CN103558383B - The application of ALDH2 gene on detecting in bladder transitional cell carcinoma - Google Patents
The application of ALDH2 gene on detecting in bladder transitional cell carcinoma Download PDFInfo
- Publication number
- CN103558383B CN103558383B CN201310516711.XA CN201310516711A CN103558383B CN 103558383 B CN103558383 B CN 103558383B CN 201310516711 A CN201310516711 A CN 201310516711A CN 103558383 B CN103558383 B CN 103558383B
- Authority
- CN
- China
- Prior art keywords
- sample
- cell carcinoma
- aldh2
- transitional cell
- bladder transitional
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Hematology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Hospice & Palliative Care (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application of ALDH2 gene of the present invention on detecting in bladder transitional cell carcinoma, belongs to gene engineering technology field.Described application is referred to and to be contrasted by the mrna expression amount of RT-PCR reaction to the ALDH2 gene in the mrna expression amount of the ALDH2 gene in urothelium tissue samples and normal urinary tract epithelial tissue, when mrna expression amount lower than normal ALDH2 gene of the mrna expression amount of ALDH2 gene in sample, this sample is upper bladder transitional cell carcinoma sample; Also can by carrying out SABC mensuration to sample urothelium tissue, when Di≤4 of sample urothelium tissue, ALDH2 high expressed in this sample urothelium tissue, this sample is upper bladder transitional cell carcinoma sample.The diagnosis that the present invention has for UTUC patient provides a kind of new diagnostic index, and ALDH2 gene can predict the advantage of T2 and T3 survival of patients difference.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to the application of ALDH2 (aldehyde dehydrogenase 2) gene on detecting in bladder transitional cell carcinoma.
Background technology
Adult's kidney comprises the malignant tumour originating from kidney essence and renal plevis.In kidney, topmost type is carcinoma of renal parenchyma and carcinoma of renal pelvis relatively rare (accounting for 10% greatly).Nearly all carcinoma of renal pelvis is all upper bladder transitional cell carcinoma (UTUC), and UTUC accounts for greatly 8.4% of pathological diagnosis kidney, accounts for greatly 5% of all bladder transitional cell carcinomas.UTUC a kind ofly originates from orificium ureteris (urinary tract) epithelial malignant tumour of dividing a word with a hyphen at the end of a line to kidney calices.People are not enough to the understanding of UTUC, and these understanding are usually based on TCCB, this is because it is believed that they have common hazards, if smoking and use are containing acetyl-p-aminophenol class antalgesic.We from the literature of the people such as Lughezzani to: in the past few years, some molecular markers relevant to UTUC process control the clinical practice that (P53) etc. promote UTUC advance as cell proliferation (EFGR), new vessels form (as HIF-1 α), cell adherence (as cadherin and beta chain albumen), Apoptosis (as Bcl-2) and cell cycle.But multivariable analysis proves that p53 can not as independently prognostic indicator.Although tumour by stages and the Pathologic Grading of tumour be still considered to the most believable clinical outcome prediction index.But some other tumor research but shows: judge that survival region is better than Pathologic Grading with molecular marker.In order to prove that molecular marker is better than Pathologic Grading in prognosis existence, in this research, we simply optionally test several gene order, but find out all genes relevant with prognosis as far as possible based on full-length genome mrna expression spectrum.
People are verified: determining in tumour-specific mark, hypotype and predicted treatment result, and method that large-scale mrna expression spectrum paints survey is effective to utilize microarray or second generation sequencing technologies to carry out.This method makes to become possibility to the series of studies of thousands of gene and even whole genome scanning simultaneously, and therefore this method can promote the complete understanding of tumour and be conducive to the discovery of the biomarker of hypersensitivity and high specific.Compared with microarray technology, the analysis based on sequence does not produce mRNA hybridization sequences and avoids repeatability, and it can measure gene expression dose in unlimited dynamic range.
Summary of the invention
The present invention, by based on the analysis of sequence, discloses the down-regulated expression of ALDH2 in UTUC patient, and determine ALDH2 protein expression can as UTUC patient important and independently prognostic evaluation index.Although Pathological TNM Staging can predict T1 and T2 or T1 and T3 existence difference, molecular labeling but can predict T2 and T3 survival of patients difference, and this does not predict by TNM by stages.Result of study of the present invention not only describes the molecular characterization of UTUC, and provides the potential prognostic marker of UTUC; The more important thing is, for function and clinical verification provide an abundant case.
