamethylene, hexanaphthene, suberane and cyclooctane); Alkene (for example amylene, hexene, heptene and octene); Amino acid (for example, aspartic acid, L-glutamic acid, glycine, Methionin, Serine and Threonine); Gas (for example, methane, hydrogen (H 2), carbonic acid gas (CO 2) and carbon monoxide (CO)); Isoprene; Ketone (for example, acetone); Organic acid (for example, acetic acid, acetonic acid, hexanodioic acid, xitix, citric acid, 2,5-diketone-D-glyconic acid, formic acid, FUMARIC ACID TECH GRADE, saccharic acid, glyconic acid, glucuronic acid, pentanedioic acid, 3-hydroxy-propionic acid, methylene-succinic acid, lactic acid, oxysuccinic acid, propanedioic acid, oxalic acid, oxaloacetic acid, propionic acid, succsinic acid and xylosic acid); And polyketide.
Hydrolysis has enzymatic under the existence of polypeptide of catalase activity and carries out in the present invention with enzyme composition.The enzyme of composition also can add simultaneously or sequentially with the polypeptide with catalase activity.
Enzymic hydrolysis preferably, under the condition of easily being determined by those skilled in the art, is carried out in suitable aqueous environment.In one aspect, hydrolysis is being suitable for the activity of enzyme, for carrying out under enzyme optimal conditions.Hydrolysis can be used as fed-batch process or successive processes is carried out, and in successive processes, cellulose materials is filled into gradually, for example, fills into gradually in the hydrating solution containing enzyme.
Saccharification is carried out conventionally in stirred-tank reactor or fermentor tank under controlled pH, temperature and mixing condition.Suitable treatment time, temperature and pH condition can easily be determined by those skilled in the art.For example, saccharification is sustainable reaches 200 hours, but conventionally carries out preferably approximately 12 to approximately 120 hours, and for example approximately 16 to approximately 72 hours, or approximately 24 to approximately 48 hours.Temperature is at preferably approximately 25 ℃ to approximately 70 ℃, and for example approximately 30 ℃ to approximately 65 ℃, approximately 40 ℃ to approximately 60 ℃, or the scope of approximately 50 ℃ to 55 ℃.PH is preferably approximately 3 to approximately 8, and for example approximately 3.5 to approximately 7, approximately 4 to approximately 6, or approximately 5.0 to approximately 5.5 scope.Solid body burden is preferred approximately 5 to about 50wt%, and for example approximately 10 to about 40wt%, or approximately 20 scopes to about 30wt%.
Enzyme composition
Enzyme composition can comprise any albumen that can be used for degraded or transform cellulose materials.Described composition can comprise a kind of enzyme as main enzyme component, and for example single-component composition, maybe can comprise plurality of enzymes.Described composition can be prepared according to means known in the art, and can be the form of liquid or dry composition.Described composition can be according to method stabilization as known in the art.
In one aspect, for the enzyme composition of degrading or transform cellulose materials, comprise one or more (for example several) and there is the enzyme of cellulose decomposition and/or hemicellulose degrading activity, and there is the polypeptide of catalase activity.
In one embodiment, described enzyme composition comprises, or also comprise one or more (for example several) and be selected from the albumen of lower group: cellulase, there is the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.In yet another aspect, described cellulase for example, is selected from the enzyme of lower group for preferred one or more (several): endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described hemicellulase for example, is selected from the enzyme of lower group for preferred one or more (several): acetyl mannan esterase, acetyl xylan esterase, arabanase, arabinofuranosidase, coumaric acid esterase, feruloyl esterase, tilactase, glucuronidase, glucuronic acid esterase, mannonase mannosidase, zytase and xylosidase.
In another embodiment, described enzyme composition comprises one or more (for example several) cellulolytic enzymes.In yet another aspect, described enzyme composition comprises or also comprises one or more (for example several) hemicellulose lytic enzymes.In yet another aspect, described enzyme composition comprises one or more (for example several) cellulolytic enzymes and one or more (for example several) hemicellulose lytic enzymes.In yet another aspect, described enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulolytic enzyme and hemicellulose lytic enzyme.In yet another aspect, described enzyme composition comprises endoglucanase.In yet another aspect, described enzyme composition comprises cellobiohydrolase.In yet another aspect, described enzyme composition comprises beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises cellobiohydrolase and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises beta-glucosidase enzyme and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase and cellobiohydrolase.In yet another aspect, described enzyme composition comprises endoglucanase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises cellobiohydrolase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.
In another embodiment, described enzyme composition comprises acetyl mannan esterase.In yet another aspect, described enzyme composition comprises acetyl xylan esterase.In yet another aspect, described enzyme composition comprises arabanase (for example α-L-arabanase).In yet another aspect, described enzyme composition comprises arabinofuranosidase (for example α-l-arabfuranglycosidase).In yet another aspect, described enzyme composition comprises coumaric acid esterase.In yet another aspect, described enzyme composition comprises feruloyl esterase.In yet another aspect, described enzyme composition comprises tilactase (for example alpha-galactosidase and/or beta-galactosidase enzymes).In yet another aspect, described enzyme composition comprises glucuronidase (for example α-D-glucuronidase).In yet another aspect, described enzyme composition comprises glucuronic acid esterase.In yet another aspect, described enzyme composition comprises mannase.In yet another aspect, described enzyme composition comprises mannosidase (for example beta-Mannosidase).In yet another aspect, described enzyme composition comprises zytase.One preferred aspect, described zytase is family's 10 zytases.In yet another aspect, described enzyme composition comprises xylosidase (for example xylobiase).
In another embodiment, described enzyme composition comprises esterase.In yet another aspect, described enzyme composition comprises claviformin.In yet another aspect, described enzyme composition comprises laccase.In yet another aspect, described enzyme composition comprises lignin decomposition enzyme.Another preferred aspect, described lignin decomposition enzyme is manganese peroxidase.Another preferred aspect, described lignin decomposition enzyme is lignin peroxidase.Another preferred aspect, described lignin decomposition enzyme produces H 2o 2enzyme.In yet another aspect, described enzyme composition comprises polygalacturonase.In yet another aspect, described enzyme composition comprises peroxidase.In yet another aspect, described enzyme composition comprises proteolytic enzyme.In yet another aspect, described enzyme composition comprises swollenin.
In the method for the invention, enzyme can be in saccharification, saccharification and fermentation, or add before fermentation or in process.The enzyme with cellulose decomposition and/or hemicellulose degrading activity can add simultaneously or sequentially with the polypeptide with catalase activity.
One or more of described enzyme composition (for example several) component can be the combination of wild-type protein, recombinant protein or wild-type protein and recombinant protein.For example, one or more (for example several) components can be the native protein of cell, and it is one or more (for example several) other components with recombinant expressed enzyme composition as host cell.One or more of enzyme composition (for example several) component can be used as single component and produces, and is then combined to form enzyme composition.Described enzyme composition can be the combination of polycomponent and single component albumen prepared product.
For the enzyme of the inventive method, can be any form being applicable to as the source of enzyme, for example fermented liquid formulation or cell composition, containing or not containing the cell lysate of cell debris, the enzyme prepared product of half purifying or purifying, or host cell.Described enzyme composition can be dry powder or particle, non-dusting particle, liquid, the shielded enzyme of stabilization liquid or stabilization.Liquid enzymes prepared product can be according to the technique of establishing, and for example, by adding stablizer as sugar, sugar alcohol or other polyvalent alcohols, and/or lactic acid or other organic acids carry out stabilization.
There is the enzyme of catalase activity and the optimal dose of polypeptide depends on several factors, include but not limited to, mixture, cellulose materials, the concentration of cellulose materials, the pre-treatment of cellulose materials, temperature, time, the pH of component fibre element lytic enzyme and comprise the fermenting organism body yeast of synchronous glycosylation and fermentation (for example, for).
One preferred aspect, cellulolytic enzyme or hemicellulose lytic enzyme are approximately 0.5 to about 50mg for the significant quantity of cellulose materials, more preferably from about 0.5 to about 40mg, more preferably from about 0.5 to about 25mg, more preferably from about 0.75 to about 20mg, more preferably from about 0.75 to about 15mg, and even more preferably from about 0.5 to about 10mg, most preferably from about 1.0 to about 10mg every g cellulose materialss.
Another preferred aspect, the polypeptide with catalase activity is approximately 0.001 to about 100.0mg for the significant quantity of cellulose materials, preferably approximately 0.01 to about 50mg, more preferably from about 0.01 to about 40mg, more preferably from about 0.01 to about 30mg, more preferably from about 0.01 to about 20mg, more preferably from about 0.01 to about 10mg, more preferably from about 0.025 to about 8mg, more preferably from about 0.05 to about 6mg, and more preferably from about 0.075 to about 5mg, and more preferably from about 0.1 to about 4mg, even more preferably from about 0.15 to about 3mg, most preferably from about 0.25 to about 1.0mg every g cellulose materials.
Another preferred aspect, the polypeptide with catalase activity is approximately 0.005 to about 1.0g for the significant quantity of cellulolytic enzyme or hemicellulose lytic enzyme, preferably approximately 0.01 to about 1.0g, more preferably from about 0.15 to about 0.75g, more preferably from about 0.15 to about 0.5g, more preferably from about 0.1 to about 0.5g, and even more preferably from about 0.1 to about 0.5g, and 0.05 to about 0.2g every g cellulolytic enzyme or hemicellulose lytic enzyme most preferably from about.
In yet another aspect, the GH61 polypeptide with cellulolytic enhancing activity is approximately 0.01 to about 50.0mg to the significant quantity of cellulose materials, preferably approximately 0.01 to about 40mg, more preferably from about 0.01 to about 30mg, more preferably from about 0.01 to about 20mg, more preferably from about 0.01 to about 10mg, more preferably from about 0.01 to about 5mg, more preferably from about 0.025 to about 1.5mg, more preferably from about 0.05 to about 1.25mg, more preferably from about 0.075 to about 1.25mg, more preferably from about 0.1 to about 1.25mg, even more preferably from about 0.15 to about 1.25mg, 0.25 cellulose materials to the every g of about 1.0mg most preferably from about.
In yet another aspect, the GH61 polypeptide with cellulolytic enhancing activity is approximately 0.005 to about 1.0g to the significant quantity of cellulose decomposition zymoprotein, preferably approximately 0.01 to about 1.0g, more preferably from about 0.15 to about 0.75g, more preferably from about 0.15 to about 0.5g, more preferably from about 0.1 to about 0.5g, and even more preferably from about 0.1 to about 0.5g, and the cellulose decomposition zymoprotein of 0.05 to about 0.2g every g most preferably from about.
The polypeptide with cellulose decomposition enzymic activity or hemicellulose lytic enzyme activity, and other can be used for the protein/polypeptide of the degraded of cellulose materials, the polypeptide (being referred to as hereinafter the polypeptide with enzymic activity) for example with cellulolytic enhancing activity can be derived from or obtain from any suitable source, comprises bacterium, fungi, yeast, plant or Mammals source.Term " acquisition " also means in this article this enzyme and can in host living beings, use described method restructuring to produce herein, the enzyme wherein producing through restructuring is natural or external source for host living beings, or there is the aminoacid sequence of modification, for example, the amino acid that there is one or more (for example several) disappearance, inserts and/or replace, the enzyme that restructuring produces, its fragment that is natural acid sequence and/or mutant or the enzyme producing by amino acid Shuffling Method known in the art.In the implication of natural enzyme, contain natural variant, and what in the implication of external enzyme, contain is the variant that restructuring (as by site-directed mutagenesis or rearrangement) obtains.
The polypeptide with enzymic activity can be bacterial peptide.For example, described polypeptide can be that gram positive bacterium polypeptide is as bacillus (Bacillus), streptococcus (Streptococcus), streptomyces (Streptomyces), Staphylococcus (Staphylococcus), enterococcus spp (Enterococcus), lactobacillus (Lactobacillus), lactococcus (Lactococcus), fusobacterium (Clostridium), ground bacillus belongs to (Geobacillus), pyrolysis Mierocrystalline cellulose Pseudomonas (Caldicellulosiruptor), hot acid Pseudomonas (Acidothermus), Thermobifidia or bacillus marinus belong to (Oceanobacillus) polypeptide, described polypeptide has enzymic activity, or gram negative bacterium polypeptide, as intestinal bacteria, Rhodopseudomonas (Pseudomonas), salmonella (Salmonella), campylobacter (Campylobacter), Helicobacterium (Helicobacter), Flavobacterium (Flavobacterium), Fusobacterium (Fusobacterium), mud Bacillaceae (Ilyobacter), eisseria (Neisseria) or Ureaplasma (Ureaplasma) polypeptide, described polypeptide has enzymic activity.
In one aspect, described polypeptide is the Alkaliphilic bacillus (Bacillus alkalophilus) with enzymic activity, bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus brevis (Bacillus brevis), Bacillus circulans (Bacillus circulans), Bacillus clausii (Bacillus clausii), Bacillus coagulans (Bacillus coagulans), bacillus firmus (Bacillus firmus), bacillus lautus (Bacillus lautus), bacillus lentus (Bacillus lentus), Bacillus licheniformis (Bacillus licheniformis), bacillus megaterium (Bacillus megaterium), bacillus pumilus (Bacillus pumilus), bacstearothermophilus (Bacillus stearothermophilus), subtilis (Bacillus subtilis) or bacillus thuringiensis (Bacillus thuringiensis) polypeptide.
Another preferred aspect, described polypeptide is streptococcus equisimilis (Streptococcus equisimilis), streptococcus pyogenes (Streptococcus pyogenes), streptococcus uberis (Streptococcus uberis) or streptococcus equi beast pest subspecies (the Streptococcus equi subsp.Zooepidemicus) polypeptide with enzymic activity.
Another preferred aspect, described polypeptide be there is enzymic activity do not produce look streptomycete (Streptomyces achromogenes), deinsectization streptomycete (Streptomyces avermitilis), sky blue streptomycete (Streptomyces coelicolor), streptomyces griseus (Streptomyces griseus) or shallow Streptomyces glaucoviolaceus (Streptomyces lividans) polypeptide.
The polypeptide with enzymic activity can be also fungi polypeptide, and the yeast polypeptides more preferably with enzymic activity is as mycocandida (Candida), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), yeast belong (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or the mould genus of Western alpine yarrow (Yarrowia) polypeptide, or the filamentous fungus polypeptide more preferably with enzymic activity is as the mould genus of branch top spore (Acremonium), Agaricus (Agaricus), Alternaria (Alternaria), Aspergillus (Aspergillus), aureobasidium genus (Aureobasidium), Botryospaeria, intend wax Pseudomonas (Ceriporiopsis), hair beak shell belongs to (Chaetomidium), Chrysosporium (Chrysosporium), Claviceps, Cochliobolus, Coprinus (Coprinopsis), Coptotermes, rod softgel shell belongs to (Corynascus), hidden clump red shell Pseudomonas (Cryphonectria), genera cryptococcus (Cryptococcus), Diplodia (Diplodia), Exidia (Exidia), Filibasidium, fusarium (Fusarium), Gibberella (Gibberella), full flagellum Eimeria (Holomastigotoides), Humicola (Humicola), rake teeth Pseudomonas (Irpex), Agaricus (Lentinula), Leptospaeria, Magnaporthe grisea belongs to (Magnaporthe), Melanocarpus, Polyporus (Meripilus), Mucor (Mucor), myceliophthora (Myceliophthora), the mould genus of Xin Kaoma fat (Neocallimastix), Neurospora (Neurospora), paecilomyces (Paecilomyces), Penicillium (Penicillium), flat lead fungi belongs to (Phanerochaete), cud Chytridium (Piromyces), Poitrasia, false black Peziza (Pseudoplectania), Pseudotrichonympha, Rhizomucor (Rhizomucor), Schizophyllum (Schizophyllum), capital spore belongs to (Scytalidium), Talaromyces (Talaromyces), thermophilic ascomycete belongs to (Thermoascus), Thielavia (Thielavia), Tolypocladium (Tolypocladium), Trichoderma (Trichoderma), the Peziza that becomes mildewed (Trichophaea), Verticillium (Verticillium), Volvaria (Volvariella) or Xylaria (Xylaria) polypeptide its.
In one aspect, described polypeptide is the saccharomyces carlsbergensis (Saccharomyces carlsbergensis) with enzymic activity, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomyces diastaticus), Doug Laplace yeast (Saccharomyces douglasii), Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or ellipsoideus yeast (Saccharomyces oviformis) polypeptide.
In one aspect, described polypeptide is the solution fiber branch top spore mould (Acremonium cellulolyticus) with enzymic activity, microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), Aspergillus fumigatus (Aspergillus fumigatus), smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), chrysosporium keratinophilum (Chrysosporium keratinophilum), Chrysosporium lucknowense, chrysosporium tropicum (Chrysosporium tropicum), Chrysosporium merdarium, Chrysosporium inops, felt gold pityrosporion ovale (Chrysosporium pannicola), Chrysosporium queenslandicum, Chrysosporium zonatum, bar spore shape sickle spore (Fusarium bactridioides), F.graminearum schw (Fusarium cerealis), storehouse prestige sickle spore (Fusarium crookwellense), machete sickle spore (Fusarium culmorum), fusarium graminaria (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), sulphur look sickle spore (Fusarium sulphureum), circle sickle spore (Fusarium torulosum), intend silk spore sickle spore (Fusarium trichothecioides), empiecement sickle spore (Fusarium venenatum), ash humicola lanuginosa (Humicola grisea), Humicola insolens (Humicola insolens), dredge cotton shape humicola lanuginosa (Humicola lanuginosa), white rake teeth bacterium (Irpex lacteus), rice black wool mould (Mucor miehei), thermophilic fungus destroyed wire (Myceliophthora thermophila), Neuraspora crassa (Neurospora crassa), penicillium funiculosum (Penicillium funiculosum), penicillium purpurogenum (Penicillium purpurogenum), the yellow flat lead fungi of spore (Phanerochaete chrysosporium), colourless shuttle spore shell (Thielavia achromatica), Thielavia albomyces, Thielavia albopilosa, Australia shuttle spore shell (Thielavia australeinsis), Thielavia fimeti, Thielavia microspora (Thielavia microspora), ovum spore shuttle spore shell (Thielavia ovispora), Thielavia peruviana, knurl spore shuttle spore shell (Thielavia spededonium), hair shuttle spore shell (Thielavia setosa), Thielavia subthermophila, autochthonal shuttle spore shell (Thielavia terrestris), trichoderma harziarum (Trichoderma harzianum), healthy and free from worry wood mould (Trichoderma koningii), long shoot wood mould (Trichoderma longibrachiatum), Trichodermareesei (Trichoderma reesei), viride (Trichoderma viride) or brown spore cup fungi (Trichophaea saccata) polypeptide that becomes mildewed.
Can also use the mutant through chemically modified or protein engineering transformation of the polypeptide with enzymic activity.
One or more of described cellulose decomposition enzyme composition (for example several) component can be restructuring component, that is, by described in clones coding separately the DNA sequence dna of component and subsequently with this DNA sequence dna transformant expression in host (referring to, for example, WO91/17243 and WO91/17244) produce.Described host is heterologous host (enzyme is external source to host) preferably, but this host can be also homology host (enzyme is natural to host) under certain condition.Monocomponent fibre element decomposition of protein can also be prepared by such protein of purifying from fermented liquid.
In one aspect, described one or more (for example several) cellulolytic enzymes comprise commercial cellulolytic enzyme prepared product.The example that is applicable to the cellulolytic enzyme prepared product of business of the present invention comprises, for example, and CELLIC tMcTec Ctec3 (Novozymes A/S), CELLIC tMctec CTec2 (Novozymes A/S), cTec (Novozymes A/S), CELLUCLAST tM(Novozymes A/S), NOVOZYM tM188 (Novozymes A/S), CELLUZYME tM(Novozymes A/S), CEREFLO tM(Novozymes A/S) and ULTRAFLO tM(Novozymes A/S), ACCELERASE tM(Genencor Int.), LAMINEX tM(Genencor Int.), SPEZYME tMcP (Genencor Int.),
Figure BDA0000421832260000262
nL (DSM),
Figure BDA0000421832260000263
s/L100 (DSM), ROHAMENT tM7069W (
Figure BDA0000421832260000264
gmbH),
Figure BDA0000421832260000265
lDI (Dyadic International, Inc.),
Figure BDA0000421832260000266
lBR (Dyadic International, Inc.) or 150L (Dyadic International, Inc.).Described cellulose enzyme with solid approximately 0.001 to about 5.0wt%, for example approximately 0.025 of solid to about 4.0wt%, or approximately 0.005 significant quantity to about 2.0wt% of solid is added.
Can include but are not limited to for the example of the bacterium endoglucanase of method of the present invention, separate fiber hot acid bacterium (Acidothermus cellulolyticus) endoglucanase (WO91/05039; WO93/15186; United States Patent (USP) 5,275,944; WO96/02551; United States Patent (USP) 5,536,655, WO00/70031, WO05/093050); Thermobifida fusca EG III (WO05/093050); With Thermobifida fusca EGV (WO05/093050).
Can include but are not limited to for the example of fungi endoglucanase of the present invention trichoderma reesei endoglucanase I (Penttila etc., 1986, Gene45:253-263, Trichodermareesei Cel7B endoglucanase i (GENBANK tMaccession number M15665); Trichoderma reesei endoglucanase II (Saloheimo etc., 1988, Gene63:11-22), Trichodermareesei Cel5A EG II (GENBANK tMaccession number M19373); Trichoderma reesei endoglucanase III (Okada etc., 1988, Appl.Environ.Microbiol.64:555-563; GENBANK tMaccession number AB003694); Trichoderma reesei endoglucanase V (Saloheimo etc., 1994, Molecular Microbiology13:219-228; GENBANK tMaccession number Z33381); Microorganism Aspergillus aculeatus endoglucanase (Ooi etc., 1990, Nucleic Acids Research18:5884); Valley aspergillus (Aspergillus kawachii) endoglucanase (Sakamoto etc., 1995, Current Genetics27:435-439); Carrot soft rot Erwinia (Erwinia carotovara) endoglucanase (Saarilahti etc., 1990, Gene90:9-14); Point sickle spore endoglucanase (GENBANK tMaccession number L29381); Ash humicola lanuginosa thermoidea mutation endoglucanase (GENBANK tMaccession number AB003107); Melanocarpus albomyces endoglucanase (GENBANK tMaccession number MAL515703); Neuraspora crassa endoglucanase (GENBANK tMaccession number XM_324477); Humicola insolens EGV; Thermophilic fungus destroyed wire CBS117.65 endoglucanase; Basidiomycetes (basidiomycete) CBS495.95 endoglucanase; Basidiomycetes CBS494.95 endoglucanase; The mould NRRL8126CEL6B endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL6C endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7C endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7E endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7F endoglucanase of autochthonal shuttle spore; Cladorrhinum foecundissimum ATCC62373CEL7A endoglucanase; And Li's Trichoderma strains No.VTT-D-80133 endoglucanase (GENBANK tMaccession number M15665).
The example that can be used for cellobiohydrolase of the present invention includes but are not limited to, Trichodermareesei cellobiohydrolase I, Trichodermareesei cellobiohydrolase II, Humicola insolens cellobiohydrolase I, thermophilic fungus destroyed wire cellobiohydrolase II, the mould cellobiohydrolase II of autochthonal shuttle spore (CEL6A), chaetomium thermophilum (Chaetomium thermophilum) cellobiohydrolase I, and chaetomium thermophilum cellobiohydrolase II.
The example that can be used for beta-glucosidase enzyme of the present invention includes but are not limited to aspergillus oryzae beta-glucosidase enzyme, Aspergillus fumigatus beta-glucosidase enzyme, Brazilian mould IBT20888 beta-glucosidase enzyme, aspergillus niger beta-glucosidase enzyme and microorganism Aspergillus aculeatus beta-glucosidase enzyme.
Aspergillus oryzae beta-glucosidase enzyme can obtain according to WO2002/095014.Aspergillus fumigatus beta-glucosidase enzyme can obtain according to WO2005/047499.Brazil's mould beta-glucosidase enzyme can obtain according to WO2007/019442.Aspergillus niger beta-glucosidase enzyme can be according to Dan etc., and 2000, J.Biol.Chem.275:4973-4980 obtains.Microorganism Aspergillus aculeatus beta-glucosidase enzyme can be according to Kawaguchi etc., and 1996, Gene173:287-288 obtains.
Described beta-glucosidase enzyme can be fusion rotein.In one aspect, described beta-glucosidase enzyme is aspergillus oryzae beta-glucosidase enzyme variant BG fusion rotein or aspergillus oryzae beta-glucosidase enzyme fusion rotein (obtaining according to WO2008/057637).
Other available endoglucanase, cellobiohydrolase and beta-glucosidase enzyme are disclosed in and use according to Henrissat B., 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem.J.280:309-316 and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, in many glycosyl hydrolase families of Biochem.J.316:695-696 classification.
Other can be used for cellulolytic enzyme of the present invention and is described in EP495, 257, EP531, 315, EP531, 372, WO89/09259, WO94/07998, WO95/24471, WO96/11262, WO96/29397, WO96/034108, WO97/14804, WO98/08940, WO98/012307, WO98/13465, WO98/015619, WO98/015633, WO98/028411, WO99/06574, WO99/10481, WO99/025846, WO99/025847, WO99/031255, WO2000/009707, WO2002/050245, WO2002/0076792, WO2002/101078, WO2003/027306, WO2003/052054, WO2003/052055, WO2003/052056, WO2003/052057, WO2003/052118, WO2004/016760, WO2004/043980, WO2004/048592, WO2005/001065, WO2005/028636, WO2005/093050, WO2005/093073, WO2006/074005, WO2006/117432, WO2007/071818, WO2007/071820, WO2008/008070, WO2008/008793, U.S. Patent number 4, 435, 307, U.S. Patent number 5, 457, 046, U.S. Patent number 5, 648, 263, U.S. Patent number 5, 686, 593, U.S. Patent number 5, 691, 178, U.S. Patent number 5, 763, 254, with U.S. Patent number 5, 776, 757.
In the method for the invention, can use any GH61 polypeptide with cellulolytic enhancing activity.
Aspect first, described in there is cellulolytic enhancing activity GH61 polypeptide comprise following motif:
[ILMV]-P-X (4,5)-G-X-Y-[ILMV]-X-R-X-[EQ]-X (4)-[HNQ] and [FW]-[TF]-K-[AIV],
Wherein X is arbitrary amino acid, and X (4,5) is the arbitrary amino acid on 4 or 5 continuous positions, and X (4) is the arbitrary amino acid on 4 continuous positions.
The GH61 polypeptide that comprises the motif shown in above-mentioned can further comprise:
H-X(1,2)-G-P-X(3)-[YW]-[AILMV]，
[EQ]-X-Y-X (2)-C-X-[EHQN]-[FILV]-X-[ILV], or
H-X (1,2)-G-P-X (3)-[YW]-[AILMV] and [EQ]-X-Y-X (2)-C-X-[EHQN]-[FILV]-X-[ILV],
Wherein X is arbitrary amino acid, and X (1,2) is the arbitrary amino acid on 1 position or 2 continuous positions, and X (3) is 3 arbitrary amino acids on continuous position, and X (2) is 2 arbitrary amino acids on continuous position.In above-mentioned motif, adopt generally acknowledged IUPAC single-letter amino acid abbreviations.
One preferred aspect, described in there is cellulolytic enhancing activity GH61 polypeptide also comprise H-X (1,2)-G-P-X (3)-[YW]-[AILMV].Another preferred aspect, the GH61 polypeptide with cellulolytic enhancing activity also comprises [EQ]-X-Y-X (2)-C-X-[EHQN]-[FILV]-X-[ILV].Another preferred aspect, the GH61 polypeptide with cellulolytic enhancing activity also comprise H-X (1,2)-G-P-X (3)-[YW]-[AILMV] and
[EQ]-X-Y-X(2)-C-X-[EHQN]-[FILV]-X-[ILV]。
Aspect second, described in there is cellulolytic enhancing activity GH61 polypeptide comprise following motif:
[ILMV]-P-x(4,5)-G-x-Y-[ILMV]-x-R-x-[EQ]-x(3)-A-[HNQ]，
Wherein x is arbitrary amino acid, and x (4,5) is the arbitrary amino acid on 4 or 5 continuous positions, and x (3) is 3 arbitrary amino acids on continuous position.In above-mentioned motif, adopt generally acknowledged IUPAC single-letter amino acid abbreviations.