The object of the invention is to disclose the application of ALDH2 gene on detecting in bladder transitional cell carcinoma.
The object of the invention is to be achieved through the following technical solutions:
The application of ALDH2 gene on detecting in bladder transitional cell carcinoma.
The application of ALDH2 gene described in technique scheme on detecting in bladder transitional cell carcinoma, wherein, ALDH2 gene is down-regulated expression in upper bladder transitional cell carcinoma.
The application of ALDH2 gene described in technique scheme on detecting in bladder transitional cell carcinoma, comprises the steps:
(1), sample this urothelium tissue, extract the RNA of urothelium tissue;
(2), to the urothelium of sample organize RNA to carry out reverse transcription, obtain the cDNA of sample urothelium tissue;
(3) the urothelium tissue cDNA, obtained with step (2) is for masterplate, with primer pair P for primer, carry out RT-PCR reaction, the mrna expression amount of the ALDH2 gene in the mrna expression amount of the ALDH2 gene in sample urothelium tissue and normal urinary tract epithelial tissue is contrasted, when mrna expression amount lower than normal ALDH2 gene of the mrna expression amount of ALDH2 gene in sample, this sample is upper bladder transitional cell carcinoma sample; Wherein primer pair P is:
ALDH2 upstream primer: 5 '-CCAACCAGCAGCCCGAGGTC-3 ',
ALDH2 downstream primer: 5 '-AAGGCCTTGTCCCCTTCAGCTACC-3 '.
The application of ALDH2 gene described in technique scheme on detecting in bladder transitional cell carcinoma, wherein, the condition of described RT-PCR is: 50 DEG C 2 minutes, 95 DEG C 2 minutes, 1 circulation; 95 DEG C 15 seconds, 55 DEG C 30 seconds, 72 DEG C 40 seconds, 40 circulations.
The application of ALDH2 gene described in technique scheme on detecting in bladder transitional cell carcinoma, wherein, described application is by carrying out SABC mensuration to the urothelium tissue of sample, when Di≤4 of sample urothelium tissue, the low expression of ALDH2 in this sample urothelium tissue, this sample is upper bladder transitional cell carcinoma sample.
The present invention has following beneficial effect:
1, the present invention discloses the low expression in upper bladder transitional cell carcinoma of ALDH2 gene by experiment, and the diagnosis for UTUC patient provides a kind of new diagnostic index.
2, ALDH2 gene of the present invention can predict T2 and T3 survival of patients difference, and TNM can not be used for predicting T2 and T3 existence difference by stages.
Accompanying drawing illustrates:
1, Fig. 1 is the comparing result figure of expression between the tumor tissues and normal control tissue of UTUC patient of the mRNA of ALDH2.
2, Fig. 2 uses the different color developing effect figures of immunohistochemical staining display ALDH2 in tumor tissues and in normal structure.
3, Fig. 3 is the relation of the low expression of ALDH2 and the prognosis of patient, and wherein Low is the low expression of ALDH2, and High is ALDH2 high expressed.
4, Fig. 4 be ALDH2 as prognostic indicator molecular marked compound and TNM comparative test result figure by stages, wherein Low is the low expression of ALDH2, and High is ALDH2 high expressed.
Embodiment:
Being convenient to for making technical scheme of the present invention understand, below in conjunction with concrete test example, the application of ALDH2 gene on detecting in bladder transitional cell carcinoma being further described.
One, sample and reagent:
(1), sample:
1, all patients are in the preoperative without radiotherapy or chemotherapy; 2, patient makes a definite diagnosis after carrying out pathological diagnosis and clinical diagnosis by Zhong Shan tumor center; 3, the age is greater than 18 years old; 4, tumor tissues is by TURP or entirely cut acquisition in art; 5, sample tissue is all flesh tissue, cuts in latter 30 minutes and puts into RNAlater, and in 4 DEG C of refrigerated overnight, thereafter-80 DEG C of low-temperature storage; 6, through HE dyeing, the tumor tissues of tumour cell more than 80%; 7, normal kidney tissue shows normal renal tubule and glomerulus and negative for tumor cells pollutes in pathological examination.
The flesh tissue of excision is immersed in RNAlater(Qiagen company immediately; Germany) in, and 4 DEG C of refrigerated overnight are so that solution gos deep into invade tissues ,-80 DEG C of low-temperature storage thereafter.On the other hand, the number percent of hematoxylin-eosin (HE) staining examine tumour cell, filters out the tumor tissues of tumour cell more than 80% and does further research.The pathological examination of normal kidney tissue shows normal renal tubule and glomerulus and negative for tumor cells pollutes.According to 2002 american cancer joint committee (AJCC) Staging Systems, the tumour of every patient to be carried out by stages or again by stages.
(2), reagent:
(1)、RNAlater；
(2), DNaseI (RNaseFree, the U.S., Promega);
(3), Trizol reagent solution (Invitrogen; Carlsbad, the U.S.);
(4), oligo (dT)
18beads (Invitrogen, the U.S.);
(5), reverse transcriptase (M-MLV) (Fermentas; The U.S.);
(6), RT-PCR instrument (ABI7000) Applied biosystems.
The use relating to mentioned reagent in the present invention all operates according to the step in reagent operation instruction.
test example 1:rT-PCR detects mRNA down-regulated expression in upper bladder transitional cell carcinoma of ALDH2 gene:
(1), sample information:
The information of 10 routine patients is as shown in table 1:
Table 1 sample information
(2), method:
1, sample rna extracts:
(1), the sample of urothelium cancerous tissue and normal adjacent tissue is put into RNAlater and carry out preservation;
(2), according to the step of Trizol reagent (Invitrogen company, the U.S.) instructions extract the total serum IgE in the sample of urothelium cancerous tissue and normal adjacent tissue, step is as follows:
A, homogenized (Homogenization):
Add 1mlTRIzol by 10-30mg tissue, with electric homogenizer or the abundant homogenate of disposable grinding pestle, from homogenate, extract total serum IgE.
B, layering (PhaseSeparation):
A (), sample add TRIzol after, room temperature places 5min, makes the abundant cracking of sample.
Step: 4 DEG C 12,000rpm centrifugal 10 minutes, gets supernatant.
B (), every 1mlTRIzol add 200 μ l chloroforms, after thermal agitation mixing, room temperature is placed 3-5min and made its natural phase-splitting.
C, RNA precipitate (RNAPrecipitation):
4 DEG C of 12,000rpm centrifugal 10-15min.Sample can be divided into three layers: yellow organic phase, middle layer and colourless aqueous phase, and RNA, mainly in aqueous phase, transfers to aqueous phase (usually can draw 550 μ l) in new pipe;
(3), according to the DNA pollution of total serum IgE in the step removal process (2) in the DNaseI operation instructions of RNase-free;
2, reverse transcriptase synthesis cDNA is used:
RNA oligo (dT) is organized to the sample urothelium in the PCR pipe of RNasefree
18beads carries out reverse transcription, obtains the cDNA of sample urothelium tissue;
(1), the template ribonucleic acid shown in table 2/primer mixed liquor is prepared, full dose 6 μ l in Microtube pipe.
Table 2 template ribonucleic acid/primer mixed liquor
| Reagent name | Use amount |
| RNA(extracts) | 1ng |
| Specific Primer（oligo(dT)18beads）（10μM） | 1μl |
| Sterile purified water | up to6μl |
(2), 70 DEG C of insulations after 10 minutes rapidly at chilling more than 2 minutes on ice.
(3), the centrifugal several seconds makes the denaturing soln of template ribonucleic acid/primer be gathered in bottom Microtube pipe.
(4), in above-mentioned Microtube pipe, the inverse transcription reaction liquid shown in table 3 is prepared.
Table 3 inverse transcription reaction liquid
| Reagent name | Use amount |
| Above-mentioned template ribonucleic acid/primer distortion solution | 6ul |
| 5×M-MLV Buffer | 2μl |
| The each 10mM of dNTP Mixture() | 0.5μl |
| RNase Inhibitor（40U/μl） | 0.25μl |
| RTase M-MLV（RNase H-）（200U/μl） | 1μl |
| Sterile purified water | up to10μl |
(5), 42 DEG C are incubated 1 hour.