The example that can be used for the GH61 polypeptide with cellulolytic enhancing activity of method of the present invention includes but not limited to the polypeptide with cellulolytic enhancing activity from autochthonal shuttle spore mould (WO2005/074647, WO2008/148131 and WO2011/035027), the polypeptide with cellulolytic enhancing activity (WO2005/074656 and WO2010/065830) from tangerine orange thermophilic ascomycete, the polypeptide with cellulolytic enhancing activity (WO2007/089290) from Trichodermareesei, polypeptide (the WO2009/085935 with cellulolytic enhancing activity from thermophilic fungus destroyed wire, WO2009/085859, WO2009/085864, WO2009/085868), the polypeptide with cellulolytic enhancing activity (WO2010/138754) from Aspergillus fumigatus, with from having a liking for loose mould (Penicillium pinophilum) (WO2011/005867), thermophilic ascomycete bacterial classification (WO2011/039319), Penicillium bacterial classification (WO2011/041397), the polypeptide with cellulolytic enhancing activity with Thermoascus crustaceous (WO2011/041504).
In one aspect, described in there is cellulolytic enhancing activity GH61 polypeptide according to WO2008/151043 at solubility activation divalent metal, for example under the existence of manganous sulfate, use.
The GH61 polypeptide in one aspect, with cellulolytic enhancing activity is used under the existence of titanium dioxide compound, bicyclic compound, heterogeneous ring compound, nitrogenous compound, naphtoquinone compounds, sulfocompound or the liquor that obtains from pretreated cellulose materials (as pretreated maize straw (PCS)).
Described titanium dioxide compound can comprise any suitable combination thing that contains two or more Sauerstoffatoms.In some respects, described titanium dioxide compound contains the aryl module (moiety) replacing as described herein.Described titanium dioxide compound can comprise one or more (for example several) hydroxyl and/or hydroxy derivatives, but also comprises the aryl module of the replacement that lacks hydroxyl and hydroxy derivatives.The non-limiting example of titanium dioxide compound comprises pyrocatechol or catechol; Coffic acid; PCA; The 4-tertiary butyl-5-methoxyl group-1,2-dihydroxy-benzene; Pyrogallol; Gallic acid; Methyl-Gallic Acid; 2,3,4-trihydroxybenzophenone; 2,6-syringol; Sinapinic acid; 3,5-resorcylic acid; 4-is chloro-1,2-dihydroxy-benzene; 4-nitro-1,2-dihydroxy-benzene; Tannic acid; Progallin A; Hydroxyethanoic acid methyl esters; Dihydroxyl fumaric acid; 2-butyne-Isosorbide-5-Nitrae-glycol; Croconic acid; 1,3-PD; Tartrate; 2,4-pentanediol; 3-oxyethyl group-1,2-PD; 2,4,4 '-trihydroxybenzophenone; Cis-2-butene-Isosorbide-5-Nitrae-glycol; Squaric acid; Otan; Acetyl acrolein (acrolein acetal); Methyl-4-HBA; 4-HBA; And methyl-3,5-dimethoxy-4 '-hydroxy-benzoic acid; Or their salt or solvate (solvate).
Described bicyclic compound can comprise any suitable replacement carbocyclic fused ring system as described herein.Described compound can comprise one or more (for example several) extra ring, and unless otherwise specified, be not limited to concrete number of rings.In one aspect, described bicyclic compound is flavonoid.In yet another aspect, described bicyclic compound is the optional isoflavonoid (isoflavonoid) replacing.In yet another aspect, described bicyclic compound is the optional pattern replacing
Figure BDA0000421832260000301
ion (flavylium ion), as the cyanidin(e) of optional replacement or the optional anthocyanogen replacing, or derivatives thereof.The non-limiting example of bicyclic compound comprises l-Epicatechol (epicatechin); Quercetin (quercetin); Myricetin (myricetin); Taxifolin (taxifolin); Kaempferol (kaempferol); Sang Su (morin); Acacetin (acacetin); Naringenin (naringenin); Isorhamnetin (isorhamnetin); Apigenin (apigenin); Anthocyanidin (cyanidin); Anthocyanin (cyanin); Kuromanin; Keracyanin (keracyanin); Or their salt or solvate.
Described heterogeneous ring compound can be any suitable compound, as described herein optional replace comprise heteroatomic aromatic ring or non-aromatic ring.In one aspect, described heterocycle is the compound of the Heterocyclylalkyl module that comprises optional replacement or the heteroaryl module optionally replacing.In yet another aspect, the Heterocyclylalkyl module of described optional replacement or the optional heteroaryl module replacing are the optional five-membered ring alkyl replacing or the optional quinary heteroaryl module replacing.In yet another aspect, the optional Heterocyclylalkyl replacing or the optional heteroaryl module replacing are the modules that is selected from following optional replacement: pyrazolyl, furyl, imidazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrryl, pyridyl, pyrimidyl, pyridazinyl, thiazolyl, triazolyl, thienyl (thienyl), dihydro-thiophene-pyrazolyl (dihydrothieno-pyrazolyl), thianaphthenyl, carbazyl, benzimidazolyl-, benzothienyl (benzothienyl), benzofuryl, indyl, quinolyl, benzotriazole base, benzothiazolyl, benzoxazolyl (benzooxazolyl), benzimidazolyl-, isoquinolyl, pseudoindoyl, acridyl, benzoisoxazole base (benzoisazolyl), T10, pyrazinyl, tetrahydrofuran base, pyrrolinyl, pyrrolidyl, morpholinyl, indyl, diazacyclo heptantriene base (diazepinyl), nitrogen heterocyclic heptantriene base (azepinyl), thia cycloheptatriene base (thiepinyl), piperidyl and oxepin base (oxepinyl).In yet another aspect, the Heterocyclylalkyl module of described optional replacement or the optional heteroaryl module replacing are the optional furyls replacing.The non-limiting example of heterogeneous ring compound comprises (1,2-dihydroxy ethyl)-3,4-dihydrofuran-2 (5H)-one; 4-hydroxy-5-methyl base-3-furanone; 5-hydroxyl-2 (5H)-furanone; [1,2-dihydroxy ethyl] furans-2,3,4 (5H)-triketones; Alpha-hydroxy-gamma-butyrolactone; Ribonic acid gamma lactone; Hexanal saccharic acid gamma lactone (aldohexuronicaldohexuronic acid γ-lactone); Glucopyrone; 4 hydroxy coumarin; Dihydrobenzofuranes; 5-(methylol) furfural; Furoin (furoin); 2 (5H)-furanones; 5,6-dihydro-2H-pyran-2-one; With 5,6-dihydro-4-hydroxyl-6-methyl-2H-pyran-2-one; Or their salt or solvate.
Described nitrogenous compound can be any suitable combination thing with one or more nitrogen-atoms.In one aspect, described nitrogenous compound comprises amine, imines, azanol or Nitrous Oxide (nitroxide) module.The non-limiting example of nitrogenous compound comprises acetoxime; Violuric acid; Pyridine-2-aldoxime; Ortho-Aminophenol; 1,2-phenylenediamine; 2,2,6,6-tetramethyl--piperidino oxygen (piperidinyloxy); 5,6,7,8-tetrahydrobiopterin; 6,7-dimethyl-5,6,7,8-tetrahydrochysene pterin; And maleinamic acid; Or their salt or solvate.
Described naphtoquinone compounds can be any described suitable compound that comprises quinone module herein.The non-limiting example of naphtoquinone compounds comprises Isosorbide-5-Nitrae-benzoquinones; 1,4-naphthoquinone; 2 hydroxy 1,4 naphthoquinone (lawsone); 2,3-dimethoxy-5-methyl isophthalic acid, 4-benzoquinones or ubiquinone 0; 2,3,5,6-tetramethyl--Isosorbide-5-Nitrae-benzoquinones or duroquinone; Isosorbide-5-Nitrae-dihydroxyanthraquinone; 3-hydroxyl-1-methyl-5,6-indoline diketone or carbazochrome; The 4-tertiary butyl-5-methoxyl group-1,2-benzoquinones; Pyrroloquinoline quinone (pyrroloquinoline quinone); Or their salt or solvate.
Described sulfocompound can be any suitable compound that comprises one or more sulphur atoms.In one aspect, described sulfocompound comprises and is selected from following module: thionyl, thioether, sulfinyl, sulphonyl, sulphonamide (sulfamide), sulphonamide (sulfonamide), sulfonic acid and sulphonate.The non-limiting example of sulfocompound comprises sulfur alcohol; 2-propylmercaptan; 2-propylene-1-mercaptan; Mistabrom; Benzenethiol; Benzene-1,2-bis-mercaptan; Halfcystine; Methionine(Met); Gsh; Gelucystine; Or their salt or solvate.
In one aspect, to the significant quantity of cellulose materials, to take to the molar ratio computing of cellulosic sugar unit be approximately 10 to compound as above -6to approximately 10, for example approximately 10 -6to approximately 7.5, approximately 10 -6to approximately 5, approximately 10 -6to approximately 2.5, approximately 10 -6to approximately 1, approximately 10 -5to approximately 1, approximately 10 -5to approximately 10 -1, approximately 10 -4to approximately 10 -1, approximately 10 -3to approximately 10 -1, and approximately 10 -3to approximately 10 -2.In yet another aspect, the significant quantity of compound as above is extremely about 1M of approximately 0.1 μ M, and for example approximately 0.5 μ M is to about 0.75M, and approximately 0.75 μ M is to about 0.5M, approximately 1 μ M is to about 0.25M, approximately 1 μ M is to about 0.1M, and approximately 5 μ M are to about 50mM, and approximately 10 μ M are to about 25mM, approximately 50 μ M are to about 25mM, approximately 10 μ M are to about 10mM, and approximately 5 μ M are to about 5mM, or about 0.1mM is to about 1mM.
Term " liquor (liquor) " means under described in this article condition, by processing ligno-cellulose and/or the hemicellulosic materials in slurry, or its monose such as wood sugar, pectinose, seminose etc., the solution phase producing, be water, organic phase or its combination, and solubility inclusion.The liquor that is used for the cellulose decomposition enhancing of GH61 polypeptide can be by applying heat and/or pressure treatment cellulose materials or hemicellulosic materials (or raw material), then produce solution is separated with residual solid, described processing optionally at catalyzer for example under the existence of acid, under the optional existence at organic solvent, carry out, and optionally combines with the physical damage to described material.Such conditional decision in the process by cellulase prepared product hydrolysis fiber cellulosic material, the degree of the obtainable cellulose decomposition enhancing of combination institute by liquor and GH61 polypeptide.Described liquor can be used standard method in this area as filtration, deposition or centrifugal from treated material separation.
In one aspect, described liquor is approximately 10 to cellulosic significant quantity -6to the every g Mierocrystalline cellulose of about 10g, for example approximately 10 -6to about 7.5g, approximately 10 -6to approximately 5, approximately 10 -6to about 2.5g, approximately 10 -6to about 1g, approximately 10 -5to about 1g, approximately 10 -5to approximately 10 -1g, approximately 10 -4to approximately 10 -1g, approximately 10 -3to approximately 10 -1g, and approximately 10 -3to approximately 10 -2the every g Mierocrystalline cellulose of g.
In one embodiment, described one or more (for example several) hemicellulose lytic enzymes comprise commercial hemicellulose lytic enzyme prepared product.The example that is applicable to commercial hemicellulose lytic enzyme prepared product of the present invention comprises, for example SHEARZYME tM(Novozymes A/S),
Figure BDA0000421832260000321
hTec (Novozymes A/S),
Figure BDA0000421832260000322
htec2 (Novozymes A/S), (Novozymes A/S), (Novozymes A/S),
Figure BDA0000421832260000325
hC (Novozymes A/S),
Figure BDA0000421832260000326
xylanase (Genencor), xY (Genencor),
Figure BDA0000421832260000328
xC (Genencor),
Figure BDA0000421832260000329
tX-200A (AB Enzymes), HSP6000Xylanase (DSM), DEPOL tM333P (Biocatalysts Limit, Wales, UK), DEPOL tM740L (Biocatalysts Limit, Wales, UK) and DEPOL tM762P (Biocatalysts Limit, Wales, UK).
The example that can be used for the zytase of the inventive method includes but not limited to microorganism Aspergillus aculeatus (Aspergillus aculeatus) zytase (GeneSeqP:AAR63790; WO94/21785), Aspergillus fumigatus (Aspergillus fumigatus) zytase (WO2006/078256), have a liking for loose mould (WO2011/041405), Penicillium bacterial classification (WO2010/126772), mould (Thielavia terrestris) NRRL8126 of autochthonal shuttle spore (WO2009/079210) and the brown spore cup fungi GH10 (WO2011/057083) that becomes mildewed.
The example that can be used for the xylobiase of the inventive method includes but not limited to, Trichodermareesei (Trichoderma reesei) xylobiase (UniProtKB/TrEMBL accession number Q92458), Ai Mosen ankle joint bacterium (Talaromyces emersonii) (SwissProt accession number Q8X212), and Neuraspora crassa (Neurospora crassa) (SwissProt accession number Q7SOW4).
The example that can be used for the acetyl xylan esterase of the inventive method includes but not limited to from microorganism Aspergillus aculeatus (WO2010/108918), chaetomium globosum (Chaetomium globosum) (Uniprot accession number Q2GWX4), thin beautiful chaetomium (Chaetomium gracile) (GeneSeqP accession number AAB82124), Humicola insolens (Humicola insolens) DSM1800 (WO2009/073709), Hypocrea jecorina (Hypocrea jecorina) (WO2005/001036), thermophilic fungus destroyed wire (Wo2010/014880), Neuraspora crassa (UniProt accession number q7s259), the acetyl xylan esterase of grain husk withered septoria musiva (Phaeosphaeria nodorum) (Uniprot accession number Q0UHJ1) and the mould NRRL8126 of autochthonal shuttle spore (WO2009/042846).
The example that can be used for the feruloyl esterase of the inventive method includes but not limited to Humicola insolens DSM1800 (WO2009/076122) feruloyl esterase, Neuraspora crassa feruloyl esterase (UniProt accession number Q9HGR3) and Fei Xixinsatuo bacterium (Neosartorya fischer) (UniProt accession number A1D9T4) feruloyl esterase.
The example that can be used for the arabinofuranosidase of the inventive method includes but not limited to the arabinofuranosidase from aspergillus niger (Aspergillus niger) (GeneSeqP accession number AAR94170), Humicola insolens (Humicola insolens) DSM1800 (WO2006/114094 and WO2009/073383) and M.giganteus (WO2006/114094).
The example that can be used for the alpha-glucuronidase of the inventive method includes but not limited to from excellent aspergillus (Aspergillus clavatus) (UniProt accession number alcc12), Aspergillus fumigatus (SwissProt accession number Q4WW45), aspergillus niger (Uniprot accession number Q96WX9), terreus (Aspergillus terreus) (SwissProt accession number Q0CJP9), Humicola insolens (WO2010/014706), tangerine ash mould (WO2009/068565), the alpha-glucuronidase of Ai Mosen ankle joint bacterium (UniProt accession number Q8X211) and Trichodermareesei (Uniprot accession number Q99024).
The polypeptide with enzymic activity for the inventive method can be by the nutritional medium containing suitable Carbon and nitrogen sources and inorganic salt, use means known in the art (referring to, Bennett for example, J.W. and LaSure, L. (volume), More Gene Manipulations in Fungi, Academic Press, CA, 1991) microorganism strains that fermentation is above pointed out produces.Suitable medium Ke Cong supplier obtains, or can for example, according to published composition (catalogue of American type culture collection), prepare.Be suitable for temperature range that growth and enzyme produce and other conditions and in this area be known (referring to, Bailey for example, J.E. and Ollis, D.F., Biochemical Engineering Fundamentals, McGraw-Hill Book Company, NY, 1986).
Described fermentation can be any method that causes the culturing cell of enzyme or protein expression or separation.Therefore, fermentation can be understood as be included in suitable medium and allow described enzyme expressed or separated condition under the shake-flask culture that carries out, or in laboratory or industrial fermentation tank little-or large scale fermentation (comprise continuously, in batches, fed-batch or solid state fermentation).The enzyme of the gained producing by aforesaid method can reclaim and pass through ordinary method purifying from fermention medium.
Described composition can be fermented liquid formulation or cell composition, as described herein.In some embodiments, described composition is (cell-killed) that the kill cell full nutrient solution containing organic acid, the cell being killed and/or cell debris and substratum.
In one aspect, the present invention relates to full nutrient solution formulation or cell culture compositions, it comprises the polypeptide that one or more (for example several) have the enzyme of cellulose decomposition and/or hemicellulose degrading activity and have catalase activity.
That term " fermented liquid " is produced by cell fermentation for this paper middle finger, do not experience or only experience the recovery of minimum and/or the prepared product of purifying.For example, saturated when allowing microorganisms cultures grow to, under the condition of restriction carbon, incubation, to allow albumen synthetic (for example, by host cell expression enzyme), and while being secreted into cell culture medium, produces fermented liquid.Described fermented liquid can contain the not classification of the fermented material obtaining when fermentation stops or the inclusion of classification.Typically, fermented liquid is unassorted, and comprises useless substratum and cell debris that removal microorganism cells (for example filamentous fungal cells) (for example, by centrifugal removal) exists afterwards.In some embodiments, described fermented liquid contains useless cell culture medium, extracellular enzyme, and great-hearted and/or unvital (viable and/or nonviable) microorganism cells.
In one embodiment, described fermented liquid formulation and cell composition comprise the first organic acid composition and the second organic acid composition, the organic acid that described the first organic acid composition comprises at least one 1-5 carbon and/or its salt, and organic acid and/or its salt that described the second organic acid composition comprises at least one 6 or more carbon.In a specific embodiments, described the first organic acid composition is acetic acid, formic acid, propionic acid, their salt, or aforementioned both or more persons' mixture, and described the second organic acid composition is phenylformic acid, hexahydrobenzoic acid, 4-methylvaleric acid, toluylic acid, their salt, or aforementioned two or more mixture.
In one aspect, described composition contains organic acid, and optionally also contains cell and/or the cell debris being killed.In one embodiment, the cell and/or the cell debris that described in removing from kill the full nutrient solution of cell, have been killed, to provide not the composition containing these components.
Described fermented liquid formulation or cell composition can further comprise sanitas and/or antimicrobial (for example antibacterial) agent, include but not limited to sorbyl alcohol, sodium-chlor, potassium sorbate and other is as known in the art.
The described full nutrient solution of cell or the not classification inclusion that composition can contain the fermented material obtaining when fermentation stops killed.Typically, the described full nutrient solution of having killed cell or composition contain that to allow microorganism cells (for example filamentous fungal cells) grow to saturated, useless substratum and the cell debris of incubation to allow albumen to exist after synthetic under the condition of restriction carbon.In some embodiments, the full nutrient solution that described cell is killed or composition are containing the cell culture medium of useful mistake, extracellular enzyme, and the filamentous fungal cells of killing.In some embodiments, the microorganism cells existing in the full nutrient solution of killing at cell or composition can be used method osmotic as known in the art and/or cracking.
Full nutrient solution or cell composition are generally liquid as described herein, but can contain insoluble component, as the cell being killed, cell debris, nutrient media components and/or insoluble enzyme.In some embodiments, can remove insoluble component so that the liquid composition of clarification to be provided.
Full nutrient solution formulation of the present invention and cell composition can produce by the method for describing in WO90/15861 or WO2010/096673.
In one aspect, the present invention relates to enzyme composition of the present invention in degraded or transform the purposes in cellulose materials.
fermentation.The organism of fermentation fermentation that can for example, sugar directly or indirectly can be fermented into required tunning by one or more (several) fermentable sugars that the cellulose materials of hydrolysis obtains of hanging oneself.Any method that " fermentation " or " fermentation process " refers to any fermentation process or comprise fermentation step.Fermentation process also comprises for example, for example, fermentation process for the industry of consumer's goods alcohol (, beer and grape wine), Dairy industry (, fermented milk prod), leather industry and tobacco.Fermentation condition depends on tunning and the fermenting organism body of expectation, and can easily be determined by those skilled in the art.
In fermentation step, the sugar discharging from cellulose materials as the result of pre-treatment and enzyme hydrolysis step, becomes product by fermenting organism body (as yeast) fermentation, for example, and ethanol.As described herein, hydrolysis (saccharification) and fermentation can be separately or simultaneously.
In implementing fermentation step of the present invention, can use any suitable cellulose materials through hydrolysis.Conventionally according to required leavened prod (that is, the material that obtain from fermentation) and the method for use, select described material, as known in the art.
Term " fermention medium " can be regarded as in this article and refers to add organism of fermentation substratum before, as, the substratum being produced by saccharifying, and the substratum using in synchronous saccharification and fermentation process (SSF).
" organism of fermentation " refers to be applicable to any microorganism that desirable fermentation process produces tunning, comprises bacterium and fungal organism.Fermenting organism body can be hexose and/or pentose fermentation organism, or their combination.Hexose and pentose fermentation organism are all known in this field.Suitable organism of fermentation sugar (as glucose, wood sugar, xylulose, pectinose, maltose, seminose, semi-lactosi and/or oligosaccharides) can ferment directly or indirectly (that is, conversion) become required leavened prod.Can produce the bacterium of ethanol and the example of fungi fermentation organism as Lin etc., described in 2006, Appl.Microbiol.Biotechnol.69:627-642.
The example of the organism of fermentation of energy zymohexose comprises bacterium and fungal organism, as yeast.Preferred yeast comprises mycocandida, genus kluyveromyces and yeast belong, for example the bacterial strain of Candida sonorensis, kluyveromyces marxianus and yeast saccharomyces cerevisiae.
Example with the fermenting organism body of its native state energy ferment pentoses comprises bacterium and fungal organism, as some yeast.Preferred wood-sugar fermentation yeast comprises mycocandida, preferably the bacterial strain of shehatae candida (Candida sheatae) or Candida sonorensis; And Pichia, the bacterial strain of preferred pichia stipitis (Pichia stipitis), as the bacterial strain of pichia stipitis CBS5773.Preferred pentose fermentation yeast comprises pipe capsule yeast belong (Pachysolen), the preferably bacterial strain of pachysolen tannophilus (Pachysolen tannophilus).Can not ferment pentoses as the biology of wood sugar and pectinose can be by means known in the art genetic modification and ferment pentoses.
Can effectively hexose be become the bacterium of ethanol to comprise with pentose fermentation, for example, Bacillus coagulans (Bacillus coagulans), clostridium acetobutylicum (Clostridium acetobutylicum), thermal fiber clostridium (Clostridium thermocellum), Clostridium phytofermentans, ground bacillus belong to bacterial classification, separate sugared hot anaerobic bacillus(cillus anaerobicus) (Thermoanaerobacter saccharolyticum) and zymomonas mobilis (Zymomonas mobilis) (Philippidis, 1996, see above).
Other fermenting organism comprises bacillus, as Bacillus coagulans; Mycocandida, as Candida sonorensis, C.methanosorbosa, Di Dansi candiyeast (Candida diddensii), Candida parapsilosis (Candida parapsilosis), C.naedodendra, C.blankii, C.entomophilia, rape candiyeast (C.brassicae), candida pseudotropicalis (Candida pseudotropicalis), Candida boidinii (Candida boidinii), Candida utilis (Candida utilis) and shehatae candida (C.scehatae); Fusobacterium, as clostridium acetobutylicum, thermal fiber clostridium and C.phytofermentans; Intestinal bacteria, the particularly coli strain of genetically modified raising ethanol production; Ground bacillus belongs to bacterial classification; Hansenula, as Hansenula anomala (Hansenula anomala); Klebsiella (Klebsiella), as acid-producing Klebsiella bacterium (Klebsiella oxytoca); Genus kluyveromyces, as kluyveromyces marxianus, Kluyveromyces lactis (K.lactis), K.thermotolerans and Kluyveromyces fragilis; Schizosaccharomyces, as schizosaccharomyces pombe (S.pombe); Hot anaerobic bacillus(cillus anaerobicus) belongs to (Thermoanaerobacter), as separates sugared hot anaerobic bacillus(cillus anaerobicus), and zymomonas (Zymomonas), as the bacterial strain of zymomonas mobilis.
One preferred aspect, yeast is that Brettanomyces belongs to (Bretannomyces).One preferred aspect, yeast is Ke Laosen Brettanomyces (Bretannomyces clausenii).In another more preferred aspect, yeast is candiyeast.In another more preferred aspect, yeast is Candida sonorensis.In another more preferred aspect, yeast is Candida boidinii.In another more preferred aspect, yeast is Candida blankii.In another more preferred aspect, yeast is rape candiyeast.In another more preferred aspect, yeast is Di Dansi candiyeast.In another more preferred aspect, yeast is Candida entomophiliia.In another more preferred aspect, yeast is candida pseudotropicalis.In another more preferred aspect, yeast is shehatae candida.In another more preferred aspect, yeast is Candida utilis.Another preferred aspect, yeast is excellent spore yeast belong (Clavispora).In another more preferred aspect, yeast is Clavispora lusitaniae yeast (Clavispora lusitaniae).In another more preferred aspect, yeast is Root and stem of Cholla rod spore yeast (Clavispora opuntiae).Another preferred aspect, yeast is kluyveromyces.In another more preferred aspect, yeast is Kluyveromyces fragilis.In another more preferred aspect, yeast is kluyveromyces marxianus.In another more preferred aspect, yeast is Kluyveromyces thermotolerans.Another preferred aspect, yeast be pipe capsule yeast belong (Pachysolen).In another more preferred aspect, yeast is pachysolen tannophilus.Another preferred aspect, yeast is pichia spp.In another more preferred aspect, yeast is pichia stipitis.Another preferred aspect, yeast is yeast belong bacterial classification.Another preferred aspect, yeast is yeast saccharomyces cerevisiae.In another more preferred aspect, yeast is saccharomyces diastaticus (Saccharomyces distaticus).In another more preferred aspect, yeast is saccharomyces uvarum (Saccharomyces uvarum).
One preferred aspect, bacterium is genus bacillus species.One preferred aspect, bacterium is Bacillus coagulans.In another more preferred aspect, bacterium is fusobacterium.In another more preferred aspect, bacterium is clostridium acetobutylicum.In another more preferred aspect, bacterium is Clostridium phytofermentans.In another more preferred aspect, bacterium is thermal fiber clostridium.In another more preferred aspect, bacterium is that ground bacillus belongs to bacterial classification.In another more preferred aspect, bacterium is hot anaerobic bacillus(cillus anaerobicus) species.In another more preferred aspect, bacterium is to separate sugared hot anaerobic bacillus(cillus anaerobicus).In another more preferred aspect, bacterium is fermentation single cell bacterium species.In another more preferred aspect, bacterium is zymomonas mobilis.
The yeast that commercially available applicable ethanol produces comprises, for example BIOFERM tMaFT and XR (NABC-North American Bioproducts Corporation, GA, USA), ETHANOL RED tMyeast (Red Star/Lesaffre, USA), FALI tM(Fleischmann ' s Yeast, Burns Philp Food Inc., USA), FERMIOL tM(DSM Specialties), GERT STRAND tM(Gert Strand AB, Sweden) and SUPERSTART tMand THERMOSACC tMfresh yeast (Ethanol Technology, WI, USA).
One preferred aspect, organism of fermentation through genetic modification so that the ability of ferment pentoses to be provided, as utilize wood sugar, utilize pectinose and jointly utilize the microorganism of wood sugar and pectinose.
By heterologous gene being cloned into multiple organism of fermentation, having built and hexose and pentose can have been changed into organism (Chen and the Ho of ethanol (fermentation altogether); 1993; Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae, Appl.Biochem.Biotechnol.39-40:135-147; Ho etc., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl.Environ.Microbiol.64:1852-1859; Kotter and Ciriacy, 1993, Xylose fermentation by Saccharomyces cerevisiae, Appl.Microbiol.Biotechnol.38:776-783; Walfridsson etc.; 1995; Xylose-metabolizing Saccharomyces cerevisiae strains overexpressing the TKL1and TAL1genes encoding the pentose phosphate pathway enzymes transketolase and transaldolase, Appl.Environ.Microbiol.61:4184-4190; Kuyper etc.; 2004; Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation:a proof of principle, FEMS Yeast Research4:655-664; Beall etc., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech.Bioeng.38:296-303; Ingram etc., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnol.Bioeng.58:204-214; Zhang etc., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis, Science267:240-243; Deanda etc., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl.Environ.Microbiol.62:4465-4470; WO2003/062430, xylose isomerase).