(6), 70 DEG C of insulations cooled on ice after 15 minutes, the cDNA solution obtained can be directly used in the synthesis of 2nd-StrandcDNA or pcr amplification etc., and during pcr amplification, the use amount of cDNA solution is 1 μ l ~ 5 μ l.
3, RT-PCR detects:
(1), RT-PCR reaction system composition (totally 15 μ l), as shown in table 4:
Table 4RT-PCR reaction system
After total system prepares, shaken well or inhale with rifle and beat even in an oscillator, then 15ul often manages and point is filled in 8 connecting legs; GAPDH in table 4 is an internal control, and wherein each primer sequence is:
ALDH2 upstream primer: 5 '-CCAACCAGCAGCCCGAGGTC-3 ',
ALDH2 downstream primer: 5 '-AAGGCCTTGTCCCCTTCAGCTACC-3 ';
GAPDH upstream primer: 5 '-GCTCTCTGCTCCTCCTGTTC-3 ',
GAPDH downstream primer: 5 '-GACTCCGACCTTCACCTTCC-3 '.
(2), cDNA sterilizing pure water dilutes suitable concentration, is generally 1:20 dilution, as run into the low sample of gene expression, then suitably reduces dilution ratio to 1:10 or 1:5.Application of sample is complete, builds eight connecting leg lids, and the limit of going up edge at eight connecting leg lids has most marked the order of 1-12;
(3), each row eight connecting leg is placed on the centrifugal several seconds on palm hydro-extractor;
(4), by eight connecting legs put into RT-PCR instrument (ABI7000) to increase, amplification condition is: 50 DEG C (2 minutes) and 95 DEG C (2 minutes), 1 circulation; 95 DEG C (15 seconds), 55 DEG C (30 seconds) and 72 DEG C (40 seconds), do 40 circulations.Calculate the regression curve of each sample, and calculate the cycle threshold of relative populations mRNA according to SPSS software (Version17.0SPSSInc.).The relative expression levels of target gene is standardized as the geometric mean of reference gene GAPDH.By compare threshold cycle (the 2-Δ CT) data analysis to us, result as shown in Figure 1.
test example two:sABC detects protein down-regulated expression in upper bladder transitional cell carcinoma of ALDH2 gene:
1, object: in order to examine the clinical meaning of cancer related gene, ALDH2 is divided into high protein expression group and low protein expression group by us.Then use GraphPadPrism6 to carry out Kaplan-Meier analysis, in analysis, use the correlativity that sequence check comes between check table expression patterns and prognosis.And use SPSS17.0 to carry out Multivariate Cox Regression analysis.In addition, protein expression (immunohistochemical staining index score) is utilized to assess two Pearson tail coefficients, to test the correlativity of these three genes.
2, method: carry out SABC (see WuS; WangY; SunL; ZhangZ; JiangZ; QinZ, etal.Decreasedexpressionofdual-specificityphosphatase9is associatedwithpoorprognosisinclearcellrenalcellcarcinoma .BMCcancer.2011; 11:413.).In brief, paraffin embedding (FFPE) section that formalin is fixing, dewaxes with dimethylbenzene.Endogenous peroxidase activity eliminated by hydrogen peroxide with 3% and 10% bovine serum albumin(BSA) stops non-specific binding.Sample adds with first antibody (Abcam, MA, USA), and overnight incubation in 4 DEG C of borders replaces first antibody to obtain negative control with antibody diluent.After this, cut into slices MaxVision at 37 DEG C
tMhRP-Polymeranti-MouseIHCKit (Maixin, Fujian, China) processes 15-20 minute, and AEC soaks, Mayer haematoxylin redyeing, and dehydration, finally separates out with crystal.
According to the standard reported (see TsuchiyaA, SakamotoM, YasudaJ, ChumaM, OhtaT, OhkiM, YasugiT, TaketaniY, HirohashiS:Expressionprofilinginovarianclearcellcarcinom a:identificationofhepatocytenuclearfactor-1betaasamolecu larmarkerandapossiblemoleculartargetfortherapyofovarianc learcellcarcinoma.AmJPathol2003,163:2503-2512, SaussezS, CucuDR, DecaesteckerC, ChevalierD, KaltnerH, Andr é S, WacreniezA, ToubeauG, CambyI, GabiusHJ, KissR:Galectin7 (p53-inducedgene1): anewprognosticpredictorofrecurrenceandsurvivalinstageIVh ypopharyngealcancer.AnnSurgOncol2006,13:999-1009., and BaoS, OuyangG, BaiX, HuangZ, MaC, LiuM, ShaoR, AndersonRM, RichJN, WangXF:Periostinpotentlypromotesmetastaticgrowthofcolonc ancerbyaugmentingcellsurvivalviatheAkt/PKBpathway.Cancer Cell2004, 5:329-339.), the immunohistochemical staining degree of paraffin section is assessed, wherein: 0 for not having positive cell, <5% Di is 1, 6% ~ 25% Di is 2, 26% ~ 50% Di is 3, 51% ~ 75% Di is 4, >75% Di is 5.According to average optical, classification is carried out to staining power: 0 grade, dye-free; 1 grade, weak dyeing (faint yellow); 2 grades, moderate dyeing (yellow); With 3 grades, strong dyeing (brown).The ratio that cancer cell proteins is expressed and staining power are used to calculate Di.We assess ALDH2 in optimum and expression that is malignant change urothelium tissue according to Di value, and score value is 0,1,2,3,4,5,6,8,9,10,12 and 15 critical values formulating protein expression on the basis of the heterogeneous size of overall survival.Di >=5 are high expressed, and Di≤4 are low expression.
3, the SABC of ALDH2 and survival analysis:
In order to check ALDH2 as the meaning of prognostic indicator, GraphPadPrism6 is used to carry out Kaplan-Meier analysis, in analysis, use sequence check to carry out the method for the correlativity between check table expression patterns and prognosis, specimens paraffin embedding slices is fixed to the tumor tissues of 104 bladder transitional cell carcinoma patients (information of this 104 routine patient is shown in " patient code ", " sex ", " age " and " TNM " row of table 5) and the formalin of contiguous normal structure and has carried out immunohistochemical analysis, to detect these protein expression situations.All patients do not accept chemotherapy and radiation before the surgery.
As shown in Figure 2, ALDH2 develops the color very low in tumor tissues, but colour developing is obvious in the normal tissue.Based on ALDH2 protein expression, 104 patients divide equally for Di >=5 and Di≤4 liang group by we.As shown in Figure 3, the low prognosis mala (p<0.0001) of expressing indication patient of ALDH2.
Table 5 participates in the patient information of demonstration test
test example three:as prognostic indicator molecular marked compound and TNM contrast test by stages:
In order to check molecular marker can as independently prognostic indicator, use SPSS17.0 is carried out COX analysis by us, the expression of result display SMAD3 can be used as the independently predictive factors (p<0.001, table 6) of UTUC patients overall survival number.
In order to check the relevance of TNM by stages and between survival rate, also adopt GraphPadPrism6 to carry out Kaplan-Meier analysis simultaneously, the correlativity that sequence check comes between check table expression patterns and prognosis is used in analysis, to verify that queue (104 SABC patients form a queue) is divided into three groups, be respectively T1(n=62), T2(n=16), T3(n=25).As shown in Figure 4 A, the overall survival of T1 group obviously will be better than T2 group (p=0.015) and T3 group (p<0.0001).Although TNM by stages can independent prediction survival rate (p<0.001, table 6), it can not predict the difference (p=0.094) of survival between T2 and T3 subgroup.For the prediction of prognosis, next whether we are more better than TNM by stages by checking ALDH2.As shown in Figure 4 B, ALDH2 can distinguish T2 and T3 group medium or high risk subgroup (p<0.0001).Patient in T2 and T3 group, ALDH2 can better prognosis as molecular marker.In sum, the protein expressed by ALDH2 has better prediction effect than TNM by stages.
Table 6 uses COX to analyze the relation of prognostic indicators different in UTUC patient and overall survival
The above, be only preferred embodiment of the present invention, not any formal and substantial restriction is done to the present invention, all those skilled in the art, do not departing within the scope of technical solution of the present invention, when utilizing disclosed above technology contents, and a little change made, modify with differentiation equivalent variations, be Equivalent embodiments of the present invention; Meanwhile, all according to substantial technological of the present invention to the change of any equivalent variations that above embodiment is done, modify and differentiation, all still belong in the scope of technical scheme of the present invention.