One preferred aspect, through the organism of fermentation of genetic modification, be Candida sonorensi.Another preferred aspect, through the organism of fermentation of genetic modification, be intestinal bacteria.Another preferred aspect, through the organism of fermentation of genetic modification, be acid-producing Klebsiella bacterium.Another preferred aspect, described genetically modified organism of fermentation is kluyveromyces marxianus.Another preferred aspect, described genetically modified organism of fermentation is yeast saccharomyces cerevisiae.Another preferred aspect, through the organism of fermentation of genetic modification, be zymomonas mobilis.
As known in the art, above-mentioned organism can also be for generation of other material, as described herein.
Conventionally cellulose materials or the hydrolyzate to degraded adds organism of fermentation, and carries out approximately 8 to approximately 96 hours, for example fermentation in approximately 24 to approximately 60 hours.Temperature is generally approximately 26 ℃ to approximately 60 ℃, for example approximately 32 ℃ or 50 ℃, and at about pH3 for example, to about pH8, about pH4-5,6 or 7.
In one aspect, the cellulose materials of degraded is used to yeast and/or another kind of microorganism, and carry out approximately 12 to approximately 96 hours, as be generally the fermentation of 24-60 hour.In yet another aspect, temperature is preferably approximately 20 ℃ to approximately 60 ℃, and for example approximately 25 ℃ to approximately 50 ℃, and approximately 32 ℃ to approximately 50 ℃, approximately 32 ℃ to approximately 50 ℃, and pH is generally about pH3 to about pH7, and for example about pH4 is to about pH7.Yet some fermenting organism styles, as bacterium, have the suitableeest higher leavening temperature.Yeast or another kind of microorganism are preferably with approximately 10 5-10 12, preferred approximately 10 7-10 10, about 2x10 particularly 8the amount of the every ml fermented liquid of viable count is used.About using the further guidance that yeast ferments to be for example found in " The Alcohol Textbook " (K.Jacques, T.P.Lyons and D.R.Kelsall compile, Nottingham University Press, United Kingdom1999), it is incorporated to herein by carrying stating.
For ethanol, produce, after fermentation, the slurry of distillation fermentation is to extract ethanol.The ethanol that the method according to this invention obtains can be used as for example alcohol fuel, and drinking alcohol is drinkable neutral wines, or industrial alcohol.
Fermentation stimulating substance can be used with any Combination of Methods as herein described, further to improve zymotechnique, especially improves the performance of organism of fermentation, as, speed increases and alcohol getting rate." fermentation stimulating substance " refers to the stimulant for organism of fermentation (particularly yeast) growth.Preferably for the fermentation stimulating substance of growing, comprise VITAMIN and mineral substance.The example of VITAMIN comprises multivitamin, vitamin H, pantothenic acid (salt), nicotinic acid, meso-inositol (meso-inositol), VitB1, pyridoxol (pyridoxine), para-amino benzoic acid, folic acid, riboflavin and vitamin A, B, C, D and E.Referring to, for example, Alfenore etc., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), it is incorporated to herein by carrying stating.The example of mineral substance comprises can provide nutraceutical mineral substance and mineral salt, and described nutrition comprises P, K, Mg, S, Ca, Fe, Zn, Mn and Cu.
tunning: tunning can be any material that is derived from fermentation.Tunning can be to be not limited to alcohol (for example, arabitol, propyl carbinol, isopropylcarbinol, ethanol, glycerine, methyl alcohol, ethylene glycol, 1,3-PD [propylene glycol], butyleneglycol, glycerol, sorbyl alcohol and Xylitol); Alkane (for example pentane, hexane, heptane, octane, nonane, decane, undecane and dodecane); Naphthenic hydrocarbon (for example pentamethylene, hexanaphthene, suberane and cyclooctane); Alkene (for example amylene, hexene, heptene and octene); Amino acid (for example, aspartic acid, L-glutamic acid, glycine, Methionin, Serine and Threonine); Gas (for example, methane, hydrogen (H 2), carbonic acid gas (CO 2) and carbon monoxide (CO)); Isoprene; Ketone (for example, acetone); Organic acid (for example, acetic acid, acetonic acid, hexanodioic acid, xitix, citric acid, 2,5-diketone-D-glyconic acid, formic acid, FUMARIC ACID TECH GRADE, saccharic acid, glyconic acid, glucuronic acid, pentanedioic acid, 3-hydroxy-propionic acid, methylene-succinic acid, lactic acid, oxysuccinic acid, propanedioic acid, oxalic acid, oxaloacetic acid, propionic acid, succsinic acid and xylosic acid); And polyketide.Tunning can also be the protein as high-value product.
One preferred aspect, tunning is alcohol.Will be understood that, term " alcohol " comprises the material that comprises one or more hydroxyl modules.Aspect preferred, described alcohol is propyl carbinol.In another more preferred aspect, described alcohol is isopropylcarbinol.In another more preferred aspect, described alcohol is ethanol.In another more preferred aspect, described alcohol is methyl alcohol.In another more preferred aspect, described alcohol is arabitol.In another more preferred aspect, described alcohol is butyleneglycol.In another more preferred aspect, described alcohol is ethylene glycol.In another more preferred aspect, described alcohol is glycerol (glycerin).In another more preferred aspect, described alcohol is glycerine (glycerol).In another more preferred aspect, described alcohol is 1,3-PD.In another more preferred aspect, described alcohol is sorbyl alcohol.In another more preferred aspect, described alcohol is Xylitol.Referring to, for example, Gong; C.S., Cao, N.J.; Du, J., and Tsao; G.T., 1999, Ethanol production from renewable resources; in Advances in Biochemical Engineering/Biotechnology, Scheper, T. compiles; Springer-Verlag Berlin Heidelberg, Germany, 65:207-241; Silveira, M.M., and Jonas, R., 2002, The biotechnological production of sorbitol, Appl.Microbiol.Biotechnol.59:400-408; Nigam, P. and Singh, D., 1995, Processes for fermentative production of xylitol – a sugar substitute, Process Biochemistry30 (2): 117-124; Ezeji, T.C., Qureshi, N. and Blaschek, H.P., 2003, Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology19 (6): 595-603.
Another preferred aspect, described tunning is alkane.Described alkane can be the alkane of branching or branching not.In another more preferred aspect, described alkane is pentane.In another more preferred aspect, described alkane is hexane.In another more preferred aspect, described alkane is heptane.In another more preferred aspect, described alkane is octane.In another more preferred aspect, described alkane is nonane.In another more preferred aspect, described alkane is decane.In another more preferred aspect, described alkane is undecane.In another more preferred aspect, described alkane is dodecane.
Another preferred aspect, described tunning is naphthenic hydrocarbon.In another more preferred aspect, described naphthenic hydrocarbon is pentamethylene.In another more preferred aspect, described naphthenic hydrocarbon is hexanaphthene.In another more preferred aspect, described naphthenic hydrocarbon is suberane.In another more preferred aspect, described naphthenic hydrocarbon is cyclooctane.
Another preferred aspect, described tunning is alkene.Described alkene can be the alkene of branching not or branching.In another more preferred aspect, described alkene is amylene.In another more preferred aspect, described alkene is hexene.In another more preferred aspect, described alkene is heptene.In another more preferred aspect, described alkene is octene.
Another preferred aspect, described tunning is amino acid.In another more preferred aspect, described organic acid is aspartic acid.In another more preferred aspect, described amino acid is L-glutamic acid.In another more preferred aspect, described amino acid is glycine.In another more preferred aspect, described amino acid is Methionin.In another more preferred aspect, described amino acid is Serine.In another more preferred aspect, described amino acid is Threonine.Referring to, for example, Richard, A. and Margaritis, A., 2004, Empirical modeling of batch fermentation kinetics for poly (glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering87 (4): 501-515.
Another preferred aspect, described material is gas.In another more preferred aspect, described gas is methane.In another more preferred aspect, described gas is H 2.In another more preferred aspect, described gas is CO 2.In another more preferred aspect, described gas is CO.Referring to, for example, Kataoka, N., A.Miya, and K.Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology36 (6-7): 41-47; And Gunaseelan, V.N., 1997, in Biomass and Bioenergy, roll up 13 (1-2): 83-114 page, 1997, Anaerobic digestion of biomass for methane production:A review.
Another preferred aspect, described tunning is isoprene.
Another preferred aspect, described tunning is ketone.It should be understood that term " ketone " contained the material that contains one or more ketone modules.In another more preferred aspect, described ketone is acetone.Referring to, for example Qureshi and Blaschek, 2003, see above.
Another preferred aspect, described tunning is organic acid.In another more preferred aspect, described organic acid is acetic acid.In another more preferred aspect, described organic acid is acetonic acid.In another more preferred aspect, described organic acid is hexanodioic acid.In another more preferred aspect, described organic acid is xitix.In another more preferred aspect, described organic acid is citric acid.In another more preferred aspect, described organic acid is 2,5-diketone-D-glyconic acid.In another more preferred aspect, described organic acid is formic acid.In another more preferred aspect, described organic acid is FUMARIC ACID TECH GRADE.In another more preferred aspect, described organic acid is saccharic acid.In another more preferred aspect, described organic acid is glyconic acid.In another more preferred aspect, described organic acid is glucuronic acid.In another more preferred aspect, described organic acid is pentanedioic acid.Another preferred aspect, described organic acid is 3-hydroxy-propionic acid.In another more preferred aspect, described organic acid is methylene-succinic acid.In another more preferred aspect, described organic acid is lactic acid.In another more preferred aspect, described organic acid is oxysuccinic acid.In another more preferred aspect, described organic acid is propanedioic acid.In another more preferred aspect, described organic acid is oxalic acid.In another more preferred aspect, described organic acid is propionic acid.In another more preferred aspect, described organic acid is succsinic acid.In another more preferred aspect, described organic acid is xylosic acid.Referring to, for example, Chen, R. and Lee, Y.Y., 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl.Biochem.Biotechnol.63-65:435-448.
Another preferred aspect, described material is polyketide.
reclaimcan use any method known in the art, optionally from fermention medium, reclaim tunning, described method includes, but not limited to chromatography, electrophoresis method, differential solubleness, distillation or extraction.For example, the separated also purified alcohols of cellulose materials from fermentation by conventional distillating method.Can obtain purity up to the ethanol of about 96vol.%, it can be used as, for example, and alcohol fuel, drinking alcohol (that is, drinkable neutral alcoholic drinks), or industrial alcohol.
The polypeptide with catalase activity
In the method for the invention, the polypeptide that has a catalase activity can be any polypeptide with catalase activity.One or more protein ingredients that the polypeptide with catalase activity can be used as the enzyme in enzyme composition and/or is added into described composition exist.One preferred aspect, the polypeptide with catalase activity is external sources for one or more components of cellulase composition.
The polypeptide with catalase activity can obtain the microorganism from any genus.In one aspect, the polypeptide obtaining from given source is exocytosis.
The described polypeptide with catalase activity can be bacterial peptide.For example, described polypeptide can be bacillus (Bacillus), streptococcus (Streptococcus), streptomyces (Streptomyces), Staphylococcus (Staphylococcus), enterococcus spp (Enterococcus), lactobacillus (Lactobacillus), lactococcus (Lactococcus), fusobacterium (Clostridium), ground bacillus genus (Geobacillus) or bacillus marinus genus (Oceanobacillus) polypeptide that gram positive bacterium polypeptide for example has catalase activity; Or gram negative bacterium polypeptide, as there is intestinal bacteria (E.coli), Rhodopseudomonas (Pseudomonas), salmonella (Salmonella), campylobacter (Campylobacter), Helicobacterium (Helicobacter), Flavobacterium (Flavobacterium), Fusobacterium (Fusobacterium), mud Bacillaceae (Ilyobacter), eisseria (Neisseria) or Ureaplasma (Ureaplasma) polypeptide of catalase activity.
In one aspect, the described polypeptide with catalase activity is the Alkaliphilic bacillus (Bacillus alkalophilus) with catalase activity, bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus brevis (Bacillus brevis), Bacillus circulans (Bacillus circulans), Bacillus clausii (Bacillus clausii), Bacillus coagulans (Bacillus coagulans), bacillus firmus (Bacillus firmus), bacillus lautus (Bacillus lautus), bacillus lentus (Bacillus lentus), Bacillus licheniformis (Bacillus licheniformis), bacillus megaterium (Bacillus megaterium), bacillus pumilus (Bacillus pumilus), bacstearothermophilus (Bacillus stearothermophilus), subtilis (Bacillus subtilis) or bacillus thuringiensis (Bacillus thuringiensis) polypeptide.
The polypeptide in yet another aspect, with catalase activity is streptococcus equisimilis (Streptococcus equisimilis), streptococcus pyogenes (Streptococcus pyogenes), streptococcus uberis (Streptococcus uberis) or streptococcus equi beast pest subspecies (the Streptococcus equi subsp.Zooepidemicus) polypeptide with catalase activity.
The polypeptide in yet another aspect, with catalase activity be there is catalase activity do not produce look streptomycete (Streptomyces achromogenes), deinsectization streptomycete (Streptomyces avermitilis), sky blue streptomycete (Streptomyces coelicolor), streptomyces griseus (Streptomyces griseus) or shallow Streptomyces glaucoviolaceus (Streptomyces lividans) polypeptide.
The described polypeptide with catalase activity also can be fungi polypeptide, and more preferably yeast polypeptides as thering is mycocandida (Candida), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), yeast belong (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or the mould genus of Western alpine yarrow (Yarrowia) polypeptide of catalase activity, or more preferably filamentous fungus polypeptide as have catalase activity branch the mould genus of top spore (Acremonium), Agaricus (Agaricus), Alternaria (Alternaria), Aspergillus (Aspergillus), aureobasidium genus (Aureobasidium), Botryospaeria, intend wax Pseudomonas (Ceriporiopsis), hair beak shell belongs to (Chaetomidium), Chrysosporium (Chrysosporium), Claviceps, Cochliobolus, Coprinus (Coprinopsis), Coptotermes, rod softgel shell belongs to (Corynascus), hidden clump red shell Pseudomonas (Cryphonectria), genera cryptococcus (Cryptococcus), Diplodia (Diplodia), Exidia (Exidia), Filibasidium, fusarium (Fusarium), Gibberella (Gibberella), full flagellum Eimeria (Holomastigotoides), Humicola (Humicola), rake teeth Pseudomonas (Irpex), Agaricus (Lentinula), Leptospaeria, Magnaporthe grisea belongs to (Magnaporthe), Melanocarpus, Polyporus (Meripilus), Mucor (Mucor), myceliophthora (Myceliophthora), the mould genus of Xin Kaoma fat (Neocallimastix), Neurospora (Neurospora), paecilomyces (Paecilomyces), Penicillium (Penicillium), flat lead fungi belongs to (Phanerochaete), cud Chytridium (Piromyces), Poitrasia, false black Peziza (Pseudoplectania), Pseudotrichonympha, Rhizomucor (Rhizomucor), Schizophyllum (Schizophyllum), capital spore belongs to (Scytalidium), Talaromyces (Talaromyces), thermophilic ascomycete belongs to (Thermoascus), Thielavia (Thielavia), Tolypocladium (Tolypocladium), Trichoderma (Trichoderma), the Peziza that becomes mildewed (Trichophaea), Verticillium (Verticillium), Volvaria (Volvariella) or Xylaria (Xylaria) polypeptide.
In yet another aspect, described polypeptide is the saccharomyces carlsbergensis (Saccharomyces carlsbergensis) with catalase activity, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomyces diastaticus), Doug Laplace yeast (Saccharomyces douglasii), Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or ellipsoideus yeast (Saccharomyces oviformis) polypeptide.
In yet another aspect, described polypeptide is the solution fiber branch top spore mould (Acremonium cellulolyticus) with catalase activity, microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), Aspergillus fumigatus (Aspergillus fumigatus), smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), chrysosporium keratinophilum (Chrysosporium keratinophilum), Chrysosporium lucknowense, chrysosporium tropicum (Chrysosporium tropicum), Chrysosporium merdarium, Chrysosporium inops, felt gold pityrosporion ovale (Chrysosporium pannicola), Chrysosporium queenslandicum, Chrysosporium zonatum, bar spore shape sickle spore (Fusarium bactridioides), F.graminearum schw (Fusarium cerealis), storehouse prestige sickle spore (Fusarium crookwellense), machete sickle spore (Fusarium culmorum), fusarium graminaria (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), sulphur look sickle spore (Fusarium sulphureum), circle sickle spore (Fusarium torulosum), intend silk spore sickle spore (Fusarium trichothecioides), empiecement sickle spore (Fusarium venenatum), ash humicola lanuginosa (Humicola grisea), Humicola insolens (Humicola insolens), dredge cotton shape humicola lanuginosa (Humicola lanuginosa), white rake teeth bacterium (Irpex lacteus), rice black wool mould (Mucor miehei), thermophilic fungus destroyed wire (Myceliophthora thermophila), Neuraspora crassa (Neurospora crassa), Penicillium emersonii, penicillium funiculosum (Penicillium funiculosum), penicillium purpurogenum (Penicillium purpurogenum), the yellow flat lead fungi of spore (Phanerochaete chrysosporium), Talaromyces stipitatus, tangerine orange thermophilic ascomycete (Thermoascus aurantiacus), colourless shuttle spore shell (Thielavia achromatica), Thielavia albomyces, Thielavia albopilosa, Australia shuttle spore shell (Thielavia australeinsis), Thielavia fimeti, Thielavia microspora (Thielavia microspora), ovum spore shuttle spore shell (Thielavia ovispora), Thielavia peruviana, knurl spore shuttle spore shell (Thielavia spededonium), hair shuttle spore shell (Thielavia setosa), Thielavia subthermophila, autochthonal shuttle spore mould (Thielavia terrestris), trichoderma harziarum (Trichoderma harzianum), healthy and free from worry wood mould (Trichoderma koningii), long shoot wood mould (Trichoderma longibrachiatum), Trichodermareesei (Trichoderma reesei) or viride (Trichoderma viride) polypeptide.
In a preferred embodiment, the polypeptide that has a catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.In a preferred embodiment, the polypeptide with catalase activity is the catalase from tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Humicola insolens or Penicillium emersonii.
Suitable catalase and the non-limiting example of encoding sequence thereof are listed in the table below.
SEQ ID NO:1 and 2: from catalatic polynucleotide and the polypeptide of tangerine orange thermophilic ascomycete (Thermoascus aurantiacus), described in JP2004261137A.
SEQ ID NO:3 and 4: from catalatic polynucleotide and the polypeptide of Talaromyces stipitatus, it can prepare described in embodiment 9-13.
SEQ ID NO:5 and 6: from catalatic polynucleotide and the polypeptide of Humicola insolens, it can prepare described in embodiment 14-20.
SEQ ID NO:7 and 8: from catalatic polynucleotide and the polypeptide of Penicillium emersonii, it can prepare described in embodiment 21-27.
SEQ ID NO:9 and 10: from catalatic polynucleotide and the polypeptide of Thermus Brockianus, described in WO2005/044994.
SEQ ID NO:11 and 12: from catalatic polynucleotide and the polypeptide of Saccharomyces pastorianus, described in WO2007/105350.
SEQ ID NO:13 and 14: from catalatic polynucleotide and the polypeptide of Saccharomyces pastorianus, described in WO2007/105350.
SEQ ID NO:15 and 16: from catalatic polynucleotide and the polypeptide of having a liking for loose mould, described in WO2009/104622.
SEQ ID NO:17 and 18: from catalatic polynucleotide and the polypeptide of grey humicola lanuginosa, described in WO2009/104622.
SEQ ID NO:19 and 20: from catalatic polynucleotide and the polypeptide of autochthonal shuttle spore shell, described in WO2010/074972.
SEQ ID NO:21 and 22: come catalatic polynucleotide and the polypeptide of self-heating Polyglucosidase genus bacillus (Bacillus thermoglucosidasius), described in JP11243961A.
SEQ ID NO:23 and 24: from catalatic polynucleotide and the polypeptide of aspergillus oryzae, described in JP2002223772A.
SEQ ID NO:25 and 26: from catalatic polynucleotide and the polypeptide of tangerine orange thermophilic ascomycete, described in JP2007143405A.
SEQ ID NO:27 and 28: come catalatic polynucleotide and the polypeptide of self-heating Polyglucosidase genus bacillus, as US6, described in 022,721.
SEQ ID NO:29 and 30: come catalatic polynucleotide and the polypeptide of self-heating Polyglucosidase genus bacillus, as US6, described in 022,721.
SEQ ID NO:31 and 32: from catalatic polynucleotide and the polypeptide of alcaligenes aquamarinus (Alcaligenes aquamarinus), described in WO98/00526.
SEQ ID NO:33 and 34: from catalatic polynucleotide and the polypeptide of the micro-cyanobacteria that quivers of blackening (Microscilla furvescens), described in WO98/00526.
SEQ ID NO:35 and 36: from catalatic polynucleotide and the polypeptide of aspergillus niger, as US5, described in 360,901.
SEQ ID NO37: the catalatic polypeptide of a kind of black humicola lanuginosa heat tolerance (GENESEQP:AXQ55105 is disclosed in WO2009104622).
In one embodiment, mature polypeptide for catalase of the present invention and SEQ ID NO:2, the mature polypeptide of SEQ ID NO:4, the mature polypeptide of SEQ ID NO:6, the mature polypeptide of SEQ ID NO:8, the mature polypeptide of SEQ ID NO:10, the mature polypeptide of SEQ ID NO:12, the mature polypeptide of SEQ ID NO:14, the mature polypeptide of SEQ ID NO:16, the mature polypeptide of SEQ ID NO:18, the mature polypeptide of SEQ ID NO:20, the mature polypeptide of SEQ ID NO:22, the mature polypeptide of SEQ ID NO:24, the mature polypeptide of SEQ ID NO:26, the mature polypeptide of SEQ ID NO:28, the mature polypeptide of SEQ ID NO:30, the mature polypeptide of SEQ ID NO:32, the mature polypeptide of SEQ ID NO:34, the mature polypeptide of SEQ ID NO:36, the mature polypeptide of SEQ ID NO:37 has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 78%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, it has catalase activity.
The amino acid/11 to 19 of SignalP program prediction SEQ ID NO:4 is signal peptides, and mature polypeptide is the amino acid 20 to 733 of SEQ ID NO:4.In yet another aspect, according to the amino acid/11 to 19 of SignalP program prediction SEQ ID NO:6, are signal peptides, mature polypeptide is the amino acid 20 to 765 of SEQ ID NO:6.In yet another aspect, according to the amino acid/11 to 19 of SignalP program prediction SEQ ID NO:8, are signal peptides, mature polypeptide is the amino acid 20 to 741 of SEQ ID NO:8.Be known in the art the mixture that host cell can produce two or more different mature polypeptides (having different C end and/or N terminal amino acid) of being expressed by identical polynucleotide.
In another embodiment, be used for catalase of the present invention by such polynucleotide encoding, described polynucleotide are at low stringency condition, medium stringent condition, medium-Gao stringent condition, under high stringent condition or very high stringent condition, hybridize with following: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, the mature polypeptide encoded sequence of SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5, or the mature polypeptide encoded sequence of SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (Sambrook etc. (ii), 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
For the present invention, hybridization shows that polynucleotide hybridize in the nucleic acid probe of the mark corresponding to following being low to moderate very much under very high stringent condition: (i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7; (ii) the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3 is, the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7; (iii) their cDNA sequence; Or (iv) their total length complementary strand; Or their subsequence.Can use with the molecule of described nucleic acid probe hybridization under these conditions, for example X ray or other any detection meanss as known in the art detect.
In one embodiment, be used for catalase of the present invention by polynucleotide encoding, the mature polypeptide encoded sequence of described polynucleotide and SEQ ID NO:1, the mature polypeptide encoded sequence of SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5, or the mature polypeptide encoded sequence of SEQ ID NO:7, or their cDNA sequence has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 78%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.
In one embodiment, mature polypeptide encoded sequence is Nucleotide 1 to 2351 or its cDNA sequence of SEQ ID NO:1.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of SignalP program prediction SEQ ID NO:3, mature polypeptide encoded sequence is Nucleotide 58 to 2418 or its cDNA sequence of SEQ ID NO:3.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of SignalP program prediction SEQ ID NO:5, mature polypeptide encoded sequence is Nucleotide 58 to 3040 or its cDNA sequence of SEQ ID NO:5.In another embodiment, according to Nucleotide 1 to the 57 coded signal peptide of SignalP program prediction SEQ ID NO:7, mature polypeptide encoded sequence is Nucleotide 58 to 2476 or its cDNA sequence of SEQ ID NO:7.
In another embodiment, the variant that relates to the mature polypeptide of SEQ ID NO:2 for catalase of the present invention, the variant of the mature polypeptide of SEQ ID NO:4, the variant of the mature polypeptide of SEQ ID NO:6, or the variant of the mature polypeptide of SEQ ID NO:8, it for example, comprises replacement, disappearance and/or inserts in one or more (several) position.In one embodiment, introduce the mature polypeptide of SEQ ID NO:2, the mature polypeptide of SEQ ID NO:4, the mature polypeptide of SEQ ID NO:6, the quantity of aminoacid replacement, disappearance and/or the insertion of the mature polypeptide of SEQ ID NO:8 is 10 of as many as, for example 1,2,3,4,5,6,7,8,9 or 10.Amino acid change can be less important in nature (of a minor nature), i.e. conservative aminoacid replacement or insertion, its not remarkably influenced protein folding and/or active; Be generally 1 to about 30 amino acid whose little disappearances; Little amino or C-terminal extend, for example N-terminal methionine residues; The little joint peptide of the about 20-25 of an as many as residue; Or by changing net charge or other function, promote the little extension of purifying, as polyhistidine sequence (poly histidine tract), epitope (antigenic epitope) or in conjunction with territory (binding domain).
The conservative example replacing is within following group: basic aminoacids group (arginine, Methionin and Histidine), acidic amino acid group (L-glutamic acid and aspartic acid), polare Aminosaeren group (glutamine and l-asparagine), hydrophobic amino acid group (leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid group (phenylalanine, tryptophane and tyrosine) and p1 amino acid group (glycine, L-Ala, Serine, Threonine and methionine(Met)).Conventionally the aminoacid replacement that does not change given activity is known in the art, and by for example H.Neurath and R.L.Hill, 1979, in The Proteins, Academic Press, describes in New York.The exchange the most generally occurring is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly.
Or amino acid change has the character of the physicochemical property change that causes polypeptide.For example, amino acid change can improve the thermostability of polypeptide, changes substrate specificity, changes optimal pH etc.
Can be according to methods known in the art, for example site-directed mutagenesis or alanine scanning mutagenesis method (Cunningham and Wells, 1989, Science244:1081-1085) identify the indispensable amino acid in parent's polypeptide.In a rear technology, single alanine mutation is incorporated into each residue in molecule, and whether test gained mutating molecule there is catalase activity, to identify the amino-acid residue for the activity key of described molecule.Equally referring to Hilton etc., 1996, J.Biol.Chem.271:4699-4708.The reactive site of enzyme or other biological interaction also can pass through the physical analysis to the structure by technical measurements such as nucleus magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with the amino acid whose sudden change in contact site to inferring, measure.Referring to such as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol.224:899-904; Wlodaver etc., 1992, FEBS Lett.309:59-64.The identity of indispensable amino acid also can from related polypeptide compare infer.
Can use known mutagenesis, restructuring and/or Shuffling Method, then carry out relevant screening process, as by Reidhaar-Olson and Sauer, 1988, Science241:53-57; Bowie and Sauer, 1989, Proc.Natl.Acad.Sci.USA86:2152-2156; WO95/17413; Or WO95/22625 disclosed those, carry out one or more aminoacid replacement, disappearance and/or insert and tested.Other spendable methods comprise that fallibility PCR, phage display are (such as Lowman etc., 1991, Biochemistry30:10832-10837; U.S. Patent number 5,223,409; WO92/06204) and region directed mutagenesis (region-directed mutagenesis) (Derbyshire etc., 1986, Gene46:145; Deng, 1988, DNA7:127).
Mutagenesis/Shuffling Method can be with high-throughput, automatically screening Combination of Methods to detect the activity (Ness etc., 1999, Nature Biotechnology17:893-896) by the polypeptide through clone, mutagenesis of host cell expression.The DNA molecular through mutagenesis of coding active polypeptide can reclaim and use this area standard method to check order rapidly from host cell.These methods allow to determine fast the importance of single amino acids residue in polypeptide.
Described polypeptide can be hybrid polypeptide, and the region of one of them polypeptide is blended in N end or the C end in the region of another polypeptide.
Described polypeptide can be the fusion polypeptide that fusion polypeptide maybe can be cut, and wherein another polypeptide is blended in N end or the C end of polypeptide of the present invention.By being blended in to polynucleotide of the present invention, the polynucleotide of another polypeptide of coding produce fusion polypeptide.The technology that produces fusion polypeptide is known in the art, and comprises and connect the encoding sequence of coded polypeptide so that they meet frame (in frame), and makes the expression of fusion polypeptide under the control of identical promoters and terminator.Fusion polypeptide also can be used interior albumen (intein) technique construction, wherein fusions after translation, produce (Cooper etc., 1993, EMBO J.12:2575-2583; Dawson etc., 1994, Science266:776-779).
Fusion polypeptide can also comprise cleavage site between two polypeptide.Once fusion polypeptide is secreted, described site is just cut, discharges described two polypeptide.The example of cleavage site includes, but not limited to be disclosed in Martin etc., 2003, J.Ind.Microbiol.Biotechnol.3:568-76; Svetina etc., 2000, J.Biotechnol.76:245-251; Rasmussen-Wilson etc., 1997, Appl.Environ.Microbiol.63:3488-3493; Ward etc., 1995, Biotechnology13:498-503; With Contreras etc., 1991, Biotechnology9:378-381; Eaton etc., 1986, Biochem.25:505-512); Collins-Racie etc., 1995, Biotechnology13:982-987; Carter etc., 1989, Proteins:Structure, Function, and Genetics6:240-248; And Stevens, the site in 2003, Drug Discovery World4:35-48.
The example that is applicable to commercial catalase prepared product of the present invention comprises for example Terminox Ultra50L/200L (Novozymes A/S), Catazyme25L (Novozymes A/S), GC118 (Danisco A/S), Oxygone T100/T400 (Danisco A/S), ASC Super200L (Mitsubishi Chemicals, Japan) and Reyonet200L (Nagase, Japan).
Nucleic acid construct
For example, for coded polypeptide (cellulolytic enzyme, the polypeptide with catalase activity, there is the polypeptide of cellulolytic enhancing activity etc.) separated polynucleotide, can handle in many ways by building nucleic acid construct, so that the expression of described polypeptide to be provided, the separated polynucleotide that nucleic acid construct comprises coding said polypeptide, it for example, is operably connected with one or more (several) regulating and controlling sequence, and described regulating and controlling sequence instructs the expression of encoding sequence in appropriate host cell under the condition compatible with this regulating and controlling sequence.Can be with being permitted described in multi-mode operation polynucleotide so that the expression of polypeptide to be provided.Depend on expression vector, it may be desirable or essential operating on it before by polynucleotide insertion vector.The technology of using recombinant DNA method to modify polynucleotide sequence is well known in the art.
Regulating and controlling sequence can be promotor, and it is identified for expressing the polynucleotide of the polynucleotide of coded polypeptide by host cell.The transcription regulating nucleotide sequence that promotor contains the expression that mediates polypeptide.Promotor can be any polynucleotide that show transcriptional activity in host cell, comprises sudden change, brachymemma and promotor heterozygosis, and can the born of the same parents' gene acquisition or polypeptide in born of the same parents with host cell homology or allos from coding.
It for instructing the example of the suitable promotor that nucleic acid construct of the present invention transcribes at bacterial host cell, is the promotor from following acquisition: bacillus amyloliquefaciens alpha-amylase gene (amyQ), bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), bacstearothermophilus produces malt amylase gene (amyM), subtilis type froctosan saccharase gene (sacB), subtilis xylA and xylB gene, bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular Microbiology13:97-107), intestinal bacteria lac operon, intestinal bacteria trc promotor (Egon etc., 1988, Gene69:301-315), sky blue streptomycete gelase gene (dagA) and protokaryon β-lactamase gene (Villa-Kamaroff etc., 1978, Proceedings of the National Academy of Sciences USA75:3727-3731), and tac promotor (DeBoer etc., 1983, Proc.Natl.Acad.Sci.USA80:21-25).Other promotor is at " Useful proteins from recombinant bacteria " in Gilbert etc., and 1980, Scientific American, in 242:74-94; With at Sambrook etc., 1989, middle description sees above.The example of Gene expression is disclosed in WO99/43835.
It for instructing nucleic acid construct of the present invention, at the example of the suitable promotor of filamentous fungal host cell transcription, is the promotor from the gene acquisition of following enzyme: Aspergillus nidulans acetamidase, aspergillus niger neutral alpha-amylase, aspergillus niger acid acceptance α-amylase, aspergillus niger or Aspergillus awamori glucoamylase (glaA), aspergillus oryzae TAKA amylase, aspergillus oryzae Sumizyme MP, aspergillus oryzae triose-phosphate isomerase, point sickle spore trypsin-like proteolytic enzyme (WO96/00787), empiecement sickle spore amyloglucosidase (WO00/56900), empiecement sickle spore Daria (WO00/56900), empiecement sickle spore Quinn (WO00/56900), Man Hegen Mucor (Rhizomucor miehei) lipase, Man Hegen Mucor aspartate protease, Trichodermareesei beta-glucosidase enzyme, Trichodermareesei cellobiohydrolase I, Trichodermareesei cellobiohydrolase II, trichoderma reesei endoglucanase I, trichoderma reesei endoglucanase II, trichoderma reesei endoglucanase III, trichoderma reesei endoglucanase IV, trichoderma reesei endoglucanase V, Xylanase from Trichoderma reesei I, Xylanase from Trichoderma reesei II, Trichodermareesei xylobiase, and NA2-tpi promotor (a kind of promotor of modification, it carrys out comfortable Aspergillus neutral alpha-amylase gene, and wherein untranslated leader sequence is substituted by the untranslated leader sequence of the gene of Aspergillus triose-phosphate isomerase, limiting examples comprises the promotor of modification, and it is from the gene of aspergillus niger neutral alpha-amylase, and wherein untranslated leader sequence is substituted by the untranslated leader sequence of the gene of Aspergillus nidulans or aspergillus oryzae triose-phosphate isomerase), with their sudden change, brachymemma and promotor heterozygosis.
In yeast host, useful promotor obtains from following gene: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae galactokinase (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), yeast saccharomyces cerevisiae triose-phosphate isomerase (TPI), brewing yeast metallothionein (CUP1) and yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase.For other useful promotor of yeast host cell, by Romanos etc., 1992, Yeast8:423-488 describes.
Regulating and controlling sequence can be also transcription terminator, and it is identified to stop transcribing by host cell.Described terminator is operably connected with 3 ' end of the polynucleotide of coding said polypeptide.In the present invention, can use any terminator that has function in host cell.
For the preferred terminator of bacterial host cell, from following gene, obtain: Bacillus clausii Sumizyme MP (aprH), bacillus licheniformis alpha-amylase (amyL) and intestinal bacteria ribosome-RNA(rRNA) (rrnB).
For the preferred terminator of filamentous fungal host cell, from the gene of following enzyme, obtain: Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger glucoamylase, aspergillus niger alpha-glucosidase, aspergillus oryzae TAKA amylase and sharp sickle spore trypsin-like proteolytic enzyme.
For the preferred terminator of yeast host cell, from the gene of following enzyme, obtain: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate, brewing yeast cell pigment C (CYC1) and yeast saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.For other useful terminator of yeast host cell by Romanos etc., 1992, description sees above.
Regulating and controlling sequence can also be the mRNA stabilization district of the encoding sequence upstream of promotor downstream and gene, and it increases the expression of described gene.
The example in suitable mRNA stabilization district obtains from following gene: bacillus thuringiensis cryIIIA gene (WO94/25612) and subtilis SP82 gene (Hue etc., 1995, Journal of Bacteriology177:3465-3471).
Regulating and controlling sequence can also be suitable leader sequence, and it is for the important mRNA non-translational region of the translation of host cell.Leader sequence is operably connected to 5 '-end of the polynucleotide of coded polypeptide.Can use any leader sequence that has function in host cell.
For the preferred leader sequence of filamentous fungal host cell, from the gene of following enzyme, obtain: aspergillus oryzae TAKA amylase and Aspergillus nidulans triose-phosphate isomerase.
The leader sequence suitable for yeast host cell obtains from the gene of following enzyme: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
Regulating and controlling sequence can be also polyadenylation sequence, and it is the sequence being operably connected with 3 ' end of polynucleotide, and when transcribing, host cell is identified as the signal that poly-adenosine residue is added into the mRNA transcribing.Can use any polyadenylation sequence that has function in host cell.
For the preferred polyadenylation sequence of filamentous fungal host cell, from the gene of following enzyme, obtain: Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger glucoamylase, aspergillus niger alpha-glucosidase, aspergillus oryzae TAKA amylase and sharp sickle spore trypsin-like proteolytic enzyme.
For the useful polyadenylation sequence of yeast host cell, by Guo and Sherman, 1995, Mol.Cellular Biol.15:5983-5990 describes.
Regulating and controlling sequence can also be signal peptide coding region, and its coding holds with the N of polypeptide the signal peptide being connected, and and guides described polypeptide to enter emiocytosis approach.Encoding sequence 5 ' the end of polynucleotide can comprise signal coding sequence inherently, and it is connected in translation reading frame natively with together with the section of the encoding sequence of coding said polypeptide.Or encoding sequence 5 ' end can contain the signal coding sequence for described encoding sequence external source.It is essential that external source signal coding sequence can be when encoding sequence does not contain signal coding sequence natively.Or external source signal coding sequence can replace natural signals peptide-coding sequence simply to strengthen the secretion of polypeptide.Yet the polypeptide of can instruction expressing enters any signal coding sequence of the Secretory Pathway of host cell.
For the effective signal coding sequence of bacterial host cell, be the signal coding sequence from the gene acquisition of following enzyme: bacillus NCIB11837 produces maltogenic amylase, Bacillus licheniformis subtilisin (subtilisin), Bacillus licheniformis β-lactamase, bacillus stearothermophilus alpha-amylase, bacstearothermophilus neutral protease (nprT, nprS, nprM) and subtilis prsA.Other signal peptide is by Simonen and Palva, and 1993, Microbiological Reviews57:109-137 describes.
For the effective signal coding sequence of filamentous fungal host cell, be the signal coding sequence from the gene acquisition of following enzyme: aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens EGV, thin cotton shape humicola lanuginosa lipase and Man Hegen Mucor aspartate protease.
The signal peptide useful for yeast host cell obtains from the gene of yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae saccharase.Other useful signal coding sequence is by Romanos etc., and 1992, description sees above.
Regulating and controlling sequence can also be propeptide code sequence, and its coding is positioned at the propetide of polypeptide N end.Gained polypeptide is called proenzyme (proenzyme) or front polypeptide (propolypeptide) (or being called in some cases proenzyme (zymogen)).Front polypeptide is non-activity normally, and catalysis that can be by propetide or autocatalysis cutting in the past polypeptide be converted into active polypeptide.Can obtain propeptide code sequence from the gene of bacillus subtilis alkali proteinase (aprE), subtilis neutral protease (nprT), thermophilic fungus destroyed wire laccase (WO95/33836), Man Hegen Mucor aspartate protease and yeast saccharomyces cerevisiae alpha factor.
When the two all exists when signal peptide and propeptide sequence, and then propeptide sequence is placed in to the N end of (next to) polypeptide, and signal peptide sequence is placed in to the and then N end of propeptide sequence.
It is desirable to equally add regulating sequence, its growth with respect to host cell regulates the expression of polypeptide.The example that regulates sequence is to cause genetic expression response chemistry or physical stimulation thing, comprises those sequences that regulate the existence of compound and open or close.Adjusting sequence in prokaryotic system comprises lac, tac and trp operator gene sequence.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, can use aspergillus niger glucoamylase promotor, aspergillus oryzae TAKA α-amylase promotor and aspergillus oryzae glucoamylase promotor.Other example that regulates sequence is those sequences that allow gene amplification.In eukaryotic system, these regulate sequence to be included in the dihydrofolate reductase gene that methotrexate (methotrexate) exists lower amplification, and the metallothionein gene increasing with heavy metal (with heavy metal).In these cases, the polynucleotide of coded polypeptide will be operably connected with regulating sequence.
Expression vector
Above-mentioned multiple Nucleotide and regulating and controlling sequence can combine to produce recombinant expression vector, described expression vector can comprise one or more (for example several) easily restriction site to allow to insert or to replace in these sites the polynucleotide of coded polypeptide, described polypeptide is cellulolytic enzyme for example, the polypeptide with catalase activity, has the polypeptide of cellulolytic enhancing activity etc.Alternative, can insert the nucleic acid construct or the polynucleotide that comprise described polynucleotide by the carrier for expressing suitable and express described polynucleotide.In preparing the process of expression vector, encoding sequence is placed in to carrier, thereby this encoding sequence is operably connected for expression with suitable regulating and controlling sequence.
Recombinant expression vector can be any carrier (for example, plasmid or virus), and it can carry out recombinant DNA step and the expression that can produce polynucleotide easily.The selection of carrier will conventionally depend on carrier and will introduce the consistency of the host cell of this carrier.Carrier can be wire or closed hoop plasmid.
Carrier can be autonomously replicationg vector, that is, the carrier existing as the outer entity (entity) of karyomit(e), it copies and is independent of chromosome duplication, for example, plasmid, extra-chromosomal element, minichromosome (minichromosome) or artificial chromosome.Carrier can contain any for guaranteeing the means (means) of self replication.Or carrier can be a kind of in being introduced into host cell time, is incorporated in genome and the carrier having copied together with having integrated the karyomit(e) of this carrier.In addition, can use independent carrier or plasmid or two or more carriers or plasmid, the global DNA (total DNA) that it contains host cell gene group to be introduced jointly, maybe can be used transposon (transposon).
Selected marker that described carrier preferably contains one or more (for example several), it allows the simple cell of selecting through conversion, transfection, transduction etc.Selected marker is gene, and its product provides biocide or virus resistance, to the resistance of heavy metal, to auxotrophic prototrophy (prototrophy to auxotrophs) etc.
The example of selective bacterium mark is Bacillus licheniformis or subtilis dal gene, or gives the mark of antibiotics resistance, and described antibiotics resistance is penbritin, paraxin, kantlex, Liu Suanyan NEOMYCIN SULPHATE, spectinomycin or tetracyclin resistance for example.For the suitable mark of yeast host cell, include but not limited to ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.Selected marker for filamentous fungal host cell includes but not limited to amdS (acetamidase), argB (ornithine transcarbamylase), bar (careless ammonium phosphine (phosphinothricin) Transacetylase), hph (hygromix phosphotransferase), niaD (nitrate reductase) (nitrate reductase), pyrG (Orotidine-5 '-'-phosphate decarboxylase) (orotidine-5 '-phosphate decarboxylase), sC (sulfate adenylyl transferase) and trpC (o-amino benzoyl acid synthase (anthranilate synthase)) and their equivalent.Preferably be used in Aspergillus cell is Aspergillus nidulans or aspergillus oryzae amdS and pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus) bar gene.
Described carrier preferably contains element, and it allows carrier to be integrated into host cell gene group or carrier is independent of genomic self-replicating in cell.
In order to be integrated into host cell gene group, the polynucleotide of the responsible coded polypeptide of carrier or for enter genomic any other carrier element by homology or non-homogeneous recombination and integration.Or carrier can contain extra polynucleotide, be used in reference to conducting and cross homologous recombination and be integrated into the exact position in host cell gene group chromosome.The probability of integrating in order to be increased in exact position, integrated element should contain the nucleic acid of sufficient amount, as 100 to 10,000 base pair, 400 to 10,000 base pairs, with 800 to 10,000 base pairs, it has height sequence identity to strengthen the probability of homologous recombination with corresponding target sequence.Integrated element can be any sequence, the target sequence homology in itself and host cell gene group.In addition, integrated element can be the polynucleotide of non-coding or coding.On the other hand, carrier can be passed through to non-homogeneous recombination and integration in the genome of host cell.
For self-replicating, carrier can further comprise replication orgin, and it can independently copy carrier in described host cell.Replication orgin can be any plasmid replicon (replicator) of mediation self-replicating, and it brings into play function in cell.Term " replication orgin " or " plasmid replicon " mean to make the polynucleotide that copy in plasmid or carrier body.
The example of bacterium replication orgin is the replication orgin that allows plasmid pBR322, pUC19, pACYC177 and the pACYC184 copy in intestinal bacteria, and allows the replication orgin of plasmid pUB110, the pE194, pTA1060 and the pAM β 1 that copy in bacillus.
The example that is used for the replication orgin of yeast host cell is 2 microns of replication orgin, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
In filamentous fungal cells, the example of useful replication orgin is AMA1 and ANS1 (Gems etc., 1991, Gene98:61-67; Cullen etc., 1987, Nucleic Acids Res.15:9163-9175; WO00/24883).Plasmid or carrier that separation of AM A1 gene and structure comprise this gene can complete according to the method being disclosed in WO00/24883.
Can be by the polynucleotide Insertion Into Host Cell of more than one copy to increase the generation of polypeptide.The increase of polynucleotide copies number can obtain by the following method: the sequence of at least one additional copy is integrated into host cell gene group, or the selected marker that can increase is included in polynucleotide, under wherein can existing by the selective agent suitable (selectable agent), culturing cell is selected the amplification copy that contains selected marker, and contains thus the cell of the additional copy of polynucleotide.
For connect said elements with build the method for recombinant expression vector be well known to those skilled in the art (referring to, for example, Sambrook etc., 1989, see above).
Host cell
The recombinant host cell of the polynucleotide that comprise coded polypeptide (cellulolytic enzyme for example, has the polypeptide of catalase activity, has the polypeptide of cellulolytic enhancing activity) etc. can be advantageously used in restructuring and produce described polypeptide.The construct that comprises polynucleotide or carrier are introduced to host cell, described construct or carrier are maintained as chromosomal integration body or as carrier outside the karyomit(e) of self replication as previously mentioned.Term " host cell " comprises the spawn of parental cell, and it is because the sudden change occurring in reproduction process is different from parental cell.The selection of host cell will depend on gene and the source thereof of coded polypeptide to a great extent.
Host cell can be useful any cell in the restructuring of polypeptide produces, for example, and protokaryon or eukaryotic cell.
Prokaryotic host cell can be any Gram-positive or gram negative bacterium.Gram positive bacterium includes but not limited to, bacillus, fusobacterium, enterococcus spp, ground bacillus genus, lactobacillus, lactococcus, bacillus marinus genus, Staphylococcus, streptococcus and streptomyces.Gram negative bacterium includes but not limited to, campylobacter, intestinal bacteria, Flavobacterium, Fusobacterium, Helicobacterium, mud Bacillaceae, eisseria, Rhodopseudomonas, salmonella and Ureaplasma.
Bacterial host cell can be any bacillus cell, includes but not limited to Alkaliphilic bacillus, bacillus amyloliquefaciens, bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, bacillus firmus, bacillus lautus, bacillus lentus, Bacillus licheniformis, bacillus megaterium, bacillus pumilus, bacstearothermophilus, subtilis and bacillus thuringiensis cell.
Bacterial host cell can also be any streptococcus cell, includes but not limited to streptococcus equisimilis, streptococcus pyogenes, streptococcus uberis and streptococcus equi beast pest subspecies cell.
Bacterial host cell can also be any streptomyces cell, includes but not limited to, does not produce look streptomycete, deinsectization streptomycete, sky blue streptomycete, streptomyces griseus and shallow Streptomyces glaucoviolaceus cell.
Can realize DNA is incorporated into bacillus cell by the following method: protoplast transformation (referring to, for example, Chang and Cohen, 1979, Mol.Gen.Genet.168:111-115), the cell transformation of use competence (referring to, for example, Young and Spizizen, 1961, J.Bacteriol.81:823-829 or Dubnau and Davidoff-Abelson, 1971, J.Mol.Biol.56:209-221), electroporation (referring to, for example, Shigekawa and Dower, 1988, Biotechniques6:742-751) or engage (referring to, for example, Koehler and Thorne, 1987, J.Bacteriol.169:5771-5278).Can realize DNA is incorporated into Bacillus coli cells by the following method: protoplast transformation (referring to, for example, Hanahan, 1983, J.Mol.Biol.166:557-580) or electroporation (referring to, for example, Dower etc., 1988, Nucleic Acids Res.16:6127-6145).Can realize by the following method DNA is incorporated into streptomyces cell: protoplast transformation, and electroporation (referring to, for example, Gong etc., 2004, Folia Microbiol. (Praha) 49:399-405), engage (referring to, for example, Mazodier etc., 1989, J.Bacteriol.171:3583-3585), or transduction (referring to, for example, Burke etc., 2001, Proc.Natl.Acad.Sci.USA98:6289-6294).Can realize by the following method DNA is incorporated into Rhodopseudomonas cell: electroporation (referring to, for example, Choi etc., 2006, J.Microbiol.Methods64:391-397) or engage (referring to, for example, Pinedo and Smets, 2005, Appl.Environ.Microbiol.71:51-57).Can realize by the following method DNA is incorporated into streptococcus cell: natural competence (natural competence) (referring to, for example, Perry and Kuramitsu, 1981, Infect.Immun.32:1295-1297), protoplast transformation (referring to, for example, Catt and Jollick, 1991, Microbios.68:189-207), electroporation (referring to, for example, Buckley etc., 1999, Appl.Environ.Microbiol.65:3800-3804) or engage (referring to, for example, Clewell, 1981, Microbiol.Rev.45:409-436).Yet, can use any method of DNA being introduced to host cell known in the art.
Host cell also can be eukaryote, as Mammals, insect, plant or fungal cell.
" fungi " is used in and comprises herein with Xiamen: Ascomycota (Ascomycota), Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota) and Zygomycota (Zygomycota) and oomycetes door (Oomycota) and all mitospore fungies (mitosporic fungi) are (as by Hawksworth etc., in Ainsworth and Bisby ' s Dictionary of The Fungi, the 8th edition, 1995, CAB International, University Press, Cambridge, defines in UK).
Fungal host cells can be yeast cell." yeast " is used in the yeast that comprises ascosporogenous yeast (ascosporogenous yeast) (Endomycetale (Endomycetales)), product load yeast (basidiosporogenous yeast) herein and belong to imperfect fungi (Fungi Imperfecti) (gemma guiding principle (Blastomycetes)).Owing to may changing in future that is sorted in of yeast, for the present invention, yeast is defined as to (the Skinner F.A. as Biology and Activities of Yeast, Passmore S.M. and Davenport R.R. compile, Soc.App.Bacteriol.Symposium Series No.9,1980) described in.
Yeast host cell can be mycocandida, Hansenula (Hansenula), genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or the mould genus cell of Western alpine yarrow, as Kluyveromyces lactis (Kluyveromyces lactis), saccharomyces carlsbergensis, yeast saccharomyces cerevisiae, saccharomyces diastaticus, Doug Laplace yeast, Crewe not yeast, promise ground yeast, ellipsoideus yeast or separate fat the West alpine yarrow mould (Yarrowia lipolytica) cell.
Fungal host cells can be filamentous fungal cells." filamentous fungus " comprise Mycophyta (Eumycota) and oomycetes door subphylum (as by Hawksworth etc., 1995, see above, define) all thread form.The common mycelia body wall being formed by chitin (chitin), Mierocrystalline cellulose, dextran, chitosan (chitosan), mannosans and other complicated polysaccharide that is characterised in that of filamentous fungus.By mycelia, extend into row and nourish and grow, and carbon katabolism is obligate aerobic.On the contrary, the yeast for example gemmation (budding) of nourishing and growing by unicellular thalline of yeast saccharomyces cerevisiae carries out, and carbon katabolism can ferment.
Filamentous fungal host cell can be a mould genus of top spore, Aspergillus, aureobasidium genus, the mould genus of smoke pipe (Bjerkandera), intend wax Pseudomonas, Chrysosporium, Coprinus (Coprinus), Coriolus Qu61 (Coriolus), genera cryptococcus, Filibasidium, fusarium, Humicola, Magnaporthe grisea belongs to, Mucor, myceliophthora, the mould genus of Xin Kaoma fat, Neurospora, paecilomyces, Penicillium, flat lead fungi belongs to (Phanerochaete), penetrate arteries and veins Pseudomonas (Phlebia), cud Chytridium, pleurotus (Pleurotus), Schizophyllum, Talaromyces, thermophilic ascomycete belongs to, Thielavia, Tolypocladium, trametes (Trametes) or Trichoderma cell.
For example, filamentous fungal host cell can be Aspergillus awamori, Aspergillus fumigatus, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger, aspergillus oryzae, black thorn smoke pipe bacterium (Bjerkandera adusta), dry plan wax bacterium (Ceriporiopsis aneirina), Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, worm is intended wax bacterium (Ceriporiopsis subvermispora), Chrysosporium inops, chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, felt gold pityrosporion ovale, Chrysosporium queenslandicum, chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus (Coprinus cinereus), hairy fungus (Coriolus hirsutus), bar spore shape sickle spore, F.graminearum schw, storehouse prestige sickle spore, machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, point sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intend branch spore sickle spore, sulphur look sickle spore, circle sickle spore, intend silk spore sickle spore, empiecement sickle spore, Humicola insolens, dredge cotton shape humicola lanuginosa, rice black wool is mould, thermophilic fungus destroyed wire, Neuraspora crassa, penicillium purpurogenum, the yellow flat lead fungi of spore (Phanerochaete chrysosporium), arteries and veins bacterium (Phlebia radiata) is penetrated in radiation, eryngo pick up the ears (Pleurotus eryngii), autochthonal shuttle spore shell, long wool hair bolt bacterium (Trametes villosa), variable color bolt bacterium (Trametes versicolor), trichoderma harziarum, healthy and free from worry wood is mould, long shoot wood is mould, Trichodermareesei or viride cell.
Fungal cell can be transformed in known mode own by relating to the method for protoplastis formation, protoplast transformation and cell walls regeneration.The appropriate method that is used for transforming Aspergillus and Trichoderma host cell is at EP238023 and Yelton etc., and 1984, Proc.Natl.Acad.Sci.USA81:1470-1474 and Christensen etc., describe in 1988, Bio/Technology6:1419-1422.For the appropriate method that transforms fusarium bacterial classification, by Malardier etc., 1989, Gene78:147-156 and WO96/00787 describe.Can use the method transformed yeast by following document description: Becker and Guarente, in Abelson, J.N. and Simon, M.I. compiles, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume194, pp182-187, Academic Press, Inc., New York; Ito etc., 1983, J.Bacteriol.153:163; With Hinnen etc., 1978, Proc.Natl.Acad.Sci.USA75:1920.
Production method
For example, for generation of polypeptide (cellulolytic enzyme, the polypeptide with catalase activity, the polypeptide with cellulolytic enhancing activity) etc. method, comprises that (a) contributing to produce culturing cell under the condition of polypeptide, and described cell produces described polypeptide with its wild-type form; (b) reclaim described polypeptide.One preferred aspect, described cell is Aspergillus, thermophilic ascomycete genus, Talaromyces, Trichoderma, Humicola or Penicillium cell.One preferred aspect, described cell is aspergillus niger, aspergillus oryzae, Aspergillus fumigatus, tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Trichodermareesei, Humicola insolens or Penicillium emersonii cell.
For example, or for generation of polypeptide, cellulolytic enzyme, has the polypeptide of catalase activity, there is the method for the polypeptide etc. of cellulolytic enhancing activity, comprise that (a) cultivates recombinant host cell contributing to produce under the condition of polypeptide; (b) reclaim described polypeptide.
Described host cell cell is used methods known in the art to cultivate in being suitable for producing the nutritional medium of described polypeptide.For example; can be by suitable culture medium and allow the shake-flask culture under the condition of expression and/or separated described polypeptide, or the small-scale in laboratory or industrial fermentation tank or large scale fermentation (comprise continuously, in batches, fed-batch or solid state fermentation) carry out culturing cell.Use methods known in the art to cultivate in suitable nutritional medium, described nutritional medium comprises Carbon and nitrogen sources and inorganic salt.Suitable medium can obtain or can prepare (for example,, in the catalogue of American type culture collection) according to disclosed composition from commercial supplier.If polypeptide is secreted in nutritional medium, this polypeptide directly can be reclaimed from described substratum.If polypeptide is not secreted, it can be reclaimed from cell lysate (lysate).
Can with known in the art for described polypeptide, be that specific method detects polypeptide.These detection methods include but not limited to use, the formation of enzyme product or the disappearance of enzyme substrates of specific antibody.For example, enzyme assay (enzyme assay) can be used for determining the activity of polypeptide.The polypeptide with cellulolytic enhancing activity is used described method to detect herein.
Polypeptide can be used methods known in the art to reclaim.For example, polypeptide can reclaim by ordinary method from nutritional medium, described ordinary method includes but not limited to collect, centrifugal, filter, extract, spraying is dry, evaporation or precipitation.In one aspect, reclaim whole beer.
Polypeptide can be by multiple methods known in the art purifying to obtain substantially pure polypeptide, described method includes but not limited to that chromatography (for example, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis method (for example, preparative (preparative) isoelectrofocusing), differential solubleness (for example, ammonium sulfate precipitation), SDS-PAGE or extraction (referring to, for example, Protein Purification, Janson and Ryden compile, VCH Publishers, New York, 1989).
In yet another aspect, do not reclaim polypeptide, but use, express the host cell of described polypeptide as the source of described polypeptide.
The present invention is further described by following embodiment, and it should not be considered as limitation of the scope of the invention.
Embodiment
Bacterial strain
From fungi strain preservation center, (Centraalbureau voor Schimmelcultures) obtains fungal bacterial strain NN70, its called after CBS375.48.Based on morphological feature and ITS rDNA sequence the two, bacterial strain NN70 is accredited as Talaromyces stipitatus.
Fungal bacterial strain NN38 uses PDA substratum 45 ℃ separation from Chinese pedotheque by dilution-plate method from collecting.Then by it by a single conidium is transferred to purifying on YG agar plate.Based on morphological feature and ITS rDNA sequence the two, bacterial strain NN38 is accredited as Humicola insolens.
Fungal bacterial strain NN051602 uses PDA substratum 45 ℃ separation from Chinese pedotheque by dilution-plate method from collecting.Then by it by a single conidium is transferred to purifying on YG agar plate.Based on morphological feature and ITS rDNA sequence the two, bacterial strain NN051602 is accredited as Penicillium emersonii.
Substratum
PDA substratum adds to 1 liter by 39 grams of potato dextrose agars and deionized water and forms.
YG agar plate is by the yeast extract of 5.0g, the glucose of 10.0g, and the agar of 20.0g, and deionized water adds to 1 liter of formation.
YPM substratum contains 1% yeast extract in deionized water, 2% peptone, and 2% maltose.
The yeast extract that YPG substratum contains 0.4% in deionized water, 0.1% KH 2pO 4, 0.05% MgSO 47H 2o, 1.5% glucose.
Minimum medium flat board is by the sucrose of 342g, the salts solution of 20ml, and the agar of 20g, and deionized water adds to 1 liter of formation, described salts solution is by 2.6%KCl, 2.6%MgSO 47H 2o, 7.6%KH 2pO 4, 2ppm Na 2b 4o 710H 2o, 20ppm CuSO 45H 2o, 40ppm FeSO 47H 2o, 40ppm MnSO 42H 2o, 40ppm Na 2moO 42H 2o, and 400ppm ZnSO 47H 2o forms.
Embodiment 1: tangerine orange thermophilic ascomycete catalase or the booster action of Talaromyces stipitatus catalase to the hydrolysis of pretreated maize straw (PCS)
Catalase (as being shown in SEQ ID NO:2) from tangerine orange thermophilic ascomycete is expressed by aspergillus niger, and described in Japanese publication number 2004261137A purifying.By the catalase from Talaromyces stipitatus (as being shown in SEQ ID NO:4) as embodiment 9-13 clone, expression and purifying.By maize straw in USDOE renewable energy source laboratory (U.S.Department of Energy National Renewable Energy Laboratory (NREL)) use dilute sulphuric acid in pretreatment reaction device at 190 ℃, 1 minute retention time, 0.05g acid/g dry biomass, and pre-treatment under the condition of 30% total solid concentration.
PCS is with the condition hydrolysis of the hydrolysis system gross weight of 10% initial total solids (TS) and 20g.By trichoderma reesei cellulase composition (
Figure BDA0000421832260000611
cTec2, can be from Novozymes A/S, and Bagsvaerd, Denmark obtains) be added into PCS and carry out enzymic hydrolysis, wherein trichoderma reesei cellulase composition is 0.5% (w/w) to cellulosic ratio, based on protein content, is 5mg/g Mierocrystalline cellulose.Dosage shown in tangerine orange thermophilic ascomycete catalase or Talaromyces stipitatus catalase following table 1 is added into hydrolysis system.Do not add catalatic hydrolysis system with comparing.By flask, at 50 ℃, under 130rpm vibration, incubation is 72 hours.Unless otherwise specified, total hydrolysis time is 72 hours.After hydrolysis completes, sugar is analyzed by high performance liquid chromatography (HPLC).
For HPLC, measure, use 0.22 μ m syringe filter (Millipore, Bedford, MA, USA) to filter in the sample of collection, and the sugared content of analysis permeate as described below.Be diluted in 0.005M H 2sO 4in the sugared concentration of sample use 7.8 * 300mm
Figure BDA0000421832260000612
hPX-87H post (Bio-Rad Laboratories, Inc., Hercules, CA, USA) is measured, and uses 0.005M H 2sO 4at 65 ℃ of flow velocity wash-outs with 0.7ml per minute, and by refractive index detect (
Figure BDA0000421832260000613
1100HPLC, Agilent Technologies, Santa Clara, CA, USA) glucose signals integration gained, that calibrate through pure sugared sample is quantitatively.The glucose of use gained is the per-cent from the glucose yield of dextran for each Response calculation.The sugared concentration recording is adjusted according to suitable dilution factor.The sugared concentration recording, for adjusting in zero time point corresponding background sugar concentration in the biomass without washing, is determined to the sugared net concentration that enzyme produces.All HPLC data processing are used MICROSOFT EXCEL tMsoftware (Microsoft, Richland, WA, USA) carries out.
Conversion of glucose be the degree of glucose according to Zhu, Y. etc. 2010, the disclosing of Bioresource Technology.102 (3): 2897-2903 calculated.
The result that is shown in table 1 shows, by adding a small amount of catalase, can significantly improve PCS to the conversion of glucose.
Table 1: from the catalase of tangerine orange thermophilic ascomycete or the effect to the conversion of glucose of PCS from the catalase of T.stipitatus
Figure BDA0000421832260000621
Embodiment 2:Talaromyces stipitatus catalase is for the booster action of the single component of cellulase
Will
Figure BDA0000421832260000622
pH-101 (Fluka11365, Sigma-Aldrich (Shanghai), Chinese Shanghai), a kind of Microcrystalline Cellulose, is hydrolyzed with the cumulative volume of the final concentration of 5g/l and the hydrolysis system of 0.5ml.PH is adjusted and maintains 5.0 by 50mM sodium acetate.In addition, xitix is present in hydrolysis system with the final concentration of 0.5mM, or is not present in hydrolysis system.Manganous sulfate (II) is present in hydrolysis system with the final concentration of 1mM.
Clone, express and purifying from cellobiohydrolase (CBH) I (WO2011/057140) of Aspergillus fumigatus, from cellobiohydrolase (CBH) II (WO2011/057140) of Aspergillus fumigatus, from endoglucanase (EG) I (WO2011/057140) of Trichodermareesei and from the beta-glucanase (BG) of aspergillus oryzae (WO02/095014).These single components are applied to separately
Figure BDA0000421832260000623
hydrolysis.Use 10mg monocomponent fibre element enzyme/g
Figure BDA0000421832260000625
with 5mg catalase/g
Figure BDA0000421832260000624
by test tube at 50 ℃ of incubations 72 hours under 600rpm vibration.All experiments are carried out the same form three times.
The HPLC of hydrolysis degree is analyzed and carried out according to the step described in embodiment 1.
The degree of cellulose conversion is recently calculated the quality of the initial mass of insoluble fibrin based on liquefiable glycosyl units.For soluble sugar, only measured glucose and cellobiose, because be longer than the cellodextrin of cellobiose, only with insignificant concentration, had (due to enzymic hydrolysis).The degree that total fiber element transforms is used following formula to calculate:
Figure BDA0000421832260000631
(formula 1)
The factor of glucose and cellobiose is respectively 1.111 and 1.053, the increase of quality when this has considered that glycosyl units (molecular-weight average is 162 dalton) in Mierocrystalline cellulose is converted into glucose (molecular weight is 180 dalton) or cellobiose glycosyl units (molecular-weight average is 171 dalton).
Table 2: the effect from the catalase of T.stipitatus to the conversion of glucose of Avicel.
Figure BDA0000421832260000632
As shown in table 2, under xitix exists, the hydrolysis of the cellulase of every kind of single component all can be strengthened by T.stipitatus catalase.
Embodiment 3: the booster action of Humicola insolens catalase to the hydrolysis of PCS
The preparation of PCS and the setting of hydrolysis system are identical with embodiment 1.Catalase clone, expression and purifying as shown in embodiment 14-20 from Humicola insolens.
Condition hydrolysis by PCS with 10% initial TS and hydrolysis system gross weight 20g.Use trichoderma reesei cellulase composition (can be from Novozymes A/S, Bagsvaerd, Denmark obtains cTec2) carry out enzymic hydrolysis.5 percent Ctec2 is by weight substituted with Humicola insolens catalase based on protein content, and total enzyme dosage is 4mg/g Mierocrystalline cellulose.Use containing 4mg trichoderma reesei cellulase composition/g Mierocrystalline cellulose but do not contain catalatic hydrolysis system not in contrast.By flask, at 50 ℃, under 130rpm vibration, incubation is 72 hours.Total hydrolysis time is 72 hours.
The calculating of conversion of glucose is identical with embodiment 1, and booster action is shown in table 3.
Table 3: the effect from the catalase of Humicola insolens to the conversion of glucose of PCS
? Contrast Humicola insolens catalase
Conversion of glucose (%) 50.4±1.1 58.4±0.9
Embodiment 4: the booster action of Humicola insolens catalase to the hydrolysis of PCS
The preparation of PCS and the setting of hydrolysis system are identical with embodiment 1.Catalase clone, expression and purifying as shown in embodiment 14-20 from Humicola insolens.
Condition hydrolysis by PCS with 10% initial TS and hydrolysis system gross weight 20g.Use trichoderma reesei cellulase composition (can be from Novozymes A/S, Bagsvaerd, Denmark obtains
Figure BDA0000421832260000643
cTec3) carry out enzymic hydrolysis.5 percent Ctec3 is by weight substituted with Humicola insolens catalase based on protein content, and total enzyme dosage is 4mg/g Mierocrystalline cellulose.Use containing 4mg trichoderma reesei cellulase composition/g Mierocrystalline cellulose but do not contain catalatic hydrolysis system not in contrast.By flask, at 50 ℃, under 130rpm vibration, incubation is 72 hours.Total hydrolysis time is 72 hours.
The calculating of conversion of glucose is identical with embodiment 1, and booster action is shown in table 4.
Table 4: the effect from the catalase of Humicola insolens to the conversion of glucose of PCS
? Contrast Humicola insolens catalase
Conversion of glucose (%) 70.9±1.4 80.1±1.2
Embodiment 5: tangerine orange thermophilic ascomycete catalase and the synergy of tangerine orange thermophilic ascomycete GH61A to the hydrolysis of PCS
PCS is according to the step preparation described in embodiment 1, and with 10% initial TS and the condition hydrolysis of hydrolysis system gross weight 20g.Use 10M sodium hydroxide to be adjusted to 5.0 pH.By trichoderma reesei cellulase composition (under the Aspergillus fumigatus beta-glucosidase enzyme (WO2005/047499) of 10% total protein weight exists
Figure BDA0000421832260000641
can be from Novozymes A/S, Bagsvaerd, Denmark obtains) be added into PCS and carry out enzymic hydrolysis, wherein trichoderma reesei cellulase composition is 0.8% (w/w) to cellulosic ratio.By the catalase from tangerine orange thermophilic ascomycete, from the GH61A polypeptide (WO2005/074656) of tangerine orange thermophilic ascomycete, or its combination is added into respectively hydrolysis system.The dosage of catalase, GH61A polypeptide or its combination calculates based on cellulosic weight.The hydrolysis system that contains trichoderma reesei cellulase composition but do not contain catalase and GH61 is with comparing.By flask, at 50 ℃, under 130rpm vibration, incubation is 72 hours.All experiments are carried out the same form three times.The HPLC of hydrolysis degree is analyzed and carried out according to the step described in embodiment 1.After hydrolysis in 72 hours, PCS is shown in following table 5 to the conversion of glucose.
Table 5: tangerine orange thermophilic ascomycete catalase and the synergy of tangerine orange thermophilic ascomycete GH61A to the hydrolysis of PCS
As shown in table 5, only catalase or only GH61A polypeptide all strengthen the hydrolysis of PCS.Make us unexpectedly finding, when catalase and GH61A polypeptide are used simultaneously, hydrolysis significantly improves.These results show that catalase and GH61A polypeptide have significant synergy to the hydrolysis of PCS.
The booster action of embodiment 6:Penicillium emersonii catalase to PCS hydrolysis
The preparation of PCS and the setting of hydrolysis system are identical with embodiment 1.Catalase from P.emersonii has been carried out to clone, expression and purifying as shown in embodiment 21-27.
Condition hydrolysis by PCS with 10% initial TS and hydrolysis system gross weight 20g.By trichoderma reesei cellulase composition (can be from Novozymes A/S, Bagsvaerd, Denmark obtains
Figure BDA0000421832260000652
cTec2) be added into PCS and carry out enzymic hydrolysis.5 percent Ctec2 is by weight substituted with P.emersonii catalase based on protein content, and total enzyme dosage is 4mg/g Mierocrystalline cellulose.Use containing trichoderma reesei cellulase composition but do not contain catalatic hydrolysis system not in contrast.By flask incubation 72 hours under 50 ℃, 130rpm vibration.
The calculating of conversion of glucose is identical with embodiment 1, and booster action is shown in table 6.
Table 6: the effect from the catalase of P.emersonii to the conversion of glucose of PCS
? Contrast P.emersonii catalase
Conversion of glucose (%) 48.6±0.7 54.3±0.8
Embodiment 7: the booster action of tangerine orange thermophilic ascomycete catalase to the hydrolysis of PCS under relatively high TS
The preparation of PCS and the setting of hydrolysis system are identical with embodiment 1.Gross weight hydrolysis by PCS with the hydrolysis system of 20% initial TS and 20g.By trichoderma reesei cellulase composition (can be from Novozymes A/S, Bagsvaerd, Denmark obtains
Figure BDA0000421832260000651
cTec2) be added into PCS and carry out enzymic hydrolysis.5 percent Ctec2 is by weight substituted with tangerine orange thermophilic ascomycete catalase based on protein content, and total enzyme dosage is 7mg/g Mierocrystalline cellulose.Use containing trichoderma reesei cellulase composition but do not contain catalatic hydrolysis system not in contrast.By flask, at 50 ℃, under 130rpm vibration, incubation is 72 hours.The calculating of conversion of glucose is identical with embodiment 1, and booster action is shown in table 7.
Table 7: the effect from the catalase of tangerine orange thermophilic ascomycete to the conversion of glucose of PCS
? Contrast 5% tangerine orange thermophilic ascomycete catalase substitutes
Conversion of glucose (%) 58.6±1.4 64.8±0.8
Embodiment 8: the booster action of tangerine orange thermophilic ascomycete catalase to the hydrolysis of PCS under relatively high TS
The preparation of PCS and the setting of hydrolysis system are identical with embodiment 1.Gross weight hydrolysis by PCS with the hydrolysis system of 20% initial TS and 20g.Use trichoderma reesei cellulase composition (can be from Novozymes A/S, Bagsvaerd, Denmark obtains
Figure BDA0000421832260000661
cTec3) carry out enzymic hydrolysis.5 percent Ctec3 is by weight substituted with tangerine orange thermophilic ascomycete catalase based on protein content, and total enzyme dosage is 6mg/g Mierocrystalline cellulose.Use containing trichoderma reesei cellulase composition but do not contain catalatic hydrolysis system not in contrast.By flask incubation 72 hours under 50 ℃, 130rpm vibration.
The calculating of conversion of glucose is identical with embodiment 1, and catalatic booster action is shown in table 8.
Table 8: the effect from the catalase of tangerine orange thermophilic ascomycete to the conversion of glucose of PCS
? Contrast 5% tangerine orange thermophilic ascomycete catalase substitutes
Conversion of glucose (%) 72.0± 80.5±0.8
Embodiment 9:Talaromyces stipitatus extracting genome DNA
Talaromyces stipitatus bacterial strain NN70 is grown 3 at 45 ℃ at PDA agar plate.Mycelium is directly collected under cooled with liquid nitrogen to pestle and the mortar through sterilizing from agar plate.The mycelium freezing is milled to fine-powder with pestle and mortar, and uses
Figure BDA0000421832260000662
the little extraction reagent kit of plant (Plant Mini Kit) (QIAGEN Inc., Valencia, CA, USA) isolation of genomic DNA.
Embodiment 10: from genomic dna cloning Talaromyces stipitatus catalase gene
Based on European Molecular Bioglogy Laboratory (European Molecular Biology Laboratory (EMBL)): the DNA information of EQ962660 (being SEQ ID NO:3) and protein sequence SWISSPROT:B8MT74 (being SEQ ID NO:4), designed the Oligonucleolide primers that time shows with the genomic dna amplification catalase gene from Talaromyces stipitatus NN70.Primer is manufactured by Invitrogen (Invitrogen, BeiJing, China).
Forward primer: 5 ' ACACAACTGGGGATCC ACC atgcgaggggcatactctctc3 ' (SEQ ID NO:38)
Reverse primer: 5 ' GTCACCCTCTAGATCT aacaagttactcgtgttaatcgtggaa3 ' (SEQ ID NO:39)
Lowercase represents the sequence of gene, and the insertion point homology of capitalization part and the pPFJO355 carrier described in US2010306879.
Expression vector pPFJO355 contains TAKA-amylase promotor and the aspergillus niger glucoamylase terminator element that derives from aspergillus oryzae.In addition pPFJO355 has for selecting intestinal bacteria and the sequence in the pUC18 source of breeding, and pyrG gene, and its coding derives from the orotidine decarboxylase of Aspergillus nidulans, for selecting the transformant of pyrG mutant Aspergillus bacterial strain.
The primer pair of 20 picomole (forward and reverse) is reacted for PCR, described reaction is by the Talaromyces stipitatus NN70 genomic dna of 2 μ l, the 5X GC damping fluid of 10 μ l, the DMSO of 1.5 μ l, the PHUSION of the dATP of each 2.5mM, dTTP, dGTP and dCTP ，He 0.6 unit tMhigh-fidelity DNA polymerase (Finnzymes Oy, Espoo, Finland) forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler (MJ Research Inc., South San Francisco, CA, USA) to carry out, and its programming was as follows: 98 ℃ of sex change 40 seconds; 8 circulations, often circulate in 98 ℃ of sex change 15 seconds, and 70 ℃ of annealing 30 seconds, each circulation reduced 1 ℃, and extends 80 seconds at 72 ℃; With other 23 circulations, each circulates in 98 ℃ carries out 15 seconds, and 62 ℃ are carried out 30 seconds, and 72 ℃ are carried out 80 seconds; 72 ℃ of final extensions 5 minutes.Then heat block enters 4 ℃ of infusion.
PCR reaction product, by using 90mM Tris boric acid separated with 1.0% agarose gel electrophoresis of 1mM EDTA (TBE) damping fluid, has wherein shown the single product band of expection size (approximately 2.4kb) under UV light, then uses ILLUSTRA tMgFX tMpCR DNA and gel strip zone purification test kit (GE Healthcare, Buckinghamshire, UK) according to manufacturer's indication from solution purification.
By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA tMgFX tMpCR DNA and gel strip zone purification test kit are according to manufacturer's indication purifying.
Use IN-FUSION tMcF dry type clone test kit (Dry-down Cloning kit) (Clontech Laboratories, Inc., Mountain View, CA, USA) by described fragment, without carrying out restrictive diges-tion and connection, Direct Cloning enters expression vector pPFJO355.
The carrier of PCR reaction product and digestion is used to IN-FUSION tMcF dry type PCR clone (Dry-down PCR Cloning) links together, and obtains plasmid pTs, and wherein Talaromyces stipitatus catalase gene transcribes under the regulation and control in the promotor from aspergillus oryzae alpha-amylase gene.Clone operations is carried out according to manufacturer's indication.In brief, the pPFJO355 by 30ng through Bam HI and Bgl II digestion, and the Talaromyces stipitatus catalase PCR reaction products addition of the purifying of 60ng is to reacting bottle, and add deionized water and powder is resuspended in to the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction product of 3 μ l to transform intestinal bacteria TOP10 competent cells (TIANGEN Biotech (Beijing) Co.Ltd., BeiJing, China).By bacterium colony PCR, detect the intestinal bacteria transformant that contains expression construct, this is a kind of from the intestinal bacteria bacterium colony method that directly screening plasmid inserts rapidly.In brief, in each PCR test tube, the PCR solution aliquots containig of premix (comprises PCR damping fluid, MgCl 2, dNTP, and the primer pair generating for PCR fragment) in, by the liquid-transfering sucker tip picking with sterilizing and described liquid-transfering sucker point fast rotational (twirl) in reaction soln is added to single bacterium colony.Conventionally filter out 7 to 10 bacterium colonies.After PCR program, on sepharose, check reaction product.The bacterium colony that provides the big or small amplification of expection may contain correct insertion.Plasmid DNA is used the centrifugal little extraction reagent kit of QIAprep (Spin Miniprep Kit) (QIAGEN Inc., Valencia, CA, USA) preparation.The Talaromyces stipitatus catalase gene inserting in plasmid pTs is by being used the DNA sequencing of 3730XL DNA analysis instrument (Applied Biosystems Inc, Foster City, CA, USA) to confirm.
Embodiment 11: the expression of Talaromyces stipitatus catalase gene in aspergillus oryzae
Aspergillus oryzae HowB101 (being described in patent WO9535385 embodiment 1) protoplastis is according to Christensen etc., the method preparation of 1988, Bio/Technology6:1419-1422.Use the plasmid pTs of 3 μ g to transform aspergillus oryzae HowB101.
With plasmid pTs, transform aspergillus oryzae HowB101, each conversion produces approximately 50 transformant.Eight transformant are separated to single minimum medium dull and stereotyped.
To from four transformant of each conversion, inoculate respectively 3ml YPM in 24 orifice plates and at 30 ℃, 150rpm incubation.After incubation on the 3rd, by 20 μ l from the supernatant of each culture at NuPAGE Novex4-12%Bis-Tris gel (the Invitrogen Corporation containing (2-N-morpholino) ethyl sulfonic acid (MES), Carlsbad, CA, USA) above according to manufacturer's indication, analyze.By the gel of gained INSTANT BLUE tM(Expedeon Ltd., Babraham Cambridge, UK) dyeing.The SDS-PAGE general picture of culture shows the expression that detects protein band.The size of the main band of gene is about 92KD.Expression strain called after EXP84.
Embodiment 12: the fermentation of expression strain EXP84
The inclined-plane of an expression strain EXP84 is washed with the YPM of 10ml and inoculate 2 liters of flasks into eight YPM substratum that contain 400ml to generate the nutrient solution for the identification of enzyme.At results culture on the 3rd, and use 0.45 μ m DURAPORE film (Millipore, Bedford, MA, USA) to filter.
Embodiment 13: from aspergillus oryzae EXP84 purification of Recombinant Talaromyces stipitatus catalase
The ammonium sulfate for supernatant (80% is saturated) of 3200ml recombinant bacterial strain EXP84 is precipitated and be resuspended in 50ml20mM Tris-HCl damping fluid, pH7.5, then for identical damping fluid dialysis, and filters by 0.45mm strainer, and final volume is 100ml.Solution is imposed on to the 40ml Q of balance in 20mM Tris-HCl pH of buffer 7.5
Figure BDA0000421832260000691
fast Flow post (GE Healthcare, Buckinghamshire, UK).Collect the fraction with 0.08-0.2M NaCl wash-out, and further at 40ml Q
Figure BDA0000421832260000692
fast Flow post (GE Healthcare, Buckinghamshire, UK) is upper with LINEAR N aCl gradient (0.14 – 0.2M) purifying.Fraction is by SDS-PAGE (NP0336BOX, NUPAGE4-12%BT GEL1.5MM15W) assessment.The fraction of collecting the band that contains about 92kDa.Then the solution collecting is passed through to ultrafiltration and concentration.
Embodiment 14: Humicola insolens extracting genome DNA
Humicola insolens bacterial strain NN38 is inoculated on PDA flat board, and 45 ℃ of lucifuge incubations 3 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of 100ml YPG substratum.By flask at 45 ℃ of incubations 3 days under 160rpm vibration.Mycelium by via
Figure BDA0000421832260000693
the filtration of (Calbiochem, La Jolla, CA, USA) is collected, and is frozen in liquid nitrogen.The mycelium freezing is ground as fine powder by pestle and mortar, and genomic dna is used
Figure BDA0000421832260000694
the large extraction reagent kit of plant (Plant Maxi Kit) (QIAGEN Inc., Valencia, CA, USA) is separated according to manufacturer's indication.
Embodiment 15: gene order-checking, assembling and the annotation of Humicola insolens bacterial strain NN38
The genome DNA sample of extraction is delivered to Beijing Genome Institute (BGI, China Shenzhen) for use
Figure BDA0000421832260000695
the gene order-checking of GA2 system (Illumina, Inc., San Diego, CA, USA).At BGI by original reading (raw read) service routine SOAPdenovo (Li etc., 2010, Genome Research20 (2): 265-72) assemble.Use the information biology means of searching (gene finding) and function prediction for gene of standard to analyze the sequence after assembling.In brief, use geneID (Parra etc., 2000, Genome Research10 (4): 511-515) carry out predictive genes.Use Blastall version2.2.10 ((Altschul etc., 1990, J.Mol.Biol.215 (3): 403 – 410; National Center for Biotechnology Information (NCBI), Bethesda, MD, USA) and HMMER version2.1.1 (National Center for Biotechnology Information (NCBI), Bethesda, MD, USA) based on structural homology forecast function.By the analysis Direct Identification to Blast result, go out catalase gene (being SEQ ID NO:5 for DNA sequence dna, is SEQ ID NO:6 for protein sequence).Use Agene program (Munch and Krogh, 2006, BMC Bioinformatics7:263) and SignalP program (Nielsen etc., 1997, Protein Engineering10:1-6) to identify initiator codon.Also use SignalP predicted signal peptide.Use iso-electric point and the molecular weight of Pepstats (European Bioinformatics Institute, Hinxton, Cambridge CB101SD, UK) predicted protein.
Embodiment 16: from genomic dna cloning Humicola insolens catalase
Based on the catalatic DNA information of Humicola insolens, designed the Oligonucleolide primers that time shows with the genomic dna amplification catalase gene from Humicola insolens NN38.Primer is manufactured by Invitrogen (Invitrogen, BeiJing, China).
Forward primer: 5 ' ACACAACTGGGGATCC ACC atgaacagagtcacgaatctcctcg3 ' (SEQ ID NO:40)
Reverse primer: 5 ' GTCACCCTCTAGATCT ggtacaactcccaccctattccttctc3 ' (SEQ ID NO:41)
Lowercase represents gene order in forward primer, represents the flanking region of 3 ' end of gene in reverse primer, and the insertion point homology of capitalization part and the pPFJO355 carrier described in US2010306879.
Expression vector pPFJO355 contains TAKA-amylase promotor and the aspergillus niger glucoamylase terminator element that derives from aspergillus oryzae.In addition pPFJO355 has for selecting intestinal bacteria and the sequence in the pUC18 source of breeding, and pyrG gene, and its coding derives from the orotidine decarboxylase of Aspergillus nidulans, for selecting the transformant of pyrG mutant Aspergillus bacterial strain.
The primer pair of 20 picomole (forward and reverse) is reacted for PCR, described reaction is by the Humicola insolens NN38 genomic dna of 2 μ l, the 5X GC damping fluid of 10 μ l, the DMSO of 1.5 μ l, the PHUSION of the dATP of each 2.5mM, dTTP, dGTP and dCTP ，He 0.6 unit tMhigh-fidelity DNA polymerase (Finnzymes Oy, Espoo, Finland) forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler (MJ Research Inc., South San Francisco, CA, USA) to carry out, and its programming was as follows: 98 ℃ of sex change 1 minute; 6 circulations, each circulates in 98 ℃ of sex change 15 seconds, and 63 ℃ of annealing 30 seconds, each circulation reduced by 1 ℃, and extends 3 minutes at 72 ℃; And other 22 circulations, each circulates in 98 ℃ carries out 15 seconds, and 62 ℃ are carried out 30 seconds, and 72 ℃ are carried out 3 minutes; 72 ℃ of final extensions 7 minutes.Then heat block enters 4 ℃ of infusion.
PCR reaction product is by being used 90mM Tris boric acid separated with 1.0% agarose gel electrophoresis of 1mM EDTA (TBE) damping fluid, the single product band that has wherein manifested expection size (approximately 3.1kb) under UV light, is then used ILLUSTRA tMgFX tMpcr dna and gel strip zone purification test kit (GE Healthcare, Buckinghamshire, UK) according to manufacturer's indication from solution purification.
By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA tMgFX tMpcr dna and gel strip zone purification test kit are according to manufacturer's indication purifying.
Use IN-FUSION tMcF dry type clone's test kit (Clontech Laboratories, Inc., Mountain View, CA, USA) enters expression vector pPFJO355 by described fragment Direct Cloning, and without carrying out restrictive diges-tion and connection.
The carrier of PCR reaction product and digestion is used to IN-FUSION tMcF dry type PCR clone (Dry-down PCR Cloning) links together and obtains plasmid pHi, and in this plasmid, Humicola insolens catalase gene transcribes under the regulation and control in the promotor from aspergillus oryzae alpha-amylase gene.Clone operations is carried out according to manufacturer's indication.In brief, the pPFJO355 by 30ng through Bam HI and Bgl II digestion, and the Humicola insolens catalase PCR reaction products addition of the purifying of 60ng is to reacting bottle, and add deionized water and powder is resuspended in to the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction product of 3 μ l to transform intestinal bacteria TOP10 competent cells (TIANGEN Biotech (Beijing) Co.Ltd., BeiJing, China).By bacterium colony PCR, detected and contained the intestinal bacteria transformant of reporting construct, bacterium colony PCR is a kind of from the intestinal bacteria bacterium colony method that directly screening plasmid inserts rapidly.In brief, in each PCR test tube, the PCR solution aliquots containig of premix (comprises PCR damping fluid, MgCl 2, dNTP, and the primer pair generating for PCR fragment) in, by the liquid-transfering sucker point picking with sterilizing, also this liquid-transfering sucker point fast rotational (twirl) in reaction soln is added to single bacterium colony.Conventionally filter out 7 to 10 bacterium colonies.After PCR program, on sepharose, check reaction product.The bacterium colony that provides the big or small amplification of expection may contain correct insertion.Plasmid DNA is used the centrifugal little extraction reagent kit of QIAprep (Spin Miniprep Kit) (QIAGEN Inc., Valencia, CA, USA) preparation.The Humicola insolens catalase gene inserting in plasmid pHi is by being used the DNA sequencing of 3730XL DNA analysis instrument (Applied Biosystems Inc, Foster City, CA, USA) to obtain confirmation.
Embodiment 17: in aspergillus oryzae, express Humicola insolens catalase gene
Aspergillus oryzae HowB101 (being described in patent WO9535385 embodiment 1) protoplastis is according to Christensen etc., the method preparation of 1988, Bio/Technology6:1419-1422.Use the plasmid pHi of 3 μ g to transform aspergillus oryzae HowB101.
With plasmid pHi, transform aspergillus oryzae HowB101 and transform approximately 50 transformant of generation at every turn.Eight transformant are separated to each other minimum medium dull and stereotyped.
Four transformant from each conversion are inoculated respectively in the 3ml YPM in 24 orifice plates, and at 30 ℃, 150rpm incubation.After incubation on the 3rd, the 20 μ l of the supernatant from each culture are above analyzed according to manufacturer's indication at the NuPAGE Novex4-12%Bis-Tris gel (Invitrogen Corporation, Carlsbad, CA, USA) containing MES.By the gel of gained INSTANT BLUE tM(Expedeon Ltd., Babraham Cambridge, UK) dyeing.The SDS-PAGE general picture of culture shows the expression that detects protein band.The size of the main band of gene is about 80KD.Expression strain called after O5.
Embodiment 18: the fermentation of expression strain O5
YPM washing by the inclined-plane of an expression strain O5 with 10ml, and inoculate in 2 liters of flasks of 12 YPM substratum that contain 400ml, to generate the nutrient solution for the identification of enzyme.At results culture on the 3rd, and use 0.45 μ mDURAPORE film (Millipore, Bedford, MA, USA) to filter.
Embodiment 19: from aspergillus oryzae O5 purification of Recombinant Humicola insolens catalase
By the recombinant bacterial strain O5 of 4000ml for supernatant ammonium sulfate (80% is saturated) precipitate and be resuspended in 50ml20mM Tris-HCl damping fluid, pH6.0, then for the dialysis of identical damping fluid, and filters by 0.45mm strainer, final volume is 140ml.Solution is imposed on to the damping fluid at 20mM Bris-Tris, the 40ml Q of balance in pH6.0
Figure BDA0000421832260000722
fast Flow post (GE Healthcare, Buckinghamshire, UK), and with LINEAR N aCl gradient (0 – 0.25M) eluted protein.Collect the fraction with 0.2-0.5M NaCl wash-out, and the further 40ml Q in being equilibrated at 20mM Bis-Tris pH of buffer 6.0
Figure BDA0000421832260000721
the upper purifying of Fast Flow post (GE Healthcare, Buckinghamshire, UK), and with LINEAR N aCl gradient (0.2 – 0.5M) eluted protein.Fraction is by SDS-PAGE (NP0336BOX, NUPAGE4-12%BTGEL1.5MM15W) assessment.The fraction of collecting the band that contains about 80kDa.Then the solution collecting is passed through to ultrafiltration and concentration.
The catalatic mature polypeptide of Humicola insolens and grey humicola lanuginosa heat tolerance hydrogen peroxide zymoprotein (WO2009104622-A1) have 99.25% identity.
Embodiment 20: catalase activity is measured
Use following experimental program to check catalase activity to the Humicola insolens catalase of purifying.
By 30%H 2o 2(from Xilong Chemical, Chinese Guangdong) uses distilled water (ddH 2o) dilute 1000 times and prepare substrate, ultimate density is 10.3mM.By being added into 1000 μ l substrates, the Humicola insolens catalase sample of the purifying of 1 μ l carrys out initial action.With Ultrospec3300 (GE Healthcare, Buckinghamshire, UK), read respectively at 0 and 16 second the optical density(OD) (OD) of 240nm, the minimizing of OD (from 0.400 to 0.102) shows the catalatic relative reactivity of Humicola insolens.
Embodiment 21:Penicillium emersonii extracting genome DNA
Penicillium emersonii bacterial strain NN051602 is inoculated on PDA flat board, and 45 ℃ of lucifuge incubations 3 days.Several mycelium-PDA bolt kinds are entered to contain in the 500ml shaking flask of YPG substratum of 100ml.By flask at 45 ℃ of incubations 3 days under 160rpm vibration.By
Figure BDA0000421832260000731
(Calbiochem, La Jolla, CA, USA) filters and collects mycelium, and freezing in liquid nitrogen.Freezing mycelium is milled to fine powder with pestle and mortar, and use the large extraction reagent kit-pillar of fungal genomic DNA (Large-Scale Column Fungal DNAout) (Baoman Biotechnology, Chinese Shanghai) according to manufacturer's indication isolation of genomic DNA.
Embodiment 22: gene order-checking, assembling and annotation
The genome DNA sample of extraction is delivered to Beijing Genome Institute (BGI, China Shenzhen) for use
Figure BDA0000421832260000732
the gene order-checking of GA2 system (Illumina, Inc., San Diego, CA, USA).At BGI by original reading (raw read) service routine SOAPdenovo (Li etc., 2010, Genome Research20 (2): 265-72) assemble.Use the confession gene identification of standard and the information biology means of function prediction to analyze the sequence of assembling.In brief, use geneID (Parra etc., 2000, Genome Research10 (4): 511-515) carry out predictive genes.Use Blastall2.2.10 version (Altschul etc., 1990, J.Mol.Biol.215 (3): 403 – 410, http://blast.ncbi.nlm.nih.gov/Blast.cgi) and HMMER2.1.1 version (National Center for Biotechnology Information (NCBI), Bethesda, MD, USA, http://hmmer.janelia.org) based on structural homology forecast function.By the analysis Direct Identification to Blast result, gone out catalase.Use Agene program (Munch and Krogh, 2006, BMC Bioinformatics7:263) and SignalP program (Nielsen etc., 1997, Protein Engineering10:1-6) to identify initiator codon.Further use SignalP predicted signal peptide.Use Pepstats (Rice etc., 2000, Trends Genet.16 (6): iso-electric point and the molecular weight of 276-277) estimating albumen.
Embodiment 23: from genomic dna cloning Penicillium emersonii catalase
Selected a catalase gene PE04230007241 (SEQ ID NO:7) to carry out cloning by expression.
Gene information based on obtaining by gene order-checking, has designed the Oligonucleolide primers that time shows with the genomic dna amplification catalase gene PE04230007241 from Penicillium emersonii.Primer is manufactured by Invitrogen (Invitrogen, BeiJing, China).
Forward primer 5’ACACAACTGGGGATCC?ACC?atgcgcgcagtgcagct3’ SEQ?ID?NO:42
Reverse primer 5’GTCACCCTCTAGATCT?gtcgactattccaaccttcctatatggacac3’ SEQ?ID?NO:43
The lowercase of forward primer represents the encoding sequence of gene, and the lowercase of reverse primer represents the flanking region of gene, and the insertion point homology of capitalization part and the pPFJO355 carrier described in US2010306879.
Use IN-FUSION tMcF dry type clone's test kit (Clontech Laboratories, Inc., Mountain View, CA, USA) enters the expression vector pPFJO355 described in US2010306879 by described fragment Direct Cloning, and without carrying out restrictive diges-tion and connection.
Expression vector pPFJO355 contains TAKA-amylase promotor and the aspergillus niger glucoamylase terminator element that derives from aspergillus oryzae.In addition pPFJO355 has the sequence in the pUC18 source for selecting intestinal bacteria and breeding, and pyrG gene, and its coding derives from the orotidine decarboxylase of Aspergillus nidulans, the transformant of selective pyrG mutant Aspergillus bacterial strain.
By 20 picomole above-mentioned each for PCR, react, described reaction is by the Penicillium emersonii genomic dna of 2 μ l, the 5X GC damping fluid of 10 μ l, the DMSO of 1.5 μ l, the PHUSION of the dATP of each 2.5mM, dTTP, dGTP and dCTP ，He 0.6 unit tMhigh-fidelity DNA polymerase (Finnzymes Oy, Espoo, Finland) forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler (MJ Research Inc., South San Francisco, CA, USA) to carry out, and its program was as follows: 98 ℃ of sex change 1 minute; 8 circulations, each circulates in 98 ℃ of sex change 15 seconds, and 65 ℃ of annealing 30 seconds, each circulation reduced 1 ℃, and extends 3 minutes at 72 ℃; And other 22 circulations, each circulates in 98 ℃ carries out 15 seconds, and 58 ℃ are carried out 30 seconds, and 72 ℃ are carried out 3 minutes and 15 seconds; 72 ℃ of final extensions 10 minutes.Then heat block enters 4 ℃ of infusion.
Reaction product, by using 90mM Tris boric acid separated with 1.0% agarose gel electrophoresis of 1mM EDTA (TBE) damping fluid, wherein cuts out the product band of about 2.5kb from gel, then use ILLUSTRA tMgFX tMpcr dna and gel strip zone purification test kit (GE Healthcare, Buckinghamshire, UK) according to manufacturer's indication from solution purification.
By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA tMgFX tMpcr dna and gel strip zone purification test kit are according to manufacturer's indication purifying.
The carrier of PCR reaction product and digestion is used to IN-FUSION tMcF dry type PCR clone (Dry-down PCR Cloning) links together, obtain plasmid pCat_PE04230007241, wherein Penicillium emersonii catalase gene transcribes under the regulation and control in the promotor from aspergillus oryzae alpha-amylase gene.Clone operations is carried out according to manufacturer's indication.In brief, the pPFJO355 by 30ng through Bam HI and Bgl II digestion, and the Penicillium emersonii catalase PCR reaction products addition of the purifying of 60ng is to reacting bottle, and add deionized water and powder is resuspended in to the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction product of 3 μ l to transform intestinal bacteria TOP10 competent cells (TIANGEN Biotech (Beijing) Co.Ltd., BeiJing, China).By bacterium colony PCR, detected an intestinal bacteria transformant that contains pCat_PE04230007241.Bacterium colony PCR is a kind of from the intestinal bacteria bacterium colony method that directly screening plasmid inserts rapidly.In brief, in each PCR test tube, the PCR solution aliquots containig of premix (comprises PCR damping fluid, MgCl 2, dNTPs, and the primer pair of generation PCR fragment) in, by the liquid-transfering sucker point picking with sterilizing, also this liquid-transfering sucker point fast rotational (twirl) in reaction soln is added to single bacterium colony.Conventionally filter out 7 to 10 bacterium colonies.After PCR, by using 1.0% agarose gel electrophoresis analytical reaction product of tbe buffer liquid.Plasmid DNA is used the centrifugal little extraction reagent kit of QIAprep (Spin Miniprep Kit) (QIAGEN Inc., Valencia, CA, USA) preparation.The Penicillium emersonii catalase gene inserting in pCat_PE04230007241 is by being used the DNA sequencing of 3730XL DNA analysis instrument (Applied Biosystems Inc, Foster City, CA, USA) to obtain confirmation.
Embodiment 24: in aspergillus oryzae, express Penicillium emersonii catalase gene
According to Christensen etc., the method for 1988, Bio/Technology6:1419-1422 is prepared aspergillus oryzae HowB101 (being described in patent WO9535385 embodiment 1) protoplastis.Use the pCat_PE04230007241 of 3 μ g to transform aspergillus oryzae HowB101.
With pCat_PE04230007241, transform aspergillus oryzae HowB101 and produce approximately 50 transformant.Four transformant are separated to each other minimum medium dull and stereotyped.
Four transformant are inoculated respectively to 3ml YPM in 24 orifice plates and at 30 ℃, 150rpm incubation.After incubation on the 3rd, by the 20 μ l supernatants from each culture containing NuPAGE Novex4-12%Bis-Tris gel (the Invitrogen Corporation of 2-(N-morpholino) ethyl sulfonic acid (MES), Carlsbad, CA, USA) above according to manufacturer's indication, analyze.By the gel of gained INSTANT BLUE tM(Expedeon Ltd., Babraham Cambridge, UK) dyeing.The SDS-PAGE general picture of culture shows that all transformant all have the band of an about 80KDa.By expression strain called after O6YTS.
Embodiment 25: the fermentation of aspergillus oryzae expression strain O6YTS
An inclined-plane of expression strain O6YTS is washed with the YPM of 10ml and inoculate 2 liters of flasks into 7 YPM substratum that contain 400ml to generate the nutrient solution for the identification of enzyme.At results culture on the 3rd, and use 0.45 μ m DURAPORE film (Millipore, Bedford, MA, USA) to filter.
Embodiment 26: from aspergillus oryzae O6YTS purification of Recombinant Penicillium emersonii catalase
The ammonium sulfate for supernatant (80% is saturated) of 2800ml recombinant bacterial strain O6YTS is precipitated and be resuspended in 50ml20mM Tris-HCl damping fluid, pH8.0, then for identical damping fluid dialysis, and filters by 0.45mm strainer, and final volume is 80ml.Solution is imposed on to the 40ml Q of balance in 20mM Tris-HCl pH of buffer 8.0
Figure BDA0000421832260000761
fast Flow post (GE Healthcare, Buckinghamshire, UK).By the fraction of 0.18-0.25M NaCl wash-out, by SDS-PAGE (NP0336BOX, NUPAGE4-12%BT GEL1.5MM15W), assess.The fraction of collecting the band that contains about 80kDa.Then the solution collecting is passed through to ultrafiltration and concentration.
Embodiment 27: catalase activity is measured
Use following experimental program to check catalase activity to the Penicillium emersonii catalase of purifying.
By 30%H 2o 2(from Xilong Chemical, Chinese Guangdong) uses distilled water (ddH 2o) dilute 1000 times and prepare substrate, ultimate density is 10.3mM.By being added into 1000 μ l substrates, the Penicillium emersonii catalase sample of the purifying of 1 μ l carrys out initial action.With Ultrospec3300 (GE Healthcare, Buckinghamshire, UK) at 0 and 16 second, read respectively the optical density(OD) (OD) of 240nm, the minimizing of OD (from 0.505 to 0.284) has shown the catalatic relative reactivity of Penicillium emersonii.
The present invention further describes by following numbering paragraph:
[1] for degrading or transforming the method for cellulose materials, it comprises: under the existence of polypeptide with catalase activity, with enzyme composition, process cellulose materials.
[2] method of section 1, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
[3] method of section 2, wherein said cellulase is that one or more (for example several) are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.
[4] method of section 2, wherein said hemicellulase is that one or more (for example several) are selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.
[5] method of section 1-4 any one, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
[6] method of section 1-5 any one, wherein said cellulose materials is pretreated, particularly pretreated by Chemical Pretreatment, physics pre-treatment or biological chemistry pre-treatment.
[7] method of section 1-6 any one, also comprises the cellulose materials reclaiming through degraded.
[8] method of section 7, wherein the cellulose materials through degraded is sugar.
[9] method of section 8, wherein said sugar is selected from lower group: glucose, wood sugar, seminose, semi-lactosi and pectinose.
[10] method of section 1-9 any one, wherein compares with not there is not the polypeptide with catalase activity, and the existence with the polypeptide of catalase activity increases the hydrolysis of cellulose materials.
[11] method of section 1-10 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
[12] method of section 1-11 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
[13] method of section 12, the wherein said polypeptide with catalase activity is the catalase from tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Humicola insolens or Penicillium emersonii.
[14] for generation of a method for tunning, it comprises:
(a) under the existence of polypeptide with catalase activity, use enzyme composition diastatic fiber cellulosic material;
(b) for example, with the fermentation of one or more (several) organism of fermentation through the cellulose materials of saccharification to produce tunning; With
(c) from fermentation, reclaim tunning.
[15] method of section 14, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
[16] method of section 15, wherein said cellulase is that one or more (for example several) are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.
[17] method of section 15, wherein said hemicellulase is that one or more (for example several) are selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.
[18] method of section 14-17 any one, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
[19] method of section 14-18 any one, wherein said cellulose materials is pretreated, particularly pretreated by Chemical Pretreatment, physics pre-treatment or biological chemistry pre-treatment; Or wherein (a) and (b) at the same time saccharification and fermentation in carry out simultaneously.
[20] method of section 14-19 any one, wherein said tunning is alcohol, alkane, naphthenic hydrocarbon, alkene, amino acid, gas, isoprene, ketone, organic acid or polyketide.
[21] method of section 14-20 any one, wherein compares with not there is not the polypeptide with catalase activity, and the existence with the polypeptide of catalase activity increases the hydrolysis of cellulose materials.
[22] method of section 14-21 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, its by with the following polynucleotide encoding with at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
[23] method of section 14-22 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
[24] method of section 23, the wherein said polypeptide with catalase activity is the catalase from tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Humicola insolens or Penicillium emersonii.
[25] a kind of method of fermented cellulose material, it comprises: for example, with one or more (several) organism of fermentation described cellulose materials that ferments, wherein said cellulose materials is hydrolyzed by enzyme composition under the existence of polypeptide with catalase activity.
[26] method of section 25, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
[27] method of section 26, wherein said cellulase is that one or more (for example several) are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.
[28] method of section 26, wherein said hemicellulase is selected from the enzyme of lower group for one or more: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.
[29] method of section 25-28 any one, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
[30] method of section 25-29 any one, wherein said cellulose materials is pretreated, particularly pretreated by Chemical Pretreatment, physics pre-treatment or biological chemistry pre-treatment.
[31] method of section 25-30 any one, wherein said fermentation produces tunning.
[32] method of section 31, also comprises and reclaims described tunning.
[33] method of section 32, wherein said tunning is alcohol, alkane, naphthenic hydrocarbon, alkene, amino acid, gas, isoprene, ketone, organic acid or polyketide.
[34] method of section 25-33 any one, wherein compares with not there is not the polypeptide with catalase activity, and the existence with the polypeptide of catalase activity increases the hydrolysis of cellulose materials.
[35] method of section 25-34 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), (b), (c) or polypeptide (d) have the fragment of catalase activity.
[36] method of section 25-35 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
[37] method of section 36, the wherein said polypeptide with catalase activity is the catalase from tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Humicola insolens or Penicillium emersonii.
[38] for degrading or transforming the enzyme composition of cellulose materials, it comprises one or more (for example several) and has the enzyme of cellulose decomposition and/or hemicellulose degrading activity, and has the polypeptide of catalase activity.
[39] enzyme composition of section 38, it also comprises one or more (for example several) and is selected from the enzyme of lower group: GH61 polypeptide, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and the swollenin with cellulolytic enhancing activity.
[40] enzyme composition of section 38 or 39, the wherein said enzyme with cellulolytic activity is to be selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.
[41] enzyme composition of section 38-40 any one, the wherein said enzyme with hemicellulose degrading activity is to be selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.
[42] enzyme composition of section 38-41 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
[43] enzyme composition of section 38-42 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
[44] enzyme composition of section 43, the wherein said polypeptide with catalase activity is the catalase from tangerine orange thermophilic ascomycete, Talaromyces stipitatus, Humicola insolens or Penicillium emersonii.
[45] purposes of the enzyme composition of section 38-44 any one in degraded or conversion cellulose materials.
[46] purposes of section 45, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
[47] purposes of section 45 or 46, wherein said cellulose materials is pretreated, particularly pretreated by Chemical Pretreatment, physics pre-treatment or biological chemistry pre-treatment.
[48] nutrient solution formulation or a cell culture compositions, it comprises one or more (for example several) and has the enzyme of cellulose decomposition and/or hemicellulose degrading activity, and has the polypeptide of catalase activity.
Description and claimed the present invention is herein not limited in the scope of concrete aspect disclosed herein, because these aspects are intended to the explanation as the several aspects of the present invention.Be intended to any aspect being equal to be contained in scope of the present invention.In fact, from the foregoing description, except herein shown and described, multiple modification of the present invention is apparent for a person skilled in the art.These modifications are also intended to fall in the scope of appended claim.In conflict in the situation that, by comprise that the disclosure of definitional part is as the criterion.
Figure IDA0000421832300000011
Figure IDA0000421832300000021
Figure IDA0000421832300000031
Figure IDA0000421832300000041
Figure IDA0000421832300000051
Figure IDA0000421832300000061
Figure IDA0000421832300000071
Figure IDA0000421832300000081
Figure IDA0000421832300000091
Figure IDA0000421832300000111
Figure IDA0000421832300000131
Figure IDA0000421832300000141
Figure IDA0000421832300000171
Figure IDA0000421832300000181
Figure IDA0000421832300000191
Figure IDA0000421832300000211
Figure IDA0000421832300000221
Figure IDA0000421832300000231
Figure IDA0000421832300000241
Figure IDA0000421832300000251
Figure IDA0000421832300000261
Figure IDA0000421832300000271
Figure IDA0000421832300000281
Figure IDA0000421832300000291
Figure IDA0000421832300000301
Figure IDA0000421832300000311
Figure IDA0000421832300000331
Figure IDA0000421832300000351
Figure IDA0000421832300000361
Figure IDA0000421832300000371
Figure IDA0000421832300000381
Figure IDA0000421832300000391
Figure IDA0000421832300000401
Figure IDA0000421832300000411
Figure IDA0000421832300000421
Figure IDA0000421832300000431
Figure IDA0000421832300000441
Figure IDA0000421832300000451
Figure IDA0000421832300000461
Figure IDA0000421832300000471
Figure IDA0000421832300000481
Figure IDA0000421832300000491
Figure IDA0000421832300000501
Figure IDA0000421832300000511
Figure IDA0000421832300000521
Figure IDA0000421832300000531
Figure IDA0000421832300000551
Figure IDA0000421832300000561
Figure IDA0000421832300000571
Figure IDA0000421832300000581
Figure IDA0000421832300000591
Figure IDA0000421832300000601

Claims (25)

1. for degrading or transforming the method for cellulose materials, it comprises: under the existence of polypeptide with catalase activity, with enzyme composition, process cellulose materials.
2. the method for claim 1, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
3. claim 1 or 2 method, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
4. the method for claim 1-3 any one, wherein said cellulose materials is pretreated, particularly pretreated by Chemical Pretreatment, physics pre-treatment or biological chemistry pre-treatment.
5. the method for claim 1-4 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
6. the method for claim 1-5 any one, the wherein said polypeptide with catalase activity is from thermophilic ascomycete, to belong to the catalase of (Thermoascus), Talaromyces (Talaromyces), Humicola (Humicola) or Penicillium (Penicillium).
7. for generation of a method for tunning, it comprises:
(a) under the existence of polypeptide with catalase activity, use enzyme composition diastatic fiber cellulosic material;
(b) for example, with the fermentation of one or more (several) organism of fermentation through the cellulose materials of saccharification to produce tunning; With
(c) from fermentation, reclaim tunning.
8. the method for claim 7, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
9. claim 7 or 8 method, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
10. the method for claim 7-9 any one, wherein said tunning is alcohol, alkane, naphthenic hydrocarbon, alkene, amino acid, gas, isoprene, ketone, organic acid or polyketide.
The method of 11. claim 7-10 any one, wherein compares with not there is not the polypeptide with catalase activity, and the existence with the polypeptide of catalase activity increases the hydrolysis of cellulose materials.
12. the method for claim 7-11 any one, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), (b), (c) or polypeptide (d) have the fragment of catalase activity.
The method of 13. claim 7-12 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
14. a method for fermented cellulose material, it comprises that for example, wherein said cellulose materials is hydrolyzed with enzyme composition under the existence of polypeptide with catalase activity with one or more (several) organism of fermentation described cellulose materials that ferments.
The method of 15. claims 14, wherein said enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.
The method of 16. claims 14 or 15, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
17. the method for claim 14-16 any one, the polypeptide wherein with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, it is by polynucleotide encoding, described polynucleotide are hybridized with following under low, medium, medium-Gao, height or very high stringent condition: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, it is by the polynucleotide encoding with having below at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
The method of 18. claim 14-17 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
For example, 19. for degrading or transforming the enzyme composition of cellulose materials, it comprises one or more (several) and has the enzyme of cellulose decomposition and/or hemicellulose degrading activity, and has the polypeptide of catalase activity.
The enzyme composition of 20. claims 19, it further comprises one or more (for example several) and is selected from the enzyme of lower group: GH61 polypeptide, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and the swollenin with cellulolytic enhancing activity.
21. the enzyme composition of claim 19 or 20, the wherein said polypeptide with catalase activity is selected from lower group:
(a) polypeptide, itself and the mature polypeptide of SEQ ID NO:2 are, the mature polypeptide of the mature polypeptide of SEQ ID NO:4, SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8 have at least 60% sequence identity;
(b) polypeptide, its by under low, medium, medium-Gao, height or very high stringent condition with the polynucleotide encoding of following hybridization: (i) the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, (ii) their cDNA sequence, or (iii) (i) or total length complementary strand (ii);
(c) polypeptide, its by with the following polynucleotide encoding with at least 60% sequence identity: the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, the mature polypeptide encoded sequence of SEQ ID NO:5 or SEQ ID NO:7, or its cDNA sequence;
(d) variant of the mature polypeptide of the variant of the mature polypeptide of SEQ ID NO:2, SEQ ID NO:4 is, the variant of the variant of the mature polypeptide of SEQ ID NO:6 or the mature polypeptide of SEQ ID NO:8, and it for example, comprises replacement, disappearance and/or inserts in one or more (several) position; With
(e) (a), the fragment with catalase activity of (b), (c) or polypeptide (d).
The enzyme composition of 22. claim 19-21 any one, the wherein said polypeptide with catalase activity is the catalase from thermophilic ascomycete genus, Talaromyces, Humicola or Penicillium.
The enzyme composition of 23. claim 19-22 any one is in degraded or transform the purposes in cellulose materials.
The purposes of 24. claims 23, wherein said cellulose materials is selected from lower group: agricultural residue, draft material, municipal solid waste, paper pulp and paper mill resistates, waste paper and timber; Preferred giantreed, bagasse, bamboo, corn cob, zein fiber, maize straw, Chinese silvergrass platymiscium, orange peel, rice straw, switchgrass, straw, eucalyptus, fir, pine tree, willow, dragon spruce, willow, algae Mierocrystalline cellulose, bacteria cellulose, velveteen, filter paper, Microcrystalline Cellulose or the acid-treated Mierocrystalline cellulose of phosphorus.
25. full nutrient solution formulation or a cell culture compositions, it comprises one or more (for example several) and has the enzyme of cellulose decomposition and/or hemicellulose degrading activity, and has the polypeptide of catalase activity.
CN201280025435.0A 2011-03-25 2012-03-26 Method for degrading or converting cellulosic material Pending CN103562382A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202211254624.7A CN115927509A (en) 2011-03-25 2012-03-26 Methods for degrading or converting cellulosic material
CN201280025435.0A CN103562382A (en) 2011-03-25 2012-03-26 Method for degrading or converting cellulosic material
CN201810257103.4A CN108467877A (en) 2011-03-25 2012-03-26 method for degrading or converting cellulosic material

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
CN2011072143 2011-03-25
CNPCT/CN2011/072143 2011-03-25
CN2011084230 2011-12-19
CNPCT/CN2011/084230 2011-12-19
CN201280025435.0A CN103562382A (en) 2011-03-25 2012-03-26 Method for degrading or converting cellulosic material
PCT/CN2012/073040 WO2012130120A1 (en) 2011-03-25 2012-03-26 Method for degrading or converting cellulosic material

Related Child Applications (2)

Application Number Title Priority Date Filing Date
CN201810257103.4A Division CN108467877A (en) 2011-03-25 2012-03-26 method for degrading or converting cellulosic material
CN202211254624.7A Division CN115927509A (en) 2011-03-25 2012-03-26 Methods for degrading or converting cellulosic material

Publications (1)

Publication Number Publication Date
CN103562382A true CN103562382A (en) 2014-02-05

Family

ID=50015668

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201280025435.0A Pending CN103562382A (en) 2011-03-25 2012-03-26 Method for degrading or converting cellulosic material
CN201810257103.4A Pending CN108467877A (en) 2011-03-25 2012-03-26 method for degrading or converting cellulosic material
CN202211254624.7A Pending CN115927509A (en) 2011-03-25 2012-03-26 Methods for degrading or converting cellulosic material

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN201810257103.4A Pending CN108467877A (en) 2011-03-25 2012-03-26 method for degrading or converting cellulosic material
CN202211254624.7A Pending CN115927509A (en) 2011-03-25 2012-03-26 Methods for degrading or converting cellulosic material

Country Status (1)

Country Link
CN (3) CN103562382A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104164413A (en) * 2014-08-18 2014-11-26 江苏迪因生物科技有限公司 Method for preparing cellulase
CN106488982A (en) * 2014-06-06 2017-03-08 诺维信公司 Enzymatic compositions and application thereof
CN109055273A (en) * 2018-09-10 2018-12-21 安徽农业大学 A kind of green brick tea pile-fermentation strain composition and application

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112522227B (en) * 2020-12-21 2022-09-23 广东溢多利生物科技股份有限公司 Catalase with high enzyme activity, gene, recombinant strain with high catalase yield and application

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004261137A (en) * 2003-03-04 2004-09-24 Mitsubishi Gas Chem Co Inc Catalase gene
CN101287751A (en) * 2005-08-04 2008-10-15 诺维信股份有限公司 Polypeptides having beta-glucosidase activity and polynucleotides encoding same
CN101321857A (en) * 2005-09-30 2008-12-10 诺维信股份有限公司 Methods for enhancing the degradation or conversion of cellulosic material
WO2010080408A2 (en) * 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing enzymatic hydrolysis of cellulosic material in the presence of a peroxidase
CN101874109A (en) * 2007-09-28 2010-10-27 诺维信公司 Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004261137A (en) * 2003-03-04 2004-09-24 Mitsubishi Gas Chem Co Inc Catalase gene
CN101287751A (en) * 2005-08-04 2008-10-15 诺维信股份有限公司 Polypeptides having beta-glucosidase activity and polynucleotides encoding same
CN101321857A (en) * 2005-09-30 2008-12-10 诺维信股份有限公司 Methods for enhancing the degradation or conversion of cellulosic material
CN101874109A (en) * 2007-09-28 2010-10-27 诺维信公司 Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
WO2010080408A2 (en) * 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing enzymatic hydrolysis of cellulosic material in the presence of a peroxidase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GENBANK DATEBASE: "ACCESSION NO:XP_002487825.1", 《GENBANK》, 2 July 2009 (2009-07-02) *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106488982A (en) * 2014-06-06 2017-03-08 诺维信公司 Enzymatic compositions and application thereof
CN104164413A (en) * 2014-08-18 2014-11-26 江苏迪因生物科技有限公司 Method for preparing cellulase
CN109055273A (en) * 2018-09-10 2018-12-21 安徽农业大学 A kind of green brick tea pile-fermentation strain composition and application

Also Published As

Publication number Publication date
CN108467877A (en) 2018-08-31
CN115927509A (en) 2023-04-07

Similar Documents

Publication Publication Date Title
US10167491B2 (en) Methods for degrading or converting cellulosic material
CN102459582B (en) Methods for enhancing the degradation or conversion of cellulosic material
CN103608461B (en) The method increasing the cellulolytic enhancing activity of polypeptide
CN105886485B (en) β-glucosyl enzym variant and its coded polynucleotide
CN103282504A (en) Methods of pretreating cellulosic material with a gh61 polypeptide
CN103797126A (en) Methods for enhancing the degradation or conversion of cellulosic material
CN103620028A (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides
CN103261429A (en) Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
CN103958674A (en) Polypeptides having xylanase activity and polynucleotides encoding same
CN103517986A (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
CN102325879A (en) Methods for increasing hydrolysis of cellulosic material in the presence of cellobiose dehydrogenase
CN103703139A (en) Processes for pretreating cellulosic material and improving hydrolysis thereof
CN103517985A (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
CN103429749A (en) Methods for producing fermentation product from lignocellulose-containing material
CN103930555A (en) Methods of hydrolyzing and fermenting cellulosic material
CN103703125A (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
CN103958675A (en) Polypeptides having xylanase activity and polynucleotides encoding same
CN103339252A (en) Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN103459605A (en) Processes for enzymatic refining of pretreated cellulosic material for saccharification
CN103649308A (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
CN104039834A (en) Hybrid polypeptides having cellobiohydrolase activity and polynucleotides encoding same
CN103108951A (en) Polypeptides having beta-glucosidase activity and polynucleotides encoding same
CN103562382A (en) Method for degrading or converting cellulosic material
CN104053666A (en) Polypeptides Having Endoglucanase Activity And Polynucleotides Encoding Same
CN104136608A (en) Polypeptides having endoglucanase activity and polynucleotides encoding same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20140205

RJ01 Rejection of invention patent application after publication