SEQUENCELISTING
<110> Shenzhen City Second People's Hospital
The application of <120>ALDH2 gene on detecting in bladder transitional cell carcinoma
<130>
<160>4
<170>PatentInversion3.5
<210>1
<211>20
<212>DNA
<213>ALDH2 upstream primer
<220>
<221>misc_feature
<222>(1)..(20)
<400>1
ccaaccagcagcccgaggtc20
<210>2
<211>24
<212>DNA
<213>ALDH2 downstream primer
<220>
<221>misc_feature
<222>(1)..(24)
<400>2
aaggccttgtccccttcagctacc24
<210>3
<211>20
<212>DNA
<213>GAPDH upstream primer
<220>
<221>misc_feature
<222>(1)..(20)
<400>3
gctctctgctcctcctgttc20
<210>4
<211>20
<212>DNA
<213>GAPDH downstream primer
<220>
<221>misc_feature
<222>(1)..(20)
<400>4
gactccgaccttcaccttcc20
Claims (5)
1. the reagent detecting ALDH2 gene is for the preparation of the application detected in bladder transitional cell carcinoma reagent.
2. the reagent of detection ALDH2 gene according to claim 1 is for the preparation of the application detected in bladder transitional cell carcinoma reagent, it is characterized in that: ALDH2 gene is down-regulated expression in upper bladder transitional cell carcinoma.
3. the reagent of detection ALDH2 gene according to claim 1 and 2 is for the preparation of the application detected in bladder transitional cell carcinoma reagent, and it is characterized in that, in described detection, bladder transitional cell carcinoma comprises the steps:
(1), get bladder transitional cell carcinoma sample, extract the RNA of sample;
(2), to the RNA of sample carry out reverse transcription, obtain the cDNA of sample;
(3) the sample cDNA, with step (2) obtained, for template, with primer pair P for primer, carries out RT-PCR reaction, obtains the mrna expression amount of the ALDH2 gene of down-regulated expression; Wherein primer pair P is:
ALDH2 upstream primer: 5 '-CCAACCAGCAGCCCGAGGTC-3 ',
ALDH2 downstream primer: 5 '-AAGGCCTTGTCCCCTTCAGCTACC-3 '.
4. the reagent of detection ALDH2 gene according to claim 3 is for the preparation of the application detected in bladder transitional cell carcinoma reagent, and it is characterized in that, the condition of described RT-PCR is: 50 DEG C 2 minutes, 95 DEG C 2 minutes, 1 circulation; 95 DEG C 15 seconds, 55 DEG C 30 seconds, 72 DEG C 40 seconds, 40 circulations.
5. the reagent of detection ALDH2 gene according to claim 1 and 2 is for the preparation of the application detected in bladder transitional cell carcinoma reagent, it is characterized in that: in described detection, bladder transitional cell carcinoma carries out SABC mensuration to upper bladder transitional cell carcinoma sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310516711.XA CN103558383B (en) | 2013-10-28 | 2013-10-28 | The application of ALDH2 gene on detecting in bladder transitional cell carcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310516711.XA CN103558383B (en) | 2013-10-28 | 2013-10-28 | The application of ALDH2 gene on detecting in bladder transitional cell carcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103558383A CN103558383A (en) | 2014-02-05 |
| CN103558383B true CN103558383B (en) | 2015-11-18 |
Family
ID=50012689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310516711.XA Expired - Fee Related CN103558383B (en) | 2013-10-28 | 2013-10-28 | The application of ALDH2 gene on detecting in bladder transitional cell carcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103558383B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558395B (en) * | 2013-10-28 | 2015-08-26 | 深圳市第二人民医院 | The application of SMAD3 gene on detecting in bladder transitional cell carcinoma |
| CN115267187B (en) * | 2022-05-10 | 2023-07-14 | 吉林大学 | MCT1 positioning detection method and application thereof in urinary tract system cancer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103149369A (en) * | 2013-03-20 | 2013-06-12 | 江苏元化生命科技有限公司 | Protein chip for detecting esophageal squamous carcinoma marker and kit box of protein chip |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040231909A1 (en) * | 2003-01-15 | 2004-11-25 | Tai-Yang Luh | Motorized vehicle having forward and backward differential structure |
-
2013
- 2013-10-28 CN CN201310516711.XA patent/CN103558383B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103149369A (en) * | 2013-03-20 | 2013-06-12 | 江苏元化生命科技有限公司 | Protein chip for detecting esophageal squamous carcinoma marker and kit box of protein chip |
Non-Patent Citations (4)
| Title |
|---|
| 26 例上尿路上皮癌临床病理分析;李祖茂;《检验医学与临床》;20090731;第6卷(第14期);第1121-1122页 * |
| Prognostic impact of the expression of ALDH1 and SOX2 in urothelial cancer of the upper urinary tract;Hiroshi Kitamura,et al.;《Modern Pathology》;20120817;第26卷(第1期);第117-124页 * |
| 上尿路尿路上皮癌预后因素研究进展;桂惠明 等;《中华泌尿外科杂志》;20130331;第34卷(第3期);第232-234页 * |
| 荧光原位杂交技术尿脱落细胞检测在上尿路尿路上皮细胞癌诊断中的应用价值;胡宝利 等;《中华泌尿外科杂志》;20111031;第32卷(第10期);第659-661页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103558383A (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Circulating exosomal noncoding RNAs as prognostic biomarkers in human hepatocellular carcinoma | |
| Wang et al. | Development and prospective multicenter evaluation of the long noncoding RNA MALAT-1 as a diagnostic urinary biomarker for prostate cancer | |
| ES2735993T3 (en) | Methods to predict the clinical outcome of cancer | |
| Goodison et al. | Bladder cancer detection and monitoring: assessment of urine-and blood-based marker tests | |
| Tölle et al. | Identification of microRNAs in blood and urine as tumour markers for the detection of urinary bladder cancer | |
| Liu et al. | Circulating miR-15b and miR-130b in serum as potential markers for detecting hepatocellular carcinoma: a retrospective cohort study | |
| Rahbari et al. | Identification of differentially expressed microRNA in parathyroid tumors | |
| ES2925983T3 (en) | Method for using gene expression to determine prostate cancer prognosis | |
| KR101896545B1 (en) | Methods for predicting risk of recurrence of breast cancer patients | |
| Kurahashi et al. | Detection of micrometastases in pelvic lymph nodes in patients undergoing radical cystectomy for focally invasive bladder cancer by real-time reverse transcriptase-PCR for cytokeratin 19 and uroplakin II | |
| de Carvalho et al. | Accuracy of microRNAs as markers for the detection of neck lymph node metastases in patients with head and neck squamous cell carcinoma | |
| McNally et al. | Biomarkers that differentiate benign prostatic hyperplasia from prostate cancer: A literature review | |
| Ye et al. | Circulating tumor cells as a potential biomarker for postoperative clinical outcome in HBV-related hepatocellular carcinoma | |
| WO2013086522A1 (en) | Methods and compositions for sample identification | |
| Mahmoud et al. | Plasma circulating cell-free nuclear and mitochondrial DNA as potential biomarkers in the peripheral blood of breast cancer patients | |
| Loudig et al. | Illumina whole-genome complementary DNA–mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern–related genes in oral squamous cell carcinoma | |
| Li et al. | Expression patterns of microRNA-329 and its clinical performance in diagnosis and prognosis of breast cancer | |
| Chen et al. | Plasma miRNA profile is a biomarker associated with urothelial carcinoma in chronic hemodialysis patients | |
| CN103558383B (en) | The application of ALDH2 gene on detecting in bladder transitional cell carcinoma | |
| Miyake et al. | Significance of micrometastases in pelvic lymph nodes detected by real‐time reverse transcriptase polymerase chain reaction in patients with clinically localized prostate cancer undergoing radical prostatectomy after neoadjuvant hormonal therapy | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| CN103558382B (en) | The application of CCNE1 gene on detecting in bladder transitional cell carcinoma | |
| Chavarriaga et al. | miRNAs for testicular germ cell tumours: Contemporary indications for diagnosis, surveillance and follow‐up | |
| Zhao et al. | A circulating miR-19b-based model in diagnosis of human breast cancer | |
| WO2014171800A1 (en) | Automatic system for early predicting and diagnosing prognosis of breast cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151118 Termination date: 20201028 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |