CN103555725A - Sdf-i binding nucleic acids - Google Patents

Abstract

The present invention is related to a nucleic acid molecule, preferably binding to SDF-I, selected from the group comprising type A nucleic acid molecules, type B nucleic acid molecules, type C nucleic acid molecules and nucleic acid molecules having a nucleic acid sequence according to any of SEQ.ID.No. 142, SEQ.ID.No. 143 and SEQ.ID.No. 144.

Description

SDF-1 binding nucleic acids

Technical field

The present invention relates to the nucleic acid in conjunction with Gro-beta-T stromal cell derived factor-1 (SDF-1), and the purposes in medicine preparation and the purposes in diagnostic reagent preparation thereof.

Background technology

Chemokine is that the structure of a 8-14kDa is relevant, the family of the alkaline small protein matter of heparin-binding.Its function can be divided into proinflammatory function, homeostasis function or dual-use function (Moser, Wolf et al.2004).Inflammatory chemokine is subject to pathogenic agent, cytokine or growth factor-induced, and effect leukocyte recruitment is arrived to infection, inflammation, tissue injury and tumor locus.The raising of described chemokine regulation and control leukocyte cells (white corpuscle), activation and hyperplasia (Schall and Bacon 1994; Springer 1995; Baggiolini 1998).The chemotaxis of chemokine selective induction neutrophilic granulocyte, oxyphie, basophilic leukocyte, monocyte, scavenger cell, mastocyte, T cell and B cell.Except chemotactic effect, it also can selectivity bring into play other effects in responsive cell, as change cell shape, instantaneous rising intracellular calcium concentration, degranulation, raise integrin, form biological activity lipid (leukotriene, prostaglandin(PG), thromboxane), or respiratory burst (destroying pathogenic microorganism or tumour cell by discharging active oxygen).Therefore, chemokine is by exciting the release of other pro-inflammatory mediators and white corpuscle to infecting or the chemotactic of inflammation kitchen range and exosmose to cause the progressively upgrading of inflammatory response.And on the other hand, homeostasis chemokine (homeostatic chemokine) is mainly expressed in marrow and lymphoid tissue tissue, and participate in hemopoietic, immunological surveillance and adaptive immune response (Godessart 2005).

According to the arrangement mode of the first two in four conservative cysteine residues, chemokine is divided into four classes: CC or beta-chemokine (for example wherein said halfcystine series connection), CXC or α-chemokine (wherein said halfcystine is separated by an extra amino-acid residue), XC or γ chemokine (only thering is a disulphide bridges) (being unique representative of lymphocyte chemotactic factor (LCF)/XCL1 up to now) and CX3C-chemokine (take have 3 amino-acid residues between described halfcystine be feature) (member only, membrane-bound CXXXC chemokine (fractalkin)) (Bazan, Bacon et al.1997).

Gro-beta-T (the especially Gro-beta-T with aminoacid sequence ELR at its N-terminal) Main Function is in neutrophilic granulocyte.To the example of the activated Gro-beta-T of neutrophilic granulocyte tool, be IL-8/CXCL8, GRO α/CXCL1, GRO β/CXCL2 and GRO γ/CXCL3, NAP-2/CXCL7, ENA-78/CXCL5, SDF-1/CXCL12 and GCP-2/CXCL6.CC chemokine acts on a greater variety of white corpuscles, as monocyte, scavenger cell, oxyphie, basophilic leukocyte and T and bone-marrow-derived lymphocyte (Oppenheim, Zachariae et al.1991; Miller and Krangel 1992; Baggiolini, Dewald et al.1994; Jose, Griffiths-Johnson et al.1994; Ponath, Qin et al.1996).The example of described chemokine is I-309/CCL1, MCP-1/CCL2, MCP-2/CCL8, MCP-3/CCL7, MCP-4/CCL13, MIP-1 α/CCL3 and MIP-1 β/CCL4, RANTES/CCL5 and eotaxin/CCL11.

Chemokine is by belonging to seven-transmembrane g protein coupled receptor (GPCRs; The acceptor of (Murphy, Baggiolini et al.2000) superfamily works.Generally speaking, the interaction of chemokine and Chemokine Receptors is tending towards mixing, because chemokine can be in conjunction with many Chemokine Receptors, and conversely, single Chemokine Receptors also can interact with several chemokines.The acceptor of the Gro-beta-T that some are known comprises that CXCR1(is in conjunction with GRO α, GCP-2 and IL-8), CXCR2(is in conjunction with comprising GRO α, GRO β, GRO γ, ENA-78 and IL-8 are at interior chemokine), CXCR3(is in conjunction with comprising PF4, MIG, IP-10 and I-TAC are at interior chemokine), CXCR4(finds up to now unique response SDF-1 and produce the CC-chemokine receptor of signal) and CXCR5( found to respond BCA-1 and produced signal) (Godessart 2005).

SDF-1(CXCL12; Another name is CXCL12; PBSF[pre-B cell growth stimulating factor]; TPAR-1[TPA suppressor gene 1]; SCYB12; TLSF[thymic lymphocytes stimulating factor]; The people's autacoid (intercrine) reducing in hIRH[hepatoma]) be not comprise IL-8 sample chemokine distinctive ELR motif (Salcedo, the people such as Wasserman 1999; Salcedo and Oppenheim 2003), in conjunction with and the angiogenic growth Gro-beta-T of activated G protein-coupled receptor CXCR 4.San Ge research group, by based on stimulate the ability (Nagasawa of early stage ancestral B cell when described chemokine is expressed by stromal cell lines PA6, the people such as Kikutani 1994) clone is with the cDNA(Tashiro of N-terminal signal sequence, the people such as Tada 1993), or pass through from the separated described chemokine (Jiang of cDNA library (cDNA library building from the mouse embryo fibroblasts of processing with protein kinase C activator dotetracontane acyl crotyl alcohol acetic ester (TPA)), the people such as Zhou 1994), found independently of one another described chemokine.

As the result of alternative splicing, there is the SDF-1 with 4 extra residues at C-terminal of two kinds of forms, SDF-1 α (68 amino acid) and SDF-1 β (Shirozu, the people such as Nakano 1995).Still imperfectly understand the biological significance of these two kinds of splice variants.

From the sequence conservation between the SDF-1 of different plant species, be significant: people SDF-1 α (SEQ.ID.1) and mouse SDF-1 α (SEQ.ID.2) are practically identical.Only there is the single conservative change (Shirozu, Nakano et al.1995) to I by V of the 18th amino acids.Distinguishing SDF-1 is its selectivity with another rare feature of other chemokines of great majority.In fact, SDF-1 and its receptor CXCR 4 seem to comprise and singly join receptor-ligand pair.

There is SDF-1[8-68] NMR structural models (PDB access, 1SDF).Find that SDF-1 is the monomer with unordered N-terminal region.Be mainly seen in the parcel of hydrophobic core and surface charge distribute (Crump, Gong et al.1997) with the difference of other chemokines.

The physiologically active of SDF-1: because SDF-1 receptor CXCR 4 wide expression in white corpuscle, mature endothelial cell, endotheliocyte, brain cell and megalokaryocyte, so the activity of SDF-1 is multiple-effect.Described chemokine is compared any other chemokine of having identified so far, especially, outside immunity system, shows biological function the most widely.The most important functional effect of SDF-1 is:

Epithelial cell is resetted (homing) and be attached to amphiblestroid choroid new vessel site partly and shown that SDF-1 participates in epithelial cell to reset to choroid in the new vessel forming process of ocular tissue.To the definite effect of described cell, still in conceptual phase, but there is hypothesis to think that epithelial cell participates in superstition vascularization (Sengupta, Caballero et al.2005).

Hemoposieis

In Adult Human Bone Marrow, need to have SDF-1 to maintain hemopoietic progenitor cell (CD34+).Can be by AMD3100(selectivity CXCR4 antagonist) for the CD34+ cell of hematopoietic stem cell transplantation, mobilize.CD34+ cell is in vitro and in vivo along the SDF-1 gradient migration (Aiuti, Webb et al.1997) being produced by stroma cell.

B cell development and chemotactic

SDF-1 supports pre B cell hyperplasia, and promotes marrow ancestral's B Growth of Cells (Nagasawa, Kikutani et al.1994); It is not in the situation that induce the specific transfer of pre B cell and ancestral B cell (pro-B cell), (D ' Apuzzo, Rolink et al.1997 as effective chemoattractant of mature B cell; Bleul, Schultze et al.1998).Infer that SDF-1 is playing a significant role B cellular localization in secondary adenoid process.

T cell chemotaxis

SDF-1 is one of the most effective T cell chemotaxis agent; CXCR4 is present in (Bleul, Farzan et al.1996) on multiple T cell subsets.

Fetal development

SDF-1 and receptor CXCR 4 thereof are essential in embryo development procedure.The mouse that knocks out SDF-1 and CXCR4 gene will die from perinatal period; Except occurring, B cell and the minimizing of marrow group cell count, also to show ventricular septal heart defect or abnormal cerebellum development (Nagasawa, Hirota et al.1996; Ma, Jones et al.1998; Zou, Kottmann et al.1998).In the normal individual generating process that the blood of embryo between the emergence period is grown, also need SDF-1(Juarez and Bendall 2004).

HIV infects

SDF-1 can suppressor T cell preferendum HIV-1 enter the clone with CXCR4, and the expression of SDF-1 can play a significant role in auxiliary AIDS falls ill, because being the morbidity (Bleul, Farzan et al.1996) that the polymorphism of people SDF-1 gene affects AIDS.

The expression level of SDF-1 or its receptor CXCR 4 changes or replying of described molecule is changed relevant to many human diseasess, and described human diseases is retinopathy (Brooks, Caballero et al.2004 for example; Butler, Guthrie et al.2005; Meleth, Agron et al.2005); Mammary cancer (Muller, Homey et al.2001; Cabioglu, Sahin et al.2005), ovarian cancer (Scotton, Wilson et al.2002), carcinoma of the pancreas (Koshiba, Hosotani et al.2000), thyroid carcinoma (Hwang, Chung et al.2003), nasopharyngeal carcinoma (Wang, Wu et al.2005); Neurospongioma (Zhou, Larsen et al.2002); Neuroblastoma (Geminder, Sagi-Assif et al.2001); B Cell Chronic Lymphocytic Leukemia (Burger, Tsukada et al.2000); WHIM syndrome (wart, hypogammag lobulinemia, infection, Myelokathexis) (Gulino, Moratto et al.2004; Balabanian, Lagane et al.2005; Kawai, Choi et al.2005); Immunodeficiency syndrome (Arya, Ginsberg et al.1999; Marechal, Arenzana-Seisdedos et al.1999; Soriano, Martinez et al.2002); Angiogenesis (Salvucci, Yao et al.2002; Yamaguchi, Kusano et al.2003; Grunewald, Avraham et al.2006); (Murdoch 2000 for inflammation; Fedyk, Jones et al.2001; Wang, Guan et al.2001); Multiple sclerosis (Krumbholz, Theil et al.2006); Rheumatoid arthritis/osteoarthritis (Buckley, Amft et al.2000; Kanbe, Takagishi et al.2002; Grassi, Cristino et al.2004).

In laboratory animal, prove, the antagonist of SDF-1 or its acceptor can effectively be blocked growth and/or the transfer diffusion of the human cancer cell of different sources, and the human cancer cell of described different sources for example derives from pancreas (Guleng, Tateishi et al.2005; Saur, Seidler et al.2005), colon (Zeelenberg, Ruuls-Van Stalle et al.2003; Guleng, Tateishi et al.2005), mammary gland (Muller, Homey et al.2001; Lapteva, Yang et al.2005), lung (Phillips, Burdick et al.2003), glioblastoma/myeloblastoma (Rubin, Kung et al.2003), prostate gland (Sun, Schneider et al.2005), osteosarcoma (Perissinotto, Cavalloni et al.2005), melanoma (Takenaga, Tamamura et al.2004), stomach (Yasumoto, Koizumi et al.2006), the human cancer cell of multiple myeloma (Menu, Asosingh et al.2006).

In addition, the retinal neovascularization of anti-SDF-1 therapy in animal model forms (Butler, Guthrie et al.2005), ephritis (Balabanian, Couderc et al.2003) and sacroiliitis (Matthys, Hatse et al.2001; Tamamura, Fujisawa et al.2004; De Klerck, Geboes et al.2005) in prevention, bring into play beneficial effect.

SDF-1 participates in an eye rear portion disease (back-of-the-eye disease) (diabetic retinopathy (DR) (Fong for example, Aiello et al.2004) and age-related macular degeneration (AMD) (Ambati, Anand et al.2003)) pathologic process.These two kinds of diseases are all damaged eyes, and cause eyesight to fail gradually to blind.Described damage is by due to the improper angiogenic growth (this process is called as choroidal neovascularization and forms (CNV)) at eye rear portion.In CNV process, come from choroidal neovascularity and enter pigment epithelium under retina (sub-RPE) or subretinal space by the breaking part migration in Bruch's membrane (Bruch membrane).Described abnormal vascular can be at subretinal hemorrhage (inter-retinal hemorrhage) or seepage liquid.This can leave scar, and can make spot increase, thus distortion vision.

SDF-1 is considered in CNV to play a role by endothelial precursor cell (EPC) being raised to eye.Then these precursor cells can become crucial structural constituent in superstition blood vessel.

Diabetic retinopathy is the main sequela of diabetes, suffers from the patient of 1 type and diabetes B fall ill through being everlasting.The U.S. 1,000 6 hundred ten thousand diabetic subjects that have an appointment, nearly 800 ten thousand diabetic retinopathies of suffering from some forms wherein.If do not treat Accretive Type diabetic retinopathy (PDR), approximately 60% patient can be in 5 years simple eye or blindness.Along with diabetes in North America, Europe and many emerging nations troubling more prevalent, patient colony is rapid growth also.For example, in diabetic subject, blind incidence is higher 25 times than general population.In addition, diabetic retinopathy (DR) is the modal blind cause of disease in middle aged experimenter, accounts for every year all new cases' of the U.S. at least 12%.Can monitor diabetic subject's eyesight by preparation screening procedure, thereby can provide in time as obtainable treatment.

Immediate cause to diabetic retinopathy is still known little about it, but this disease by people by due to the combination of following a plurality of origin causes of formation: retinal blood flow inherent regulation is impaired; In retina cell, sorbyl alcohol is accumulated with the middle-and-high-ranking AGEP of extracellular fluid and is accumulated.All of these factors taken together is directly or indirectly relevant to the sugared abundance in hyperglycemia, blood flow.

DR symptom is similar to AMD symptom.Patient loses retina cell, and microaneurysm (blood flow) occurs in retina basilar membrane.In addition, VEGF, IGF-1 and other blood factors (may comprise SDF-1) attract neovascularity cell, and promote to damage the formation of blood vessel.

Age-related macular degeneration (AMD) destroys people's central vision.The early symptom of disease is not obvious, because symptom is different with patient.Sometimes patient's simple eye being affected only.Or binocular vision all goes down, but not remarkable.Disease causes colour vision distortion or makes mistakes.In visual field central authorities, often there is blackspot.

The pathogeny of described disease (pathogenic process) is still known little about it.It has been generally acknowledged that AMD is that retina is outermost aging.In its retina part relying on for the sharpest vision of retinal centre generation physiological change (being also referred to as spot).

Moist AMD starts from the sequela of the dryness form of described disease.Approximately 90% patient suffers from dryness AMD, and it causes spot to organize attenuation and pigment deposition disorder.All the other suffer from described moist form, comprise above-mentioned hemorrhage.

Described moist AMD is representing the desirable market of new therapeutic agent: be the blind common cause of 55 years old above people, AMD make the American population in 65-74 year of 4%-5% according to estimates and nearly 10% 75 years old or more old man group suffer misery.The Jin U.S. just has 500 ten thousand and suffers from 80 years old above people of described disease, and affected by it before also having other 5 million peoples to be expected at the year two thousand twenty.

Tumour is not only cancer cells aggregation block: it is the feature of cancer that tumour is infiltrated by immunocyte.Many human cancers have the degree of the described infiltration of impact and the complicated chemokine network of phenotype and tumor growth, survival and migration and blood vessel generation.Most of solid tumors comprise many non-malignant stroma cells.In fact, stroma cell is more than cancer cells sometimes.The dominant stroma cell of finding in cancer is scavenger cell, lymphocyte, endotheliocyte and inoblast.

Malignant cell from various cancers type has different chemokine receptor expression spectrums, but described SDF-1 receptor CXCR 4 is most commonly in mouse and people: the tumor cells expression CXCR4(Balkwill 2004 of the cancer of originating from least 23 dissimilar people's epitheliums, mesenchymal cell and hematopoiesis).SDF-1 is unique known ligand of CXCR4.SDF-1 is except constitutive expression in marrow and secondary Lymphoid tissue, and it is also shown in the cerebral tumor of lymphadenomatous primary tumor (Corcione, Ottonello et al.2000) and neurone and stellate cell system.In addition, it is present in ovary (Scotton with high level, Wilson et al.2002) and carcinoma of the pancreas (Koshiba, Hosotani et al.2000) in and be present in mammary cancer (Muller, Homey et al.2001) and thyroid carcinoma (Hwang, Chung et al.2003), in the metastasis of neuroblastoma and haematological malignancies (Geminder, Sagi-Assif et al.2001).On the contrary, the very low or nothing of the expression level of CXCR4 in normal breast (Muller, Homey et al.2001), ovary (Scotton, Wilson et al.2002) and prostatic epithelium (Sun, Schneider et al.2005).Therefore, the expression of CXCR4 Malignant Epithelium cell but not its normal phase is answered the general feature of cell seemingly.

The transduction of chemokine on inhibition tumor cell-receptor signal has the potential that induced growth stagnation in vivo or apoptosis and prevention are invaded and shifted:

The CXCR4 producing by siRNA weakens the growth (Lapteva, Yang et al.2005) that (knockdown) ended breast tumor; To the T hybridoma that stops the construct transfection of CXCR4 surface expression for mouse mainline, can make it no longer migrate to organ (Zeelenberg, Ruuls-Van Stalle et al.2001) at a distance; In using the similar experiment of colorectal cancer cell, lung and hepatic metastases (Zeelenberg, Ruuls-Van Stalle et al.2003) have been greatly reduced; Anti-CXCR4 antibody suppression mammary cancer heterograft is diffused into lymphatic node (Muller, Homey et al.2001); Use anti-CXCR4 or anti-SDF-1 antibody treatment lymphoid stem cells to postpone the tumor growth (Bertolini, Dell ' Agnola et al.2002) in (NOD)/SCID mouse; The generation (Phillips, Burdick et al.2003) that anti-SDF-1 antibody suppression nonsmall-cell lung cancer (NSCLC) cell organelle shifts; CXCR4 antagonist AMD3100(AnorMED) systemic administration has suppressed the growth of encephalic glioblastoma and myeloblastoma heterograft in 24 hours, and has increased apoptosis of tumor cells (Rubin, Kung et al.2003); Anti-SDF-1 antibody suppression with the growth (Orimo, Gupta et al.2005) of the MCF-7 breast cancer cell of cancer associated fibroblast cytomixis; Use in antibody and blocked prostate cancer transfer and bone kitchen range growth (growth in osseous sites) (Sun, Schneider et al.2005) with CXCR4; By administration for peptides CXCR4 antagonist T134, stoped the generation (Perissinotto, Cavalloni et al.2005) that lung shifts after injection osteosarcoma cell.

Different literature authors all propose, and target SDF-1/CXCR4 axle can provide new treatment to select to cancer patients:

Human ovarian tumor strong expression SDF-1, and with lower level VEGF expression.Two kinds of albumen are triggered by the hypoxemia in tumour.Wherein arbitrary protein of pathological concentration is all not enough to blood vessel in independent inductor and occurs, if but combine, the SDF-1 of pathological concentration and VEGF can be effectively and the formation of co-induction new vessel.Therefore, block described collaborative axle, but not only for VEGF, can be the effective angiogenesis inhibitor New Policy (Kryczek, Lange et al.2005) for the treatment of cancer;

When having autocrine SDF-1/CXCR4 signal transduction pathway, breast cancer cell line just shows aggressive behaviour.This comprises follows invasion and attack and the migration of accelerating growth.Therefore, can obtain the described aggressive important information of prediction from described SDF-1/CXCR4 axle, also can be used as the important target (Kang, Watkins et al.2005) for the treatment of human breast carcinoma;

Migration and the transfer of expressing small cell lung cancer (SCLC) cell of high-caliber CXCR4 are regulated and controled by SDF-1.The activation of CXCR4 promotes for example, adhering to the helper in tumor microenvironment (stroma cell) and extracellular matrix molecules.These adhesions interact and cause SCLC cell to increase chemotherapeutic resistance.Like this, the inhibitor of described SDF-1/CXCR4 axle can increase the chemosensitivity of SCLC cell, and new treatment approach (Hartmann, Burger et al.2004) is provided to the patient who suffers from SCLC;

Described SDF-1/CXCR4 axle has been considered to transport in vivo the key adjusting path of dissimilar stem cell.Because great majority (if not all) malignant tumour comes from stem/progenitor cells region, cancer stem cell is also at its surface expression CXCR4, thereby described SDF-1/CXCR4 axle participates in them to instruct and transport/be transferred to the organ (for example lymphoglandula, lung, liver, bone) of expressing SDF-1.Therefore, the strategy for regulation and control SDF-1/CXCR4 axle can have important clinical application (Kucia, Reca et al.2005) in the regenerating medicine that normal stem cell is delivered to tissue and in the Clinical Oncology of the transfer of inhibition cancer stem cell.

Summary of the invention

The present invention aims to provide the specificity knot anti-agent for SDF-1.The present invention aims to provide to be on the other hand used for the treatment of and involves respectively SDF-1 and the disease of CXCR4 acceptor and the compound of illness.

The present invention aims to provide the method for specific detection SDF-1 on the other hand.

Theme by independent claim has solved problem involved in the present invention.Preferred embodiment is desirable from dependent claims.

First aspect, the present invention has solved problem involved in the present invention by nucleic acid molecule, described nucleic acid molecule preferred combination SDF-1, be selected from A type nucleic acid molecule, Type B nucleic acid molecule, C type nucleic acid molecule, and nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.142, SEQ.ID.No.143 and SEQ.ID.No.144.

In one embodiment, described A type nucleic acid molecule comprises following core nucleotide sequence:

5’AAAGYRACAHGUMAAX _AUGAAAGGUARC?3’（SEQ.ID.19）

X wherein _adisappearance or be A.

In a preferred embodiment, described A type nucleic acid molecule comprises and is selected from following core nucleotide sequence:

5’AAAGYRACAHGUMAAUGAAAGGUARC?3’（SEQ.ID.No.20）、

5 ' AAAGYRACAHGUMAAAUGAAAGGUARC 3 ' (SEQ.ID.No.21) and

5 ' AAAGYAACAHGUCAAUGAAAGGUARC 3 ' (SEQ.ID.No.22), described core nucleotide sequence preferably comprises 5 ' AAAGYAACAHGUCAAUGAAAGGUARC 3 ' (SEQ.ID.No.22).

In one embodiment, described nucleic acid molecule comprises first Nucleotide section, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

In one embodiment, described nucleic acid molecule comprises the second nucleotide fragments, described nucleic acid nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

In a preferred embodiment, described nucleic acid molecule comprises described the first and second nucleotide fragments, and the optional phase mutual cross of described the first and second nucleotide fragments, wherein after hybridization, forms duplex structure.

At one again in preferred embodiment, described duplex structure is by 4-6 base pair, preferably 5 base pairs formations.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁x ₂nNBV 3 ' (SEQ.ID.No.44), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BNBNX ₃x ₄3 ' (SEQ.ID.No.45),

X wherein ₁disappearance or be R, X ₂for S, X ₃for S and X ₄disappearance or be Y;

Or

X ₁disappearance, X ₂disappearance or be S, X ₃disappearance or be S and X ₄disappearance.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' RSHRYR 3 ' (SEQ.ID.No.23), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YRYDSY 3 ' (SEQ.ID.No.24),

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCUGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCAGC 3 '.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₂bBBS 3 ' (SEQ.ID.No.42), and described the second nucleotide fragments comprises nucleotide sequence 5 ' SBBVX ₃3 ' (SEQ.ID.No.43),

X wherein ₂disappearance or be S, and X ₃disappearance or be S;

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' CUGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCAG 3 ';

Or described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCGC 3 '.

In one embodiment, described nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.5-18,25-41,133,137,139-141.

In one embodiment, described Type B nucleic acid molecule comprises following core nucleotide sequence:

5’GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG3’（SEQ.ID.No.57）。

In a preferred embodiment, described Type B nucleic acid molecule comprises core nucleotide sequence GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGG(SEQ.ID.No.58):

In one embodiment, described nucleic acid molecule comprises the first nucleotide fragments, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

In one embodiment, described nucleic acid molecule comprises the second nucleotide fragments, described core nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

In a preferred embodiment, described nucleic acid molecule comprises described the first and second nucleotide fragments, and the optional phase mutual cross of described the first and second nucleotide fragments wherein forms duplex structure after hybridization.

In one embodiment, described duplex structure is by 4-6 base pair, and preferably 5 base pairs form.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁x ₂sVNS 3 ' (SEQ.ID.No.77), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BVBSX ₃x ₄3 ' (SEQ.ID.No.78), wherein

X ₁disappearance or be A, X ₂g, X ₃c and X ₄disappearance or be U;

Or

X ₁disappearance, X ₂disappearance or be G, X ₃disappearance or be C and X ₄disappearance.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁gCRWG 3 ' (SEQ.ID.No.59), and described the second nucleotide fragments comprises nucleotide sequence 5 ' KRYSCX ₄3 ' (SEQ.ID.No.60),

X wherein ₁disappearance or be A, and X ₄disappearance or be U.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁gCGUG 3 ' (SEQ.ID.No.75), and described the second nucleotide fragments comprises nucleotide sequence 5 ' UACGCX ₄3 ' (SEQ.ID.No.76),

X wherein ₁disappearance or be A, and X ₄disappearance or be U,

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' AGCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' UACGCU 3 '.

In a preferred embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X ₂sSBS 3 ' (SEQ.ID.No.73), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BVSSX ₃3 ' (SEQ.ID.No.74),

X wherein ₂disappearance or be G, and X ₃disappearance or be C,

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' UACGC 3 '.

In one embodiment, described nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.46-56,61-72 and 132.

In one embodiment, described C type nucleic acid molecule comprises core nucleotide sequence GGUYAGGGCUHRX _aaGUCGG(SEQ.ID.No.90),

X wherein _adisappearance or be A.

In a preferred embodiment, described C type nucleic acid molecule comprises the core nucleotide sequence that is selected from following sequence:

5’GGUYAGGGCUHRAAGUCGG?3’（SEQ.ID.No.91）、

5 ' GGUYAGGGCUHRAGUCGG 3 ' (SEQ.ID.No.92) and

5 ' GGUUAGGGCUHGAAGUCGG 3 ' (SEQ.ID.No.93), described core nucleotide sequence preferably comprises 5 ' GGUUAGGGCUHGAAGUCGG 3 ' (SEQ.ID.No.93).

In one embodiment, described nucleic acid molecule comprises the first nucleotide fragments, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

In one embodiment, described nucleic acid molecule comprises the second nucleotide fragments, described core nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

In a preferred embodiment, described nucleic acid molecule comprises described the first and second nucleotide fragments, the optional phase mutual cross of at least a portion of at least a portion of wherein said the first nucleotide fragments and described the second nucleotide fragments wherein forms duplex structure after hybridization.

In one embodiment, the length of the length of described the first nucleotide fragments and described the second fragment is respectively 0-17 Nucleotide separately, preferred 4-10 Nucleotide, and more preferably 4-6 Nucleotide.

In one embodiment, described duplex structure comprises 4-10 base pair, preferably 4-6 base pair, more preferably 5 base pairs.

In a preferred embodiment, described duplex structure comprises 4-10 base pair continuously, preferably 4-6 continuous base pair, more preferably 5 continuous base pairs.

In a preferred embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' RKSBUSNVGR3 ' (SEQ.ID.No.120), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YYNRCASSMY 3 ' (SEQ.ID.No.121),

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' RKSBUGSVGR 3 ' (SEQ.ID.No.122), and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' YCNRCASSMY 3 ' (SEQ.ID.No.123).

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' X _ssSSV 3 ' (SEQ.ID.No.124), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BSSSX _s3 ' (SEQ.ID.No.125), wherein X _sdisappearance or be S.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' SSSSR 3 ' (SEQ.ID.No.130), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YSBSS 3 ' (SEQ.ID.No.131),

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' SGGSR 3 ' (SEQ.ID.No.126), and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' YSCCS 3 ' (SEQ.ID.No.127).

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' GCSGG 3 ' (SEQ.ID.No.128), and described the second nucleotide fragments comprises nucleotide sequence 5 ' CCKGC 3 ' (SEQ.ID.No.129),

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCCGG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CCGGC 3 '.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' CGUGCGCUUGAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUCACG 3 '.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' UGAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUCA 3 '.

In one embodiment, described the first nucleotide fragments comprises nucleotide sequence 5 ' GAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUC 3 '.

In one embodiment, described nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.79-89,94-119 and 134-136.

In one embodiment, described nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.142-144.

In one embodiment, described nucleic acid molecule is the antagonist for SDF-1.

In one embodiment, described nucleic acid molecule is the antagonist of SDF-1 receptor system, and the described SDF-1 acceptor of described SDF-1 receptor system is CXCR4 acceptor preferably.

In one embodiment, described SDF-1 is that people SDF-1 and/or described SDF-1 acceptor are people SDF-1 acceptors.

In one embodiment, described SDF-1 comprises aminoacid sequence shown in SEQ ID No.1.

In one embodiment, described nucleic acid comprises modifier.

In a preferred embodiment, described modifier is selected from HES part and peg moiety.

At one, again in preferred embodiment, described modifier is the peg moiety consisting of straight or branched PEG, and the molecular weight of wherein said peg moiety is about 2-180kD preferably, more preferably from about 60-140kD and most preferably from about 40kD.

In one embodiment, described modifier is HES part, and the molecular weight of wherein said HES part is about 10-130kD preferably, more preferably from about 30-130kD and most preferably from about 100kD.

In one embodiment, the Nucleotide of described nucleic acid is L-Nucleotide, preferably the Nucleotide of arbitrary sequence shown in SEQ.ID.No.19,20,21,22,57,58,90,91,92 and 93.

Second aspect, the present invention has solved problem involved in the present invention by the nucleic acid that comprises first aspect with the pharmaceutical composition of optional other components, and wherein said other components are selected from the acceptable vehicle of pharmacy and pharmaceutically active agents.

The third aspect, the purposes of the nucleic acid of the present invention by first aspect in medicine preparation solved problem involved in the present invention.

In an embodiment of the third aspect, described medicine is used to treat and/or prevent disease or illness, wherein said disease or illness are mediated by SDF-1, and described disease or illness are preferably selected from a rear portion disease, as diabetic retinopathy and age-related macular degeneration; Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Rheumatoid arthritis/osteoarthritis and ephritis.

In an embodiment of the third aspect, described medicine is used to suppress blood vessel generation, new vessel formation, inflammation and transfer.

Fourth aspect, the purposes of the nucleic acid of the present invention by first aspect in diagnostic tool preparation solved problem involved in the present invention.

In an embodiment of fourth aspect, described diagnostic tool is used to diagnose the illness, and wherein said disease is selected from a rear portion disease, as diabetic retinopathy and age-related macular degeneration; Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Rheumatoid arthritis/osteoarthritis and ephritis.

In an embodiment of fourth aspect, described diagnostic tool is used to diagnose blood vessel generation, new vessel formation, inflammation and/or transfer.

The 5th aspect, the mixture of the nucleic acid of the present invention by comprising SDF-1 and first aspect has solved problem involved in the present invention, and wherein said mixture is crystalline complex preferably.

The 6th aspect, the purposes of the nucleic acid of the present invention by first aspect in SDF-1 detects solved problem involved in the present invention.

The 7th aspect, this has by having solved problem involved in the present invention for screening the method for SDF-1 antagonist or SDF-1 agonist, and described method comprises the following steps:

-candidate SDF-1 antagonist and/or candidate SDF-1 agonist be provided,

-nucleic acid of first aspect is provided,

-detection system that signal is provided in the situation that SDF-1 antagonist and/or SDF-1 agonist exist is provided, and

-determine whether described candidate SDF-1 antagonist is whether SDF-1 antagonist and/or described candidate SDF-1 agonist are SDF-1 agonists.

Eight aspect, the present invention has solved problem involved in the present invention by the method for screening SDF-1 agonist and/or SDF-1 antagonist, and described method comprises the following steps:

-SDF-1 that is fixed on phase is provided, described preferred solid phase mutually,

-nucleic acid of first aspect is provided, the nucleic acid of the first aspect being preferably labeled,

-add candidate SDF-1 agonist and/or candidate SDF-1 antagonist, and

-determine whether described candidate SDF-1 agonist is whether SDF-1 agonist and/or described candidate SDF-1 antagonist are SDF-1 antagonists.

In an embodiment of eight aspect, carry out described definite to estimate whether described nucleic acid substitutes by described candidate SDF-1 agonist or by candidate SDF-1 antagonist.

The 9th aspect, the present invention has solved problem involved in the present invention by the test kit of the nucleic acid that comprises first aspect for detection of SDF-1.

The tenth aspect, the present invention has solved problem involved in the present invention by the SDF-1 antagonist that can obtain by the method for the 7th aspect or eight aspect.

The present invention is based on surprising discovery, likely prepare specific binding SDF-1 and there is the nucleic acid of high-affinity with it.

SDF-1 is the basic peptide with the aminoacid sequence of SEQ.ID.No.1.The pI of the SDF-1 calculating is 9.70.Term SDF-1 used herein refers to any SDF-1, includes but not limited to Mammals SDF-1.Described Mammals SDF-1 is preferably selected from mouse, rat, rabbit, hamster, monkey and people SDF-1.Described SDF-1 is most preferably people SDF-1(SEQ.ID.1).

Discovery can identify high-affinity SDF-1 binding nucleic acids to be surprising, because the people such as Eaton are (Eaton, Gold et al.1997) observe conventionally extremely difficult preparation for fit (aptamer) (being the D-nucleic acid of binding target molecule) of basic protein, because this type of target can produce high but nonspecific signal to noise ratio.Described high s/n ratio by nucleic acid, shown to due to the non-specific avidity of height of alkaline target (as SDF-1).

Can use the feature that realizes described nucleic acid aspect nucleic acid of the present invention of the present invention any, wherein can be separately or arbitrary combination use described nucleic acid.

Be not intended to be bound by any theory, contriver supposes that viewed nucleic acid of the present invention is in conjunction with more total constitutional featuress of specificity of SDF-1, and specifically refer to be called as one of nucleotide sequence of core sequence (will discuss in more detail hereinafter), please refer to Fig. 1-8 and embodiment 1.But need know, these figure and embodiment 1 comprise several described constitutional featuress that needn't realize in each and arbitrary nucleic acid of the present invention.

As being described in further detail in claims and embodiment 1, can based on described frame and some constitutional featuress and element, to various people SDF-1 binding nucleic acids molecules, classify respectively.To be "～type " as stated the various types of another name of definition herein, and be more specifically called A type, Type B and C type.

In a preferred embodiment, nucleic acid of the present invention is single core acid molecule.In another embodiment, shown in single core acid molecule with the form of many single core acid molecules, exist.Except as otherwise noted, term " nucleic acid " and " nucleic acid molecule " is herein used interchangeably.

Those skilled in the art will generally acknowledge: nucleic acid molecule of the present invention preferably consists of the Nucleotide of covalently bound (preferably connect by phosphodiester or key connects) mutually.

Nucleic acid of the present invention also should comprise the nucleic acid with the basic homology of particular sequence of the present invention.Term " basic homology " should be interpreted as, homology at least 75%, preferably 85%, more preferably 90%, and be most preferably greater than 95%, 96%, 97%, 98% or 99%.

The actual percentage that is present in the same exogenous nucleotide in nucleic acid of the present invention will depend on the Nucleotide sum being present in described nucleic acid.Modify the Nucleotide sum that per-cent can be based on being present in described nucleic acid.

Can measure described homology according to mode well known by persons skilled in the art.Described method is more specifically sequence comparison algorithm, then the sequence identity per-cent with respect to reference sequence based on designated program calculation of parameter sequence to be measured.Described sequence preference to be measured be described should with another nucleic acid molecule homology or to be measured whether with sequence or the nucleic acid molecule of another nucleic acid molecule homology (and if, with which kind of degree homology), wherein also described another nucleic acid molecule is called to reference sequence.In one embodiment, described reference sequence is nucleic acid molecule described herein, more preferably has the nucleic acid molecule of arbitrary sequence shown in SEQ.ID.No.5-144.Can carry out for optimal sequence comparison relatively according to following method, described method is for example: local homology's algorithm of Smith & Waterman (Smith & Waterman, 1981), the sequence analysis algorithm of Needleman & Wunsch (Needleman & Wunsch, 1970), the similarity searching method of Pearson & Lipman (Pearson & Lipman, 1988), (the GAP in Wisconsin Genetics Software Package is implemented in the computerize of these algorithms, BESTFIT, FASTA and TFASTA, Genetics Computer Group, 575 Science Dr., Madison, Wis.) or visual inspection.

An example that is suitable for measuring the algorithm of sequence identity per-cent is at basic Local Alignment research tool (basic local alignment search tool, hereinafter referred to as " BLAST ") the middle algorithm using, referring to such as the people such as Altschul (Altschul et al.1990 and Altschul et al, 1997).For carrying out open acquisition of software Ke U.S. biotechnology information center (National Center for Biotechnology Information) (hereinafter referred to as " NCBI ") of BLAST analysis.The people such as McGinnis have described and have used software (for example BLASTN(is for nucleotide sequence) and the BLASTP(that can obtain from NCBI be used for aminoacid sequence)) carry out the default parameters (McGinnis et al, 2004) that sequence identity mensuration adopts.

Term " nucleic acid of the present invention " also should comprise those nucleic acid that comprise nucleotide sequence disclosed herein or its part, and extremely described nucleic acid or described part preferably participate in conjunction with SDF-1.Can for example by reducing nucleic acid disclosed herein, produce described nucleic acid.Can reduce arbitrary end or two ends of nucleic acid disclosed herein.Also can reduce inner core nucleotide sequence, reduce the Nucleotide between 5 ' and 3 ' terminal nucleotide.In addition, reduce and also should comprise the Nucleotide that is as short as of deleting in nucleotide sequence disclosed herein.Also can reduce a not only nucleic acid fragment of the present invention, it is only that a Nucleotide is long that wherein said fragment can be as short as.Those skilled in the art can be by normal experiment or by using or adopt method as herein described (method of preferably partly describing at this paper embodiment) to measure the combination of nucleic acid of the present invention.

Nucleic acid of the present invention can be D-nucleic acid or L-nucleic acid.Nucleic acid of the present invention is L-nucleic acid preferably.In addition, may be also that one or several part of described nucleic acid is that at least one or several parts of D-nucleic acid or described nucleic acid are L-nucleic acid.Described in term, " part " of nucleic acid should refer to be as short as a Nucleotide.Conventionally described nucleic acid is called to D-nucleic acid and L-nucleic acid herein.Therefore, in an especially preferred embodiment, nucleic acid of the present invention consists of L-Nucleotide, and comprises at least one D-Nucleotide.Described D-Nucleotide is preferably attached to and is different from the part that defines nucleic acid fragment of the present invention, preferably with those parts of the interactional described nucleic acid of other parts of described nucleic acid.Described D-Nucleotide is preferably attached to respectively any fragment end of the present invention and any nucleic acid end.In preferred embodiment again, described D-Nucleotide can be used as spacer or connector, preferably modifier (as PEG and HES) is attached to nucleic acid of the present invention.

State feature also within the scope of the invention, each is all limited to specific nucleotide sequence with arbitrary nucleic acid molecule described herein (with its integral body (representing with its nucleotide sequence)).In other words, the term in described embodiment " should be comprised " be interpreted as " containing " or " by ... form ".

State feature also within the scope of the invention, nucleic acid of the present invention is the part compared with longer nucleic acid, wherein saidly compared with longer nucleic acid, comprises several parts, and wherein described at least one, part is nucleic acid of the present invention or its part.Described other parts compared with longer nucleic acid can be one or several D-nucleic acid or L-nucleic acid.The present invention can use arbitrary combination.Compared with described other parts of longer nucleic acid, can show the function being different from conjunction with (preferred combination SDF-1).A kind of possible function is to allow to interact from other molecules (wherein said other molecules are preferably different with SDF-1), for example, and for fixing, be cross-linked, detect or amplification.In another embodiment of the invention, nucleic acid of the present invention comprises several nucleic acid of the present invention alone or in combination.The described nucleic acid that comprises several nucleic acid of the present invention also contained in term " compared with longer nucleic acid ".

L-nucleic acid used herein is the nucleic acid consisting of L-Nucleotide, the nucleic acid preferably consisting of L-Nucleotide completely.

D-nucleic acid used herein is the nucleic acid consisting of D-Nucleotide, the nucleic acid preferably consisting of D-Nucleotide completely.

Except as otherwise noted, term " nucleic acid " and " nucleic acid molecule " are used interchangeably in this article.

Except as otherwise noted, all nucleotide sequences are herein also all with 5 ' → 3 ' direction indication.

No matter nucleic acid of the present invention is formed, L-Nucleotide, is consisted of or (described combination is random combine for example by both combination by D-Nucleotide, or the particular sequence of the fragment consisting of at least one L-Nucleotide and at least one D-nucleic acid) form, described nucleic acid can be constituted by deoxyribonucleotide, ribonucleotide or its.

Nucleic acid of the present invention is designed to L-nucleic acid and there is plurality of advantages.L-nucleic acid is the enantiomorph of natural acid.But due to the extensive existence of nuclease, D-nucleic acid in the aqueous solution (and especially in biosystem or biological sample) is not bery stable.The natural acid enzyme nuclease of zooblast (especially from) the L-nucleic acid of can not degrading.Thus, the biological half time phenomenal growth of L-nucleic acid in described system (comprising animal and human's body).Because L-nucleic acid is difficult for degraded, thus the generation of nuclease free degraded product, thus do not observe by the side effect due to it.Described aspect has in fact defined the every other compound L-nucleic acid of (it is used for the treatment of disease and/or the illness that relates to SDF-1).Also by by be different from Watson-Crick base pairing mechanism specific binding target molecule L-nucleic acid or or fit (the described fit part that especially contains the combination that participates in described fit and target molecule) that partially or completely by L-nucleic acid, formed be called mirror image isomer (spiegelmer).

State feature also within the scope of the invention, described the first and second nucleotide fragments that are connected to described core nucleotide sequence both sides in principle can phase mutual cross.After described hybridization, form duplex structure.Those skilled in the art will generally acknowledge: described hybridization can (especially in vitro and/or in body under condition) occur or not occur.If hybridized, can be at least based on base pairing rules hybridization formation duplex structure, without the complete sequence hybridization that two fragments occur.Part molecule or structure that duplex structure used herein is preferably formed by two or more uncrosslinking chains, the base pair that wherein exists at least one (preferably two or more) preferably to carry out base pairing according to Watson-Crick base pairing rules.Those skilled in the art also will generally acknowledge: other base pairings (for example Hoogsten base pairing) can be present in described duplex structure or form described duplex structure.

No matter state feature also within the scope of the invention, be with D-nucleic acid, L-nucleic acid or D, the nucleic acid that L-nucleic acid exists, or no matter they are DNA or RNA, nucleic acid of the present invention can be used as strand or double-strandednucleic acid exists.Conventionally, nucleic acid of the present invention is to show the secondary structure being limited by primary sequence, and also can form thus the single-chain nucleic acid of tertiary structure.But nucleic acid of the present invention also can be double-strandednucleic acid, i.e. complimentary to one another or complementary two the chain phases mutual cross of part.This gives nucleic acid with stability, at described nucleic acid, is especially with natural D-form but not L-form is favourable while existing.

Can modify nucleic acid of the present invention.Can carry out described modification to the single core thuja acid of described nucleic acid, and described in be modified to known in the art.The example of relevant described modification is especially shown in people such as Venkatesan (Venkatesan, Kim et al.2003) and Kusser(Kusser2000).Described modifier can be H atom, F atom or the O-CH in 2 ' position of indivedual Nucleotide of the described nucleic acid of formation ₃group or NH ₂-group.In addition, nucleic acid of the present invention also can comprise at least one LNA Nucleotide.In one embodiment, nucleic acid of the present invention consists of LNA Nucleotide.

In one embodiment, nucleic acid of the present invention can be many splits (multipartite) nucleic acid.Many splits nucleic acid used herein is the nucleic acid consisting of at least two nucleic acid chains.Described at least two nucleic acid chains form functional unit, and wherein said functional unit is the part of target molecule.Can be by described nucleic acid being cut into two chains, or the corresponding nucleic acid of the first part by synthetic and of the present invention (i.e. integral body) nucleic acid and at least two nucleic acid chains described in obtaining from nucleic acid of the present invention with corresponding another nucleic acid of the second section of whole nucleic acid.Should generally acknowledge cutting and synthetic both all can be used to preparation and there are as mentioned above 2 nucleic acid of the many splits with cochain.In other words, although can be to a certain degree complementary between each nucleic acid moiety, described at least two nucleic acid chains be different from two chains of complementation and phase mutual cross conventionally.

State feature also within the scope of the invention, finally realized complete closure (the being ring-type) structure of nucleic acid of the present invention, be that nucleic acid of the present invention is closed, preferably by covalently bound closure, between the wherein said covalently bound 5 ' end and 3 ' end that more preferably occurs in nucleotide sequence disclosed herein.

Contriver finds, and nucleic acid of the present invention shows very favorable K _dvalue scope.

By the surface plasma resonance measurement of using so-called biacore instrument (Biacore AB, Uppsala, Sweden) to carry out, be a kind of possibility method of measuring binding constant, this is also well known by persons skilled in the art.Can be preferably by using " pull-down assay method (the pull-down binding assay) " that describe in embodiment to measure avidity used herein.Suitable the measuring that represents the bonding strength between described nucleic acid and described target (being SDF-1) under present case is so-called K _dvalue, those skilled in the art know this value and measuring method thereof.

Nucleic acid of the present invention is by certain K _dvalue characterizes.The K that nucleic acid of the present invention shows _dvalue is preferably lower than 1 μ M.The K of approximately 1 μ M _dvalue is considered to the feature of nucleic acid and target non-specific binding.The same as skilled in the art will be accepted, the K of one group of compound (as nucleic acid of the present invention) _dvalue is within the scope of certain.The K of above-mentioned approximately 1 μ M _dpreferred K _dthe value upper limit.K in conjunction with the nucleic acid of target _dpreferred lower limit can be about 10pM or higher.State feature also within the scope of the invention, the K that indivedual nucleic acid is combined with SDF-1 _dvalue is preferably in described scope.Preferred scope can be by selecting any first digit in described scope and any second digit in described scope to limit.Preferred higher limit is 250nM and 100nM, and preferred lower value is 50nM, 10nM, 1nM, 100pM and 10pM.

As long as still can binding target molecule, nucleic acid molecule of the present invention can have random length.This area will be generally acknowledged, have the preferred length of nucleic acid of the present invention.Described length is generally 15-120 Nucleotide.Those skilled in the art will generally acknowledge, any integer of 15-120 is the possible length of nucleic acid of the present invention.More preferably the scope of the length of nucleic acid of the present invention is the length of an about 20-100 Nucleotide, an about 20-80 Nucleotide, an about 20-60 Nucleotide, an about 20-50 Nucleotide and an about 20-40 Nucleotide.

State feature also within the scope of the invention, nucleic acid disclosed herein comprises and is preferably high molecular part and/or preferably makes described nucleic acid the part that the feature of the residence time of (preferably in human body) changes especially in animal body.The particularly preferred embodiment of described modifier is PEGization and the HESization of nucleic acid of the present invention.PEG used herein represents PEG, and HES represents hydroxyethylamyle.PEGization used herein is preferably the modification to nucleic acid of the present invention, and wherein said modifier consists of the peg moiety that is attached to nucleic acid of the present invention.HESization used herein is preferably the modification to nucleic acid of the present invention, and wherein said modifier partly consists of the HES that is attached to nucleic acid of the present invention.Described modifier has been described and by the method for described modifier modification of nucleic acids in European patent application EP 1 306 382, by described patent openly by reference integral body be incorporated to herein.

Under preferable case, high molecular, partly consisting of or the molecular weight of the modifier that comprises high molecular part, is especially approximately 2 at PEG as described high molecular part in the situation that, 000-200,000Da, preferably 40,000-120,000Da, and especially at HES, be preferably approximately 3,000-180 as described high molecular part in the situation that, 000Da, more preferably 60,000-140,000Da.For example in German patent application DE 1 2,004 006 249.8, HES modifying method has been described, by described patent openly by reference integral body be incorporated to herein.

State feature also within the scope of the invention,, as further described, can straight or branched form use any one in PEG and HES in patent application WO2005074993 and PCT/EP02/11950.Can carry out described modification in any position of nucleic acid molecule of the present invention in principle.Can preferably on any Nucleotide between 5 ' of described nucleic acid molecule-terminal nucleotide, 3 '-terminal nucleotide and/or 5 ' Nucleotide and 3 ' Nucleotide, carry out described modification.

Can be by described modifier (and being preferably PEG and/or HES part) directly or be attached to nucleic acid molecule of the present invention by connexon.State feature also within the scope of the invention, nucleic acid molecule of the present invention comprises one or more modifiers, preferably one or more PEG and/or HES part.In one embodiment, connecting individually molecule is partly attached to more than one peg moiety or HES on nucleic acid molecule of the present invention.That the connexon using in the present invention itself can be straight chain or side chain.Those skilled in the art know this type of connexon, and have also further described described connexon in patent application WO2005074993 and PCT/EP02/11950.

Be not intended to be bound by any theory, by modifying nucleic acid of the present invention by high molecular part (as polymkeric substance (and polymkeric substance more particularly disclosed herein (it is preferably on physiology acceptable))), seem to have changed kinetics of secretion.More specifically, seem because the molecular weight of described modified nucleic acid of the present invention increases, and because described nucleic acid is thanked when L shaped formula (especially) without the successive dynasties, thereby it reduced in animal body, preferably in mammalian body, and more preferably from human endocrine.Owing to generally secreting by kidney, so contriver infers: through more significantly not reducing with the nucleic acid of this type of high molecular modifier as stated the glomerular filtration rate(GFR of the nucleic acid of modification, this causes its residence time in vivo to increase.Associated, although it should be noted that especially having this high molecular modifies, the specificity of nucleic acid of the present invention is not subject to harmful effect.Thus and thus, nucleic acid of the present invention has surprising feature (described feature can not be expected conventionally from pharmaceutically active compound), thereby makes its sustained release without the pharmaceutical preparation of giving sustained release characteristic by use.And the modified forms that comprises high molecular part with it, itself just can be used as extended release preparation nucleic acid of the present invention.Thus and thus, the modifier of nucleic acid molecule and warp can provide different as stated nucleic acid molecule and any composition that comprises it of modification as disclosed herein, preferably controlled pharmacokinetics and bio distribution thereof.This is also included in residence time in circulation and to the distribution of tissue.In patent application PCT/EP02/11950, further described described modification.

But state feature also within the scope of the invention, nucleic acid disclosed herein does not comprise any modification, and especially do not comprise high molecular modification (for example PEGization or HESization).When hope nucleic acid is rear while clearing out health fast in using, especially preferred described embodiment.When carrying out in-vivo imaging or specific administration, the medicine that need to use nucleic acid of the present invention or comprise described nucleic acid may wish described quick removing.

Nucleic acid of the present invention and/or antagonist of the present invention can be used for to pharmacy.At least one nucleic acid of the present invention that described pharmaceutical pack is combined containing optional and other pharmaceutically active compounds, the wherein preferably effect of performance pharmaceutically active compound of nucleic acid of the present invention itself.In a preferred embodiment, described medicine at least comprises pharmaceutically acceptable carrier.Described carrier for example can be water, damping fluid, PBS, glucose solution, sucrose solution, mannose solution, preferably 5% sucrose balance liquid, starch, sugar, gelatin or any other acceptable carrier material.Described carrier is normally well known by persons skilled in the art.Those skilled in the art will generally acknowledge, also any embodiment, purposes and the aspect of medicine of the present invention or associated embodiment, purposes and aspect can be applied to pharmaceutical composition of the present invention, and vice versa.

By indication, disease and the illness of nucleic acid of the present invention or prepared in accordance with the present invention, pharmaceutical composition and pharmacological agent and/or prevention, be directly or indirectly to be participated in separately due to pathogenesis by SDF-1.

Certainly, because the SDF-1 of SDF-1 binding nucleic acids of the present invention and people or mouse interacts or combination, those skilled in the art will understand conventionally: can easily SDF-1 binding nucleic acids of the present invention is used for the treatment of, be prevented and/or diagnose anyone and Animal diseases described herein.

Can use the disease of described pharmacological agent and/or prevention and/or illness and/or symptom to include but not limited to: eye rear portion disease, as retinopathy, diabetic retinopathy and age-related macular degeneration (dryness and moist two kinds of forms); Cancer; Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; B Cell Chronic Lymphocytic Leukemia, multiple myeloma; Lymphoma; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Sacroiliitis, rheumatoid arthritis, osteoarthritis and ephritis.

In further embodiment, described pharmaceutical pack is containing other forms of pharmacologically active agents.Described other pharmaceutically active compounds can be medicine well known by persons skilled in the art, and are preferably selected from chemokine or cytokine antagonist, reflunomide etc.Those skilled in the art understand: suppose can the application of the invention according to the present invention nucleic acid while processing described various indication, described other forms of pharmacologically active agents can be any forms of pharmacologically active agents that is applicable in principle treat and/or prevent described disease.Preferably by nucleic acid molecule of the present invention (when especially existing or using with medicament forms) and VEGF inhibitor (as the Macugen from Pfizer Ophthalmics (Pegatanib), from the Lucentis(Ranitizumab of Novartis Ophthalmics), from Roche(off-label use) Avastin (rhuMAb-VEGF)) combination; Or with photodynamic therapy (as the Visudyne(Visudyne from Novartis Ophthalmics)) and may be injected into intravitreous cortisone derivative (as the Retaane(NSC 24345 from Alcon Inc.) combination.

In addition, described other forms of pharmacologically active agents also can be other nucleic acid of the present invention.Described medicine also can comprise at least one nucleic acid of being combined with the target molecule that is different from SDF-1 or showing the function that is different from one of nucleic acid of the present invention again.

Those skilled in the art will generally acknowledge: really can any can be by the antagonist for SDF-1 being administered to the patient who needs described knot anti-agent, and described antagonist is suitable for eliminating a disease or the cause of disease of illness or at least can reduce in the disease from the effect of disease or illness and use nucleic acid of the present invention.Described effect includes but not limited to: Angiogenesis, inflammation and transfer.Disease or illness (it being incorporated to herein by reference, to avoid any unnecessary repetition) due to nucleic acid of the present invention is applicable to especially to be participated in by SDF-1 described in described and other specification sheets Introductory part.

State feature also within the scope of the invention, in addition in principle also can be by medicine for preventing disclosed and described medicine in the relevant any disease of the purposes of described disease treatment.So known respective markers thing for corresponding disease of those skilled in the art.Described respective markers thing is SDF-1 preferably.In addition, described respective markers thing is selected from oxidative stress marker (the cross-film reductase enzyme that comprises the hexacyanoferrate (TMR), sorbyl alcohol after the increase of sorbyl alcohol pathway activities comprises is accumulated, cytosol NADH/NAD ratio increases, NADPH exhausts and accumulates with fructose and the non-enzymatic generation of consequent advanced glycation end products (AGES) and the activation subsequently of protein kinase C, downstream events (for example map kinase activation) by nitrosification and oxidative stress mediation), Markers of inflammation (comprises ICAM-1, VCAM-1, RANTES, haptoglobin or CRP) and Angiogensis marker (as short erythrocyte growth hormone or VEGF).In view of this, described mark can be used for determining whether available any nucleic acid molecule treatment experimenter of the present invention or patient.Therefore, more on the one hand, the present invention relates to described method, whether and more specifically the existence of wherein measuring respective markers thing concentration.Those skilled in the art become known for detecting described marker and optional quantitative described marker, and respective markers thing should exist or not be present in scope wherein, to judge whether experimenter or patient suffer from the method in any or the danger in suffering from described disease in described disease, thus and can be according to the corresponding method for the treatment of of the present invention.

In an embodiment of medicine of the present invention, described medicine and other therapies are united and applied in to any disease disclosed herein, the disease that especially stand-by medicine of the present invention is treated.

" conjoint therapy " (or " composite treatment ") comprises uses medicine of the present invention and at least the second reagent (as a part for concrete treatment plan), should to expect that acting in conjunction by these therapeutical agents (being medicine of the present invention and described the second reagent) provides beneficial effect.The useful effect of this associating includes but not limited to by the pharmacokinetics due to the associating of therapeutical agent or pharmacodynamics acting in conjunction.Conventionally within the time limiting, complete co-administered (be generally several minutes, a few hours, a couple of days or several weeks, depend on selected associating) of described therapeutical agent.

" conjoint therapy " can be intended to comprise (but conventionally not comprising) individual application therapeutical agent described in two or more respectively, and described individual application respectively also can cause associating of the present invention once in a while." conjoint therapy " is intended to comprise these therapeutical agents of continuous administration, at different time, uses wherein each therapeutical agent, and substantially uses at least two kinds in these therapeutical agents or described therapeutical agent simultaneously.Can be for example by use single capsule of containing each therapeutical agent with fixed proportion or single capsule of a plurality of each therapeutical agents to experimenter, realize administration simultaneously substantially.

Can realize the administration successively of each therapeutical agent or administration simultaneously substantially by any suitable pathways, described approach includes but not limited to: local approach, oral route, intravenous route, intramuscular approach and process mucosal tissue directly absorb.Can use described therapeutical agent by identical approach or different approaches.For example, injectable is used the first therapeutical agent of selected associating agent, and the other treatment agent in associating agent described in can topical application.

In addition, also for example can all therapeutical agents of topical application, or injectable is used all therapeutical agents.Except as otherwise noted, the order of administration of described therapeutical agent is strictly unimportant." conjoint therapy " also can comprise above-mentioned therapeutical agent co-administered with other biological activeconstituents again.If conjoint therapy also comprises non-drug therapy, can implement described non-drug therapy in any suitable time that can obtain useful effect from the acting in conjunction of the associating of therapeutical agent and non-drug therapy.For example, in appropriate circumstances, in non-drug therapy, after using of therapeutical agent, perhaps there are several days or even a few when week, still can reach useful effect.

As discussed, can any form well known by persons skilled in the art use medicine of the present invention in principle in above-mentioned generic term.Preferred route of administration is systemic administration, more preferably by parenteral administration (preferably by injection).In addition medicine described in, also can topical application.Other route of administration comprise in intramuscular, intraperitoneal and subcutaneous, per os, nose, in tracheae or pulmonary administration, and preferably invasive minimum and guarantee the route of administration of effect simultaneously.

That parenteral administration is normally used for is subcutaneous, intramuscular or intravenous injection and infusion.In addition, a kind of method for parenteral administration has adopted the implantation of slowly-releasing well known to those skilled in the art or sustained release system, and it guarantees the dosage level that remains constant.

In addition, can use vehicle (vehicle), inhalation in suitable nose to use preferred agents of the present invention with form in nose by part, maybe can adopt the form of the known transdermal patch of those skilled in the art by using preferred agents of the present invention through skin approach.Want with transdermal delivery system form administration, (certainly) will be in whole administration process continuously but not intermittently administration.Other preferred topical formulations comprise ointment, ointment, lotion, aerosol spray and gelifying agent, and wherein the concentration range of activeconstituents will be 0.01%-15%(w/w or w/v conventionally).

Medicine of the present invention, by conventionally comprising the therapeutic activity composition that is dissolved or dispersed in the significant quantity in the acceptable medium of pharmacy, includes but not limited to nucleic acid molecule of the present invention.The acceptable medium of pharmacy or carrier comprise any and all solvents, dispersion medium, dressing, antibacterial agent and anti-mycotic agent, isotonic agent and absorption delay agent etc.The well known described medium for pharmaceutically active substances and the application of preparation.Also supplementary activeconstituents can be mixed in medicine of the present invention.

Further aspect of the present invention relates to pharmaceutical composition.Described pharmaceutical composition comprises at least one nucleic acid of the present invention, and preferably comprises the acceptable tackiness agent of pharmacy.Described tackiness agent can be this area and uses and/or known any tackiness agent.Described tackiness agent is any tackiness agent about discussing in the preparation process of medicine disclosed herein more especially.In another embodiment, described pharmaceutical composition comprises other forms of pharmacologically active agents.

According to the disclosure, one skilled in the art will know that the preparation of medicine and pharmaceutical composition.Conventionally described composition can be made to injection (as liquor or suspension); Make and be suitable for before injection, dissolving or being suspended in the solid form in liquid; Make for Orally administered tablet or other solid formulation; Make timed release capsule; Or make any other form of current use, comprise eye drops, ointment, lotion, salve, inhalation etc.The specific region of using sterile preparation (for example washing lotion based on salt solution) to process in field of operation by surgeon, physician or health care worker is also particularly useful.Also can pass through micro device, microparticle or sponge delivering compositions.

After preparation, medicine is used in the mode compatible with dosage particles, and used pharmacology significant quantity.Can be easy to for example, use described preparation with various formulations (type of above-mentioned Injectable solution), but also can adopt drug release capsules etc.

In described situation, the amount of activeconstituents to be administered and composition volume depend on individuality to be treated or experimenter.The concrete amount of the active compound that administration is required depends on practitioner's judgement, and is specific to each individuality.

Conventionally utilize the medicine of the required minimum volume of dispersed activity compound.Suitable application program is also variable, but can start to use described compound monitoring result, and then provides further controlled dose to represent with the further timed interval.

For example, when for example, with tablet or capsule (gelatine capsule) form when Orally administered, can by active pharmaceutical ingredient (being nucleic acid molecule of the present invention) and/or any other forms of pharmacologically active agents (being also referred to as in this article therapeutical agent or active compound) with oral, nontoxic, the acceptable inert support of pharmacy (such as ethanol, glycerine, water etc.) is combined.And, when expecting or needing, also suitable binder, lubricant, disintegrating agent and tinting material can be mixed to described mixture.Suitable binder comprises starch, neusilin, starch slurry, gelatin, methylcellulose gum, Xylo-Mucine and/or polyvinylpyrrolidone, natural carbohydrate (for example glucose or beta lactose), corn sweetener, natural and synthetic natural gum (for example gum arabic, tragacanth gum or sodiun alginate), polyoxyethylene glycol, wax etc.The lubricant using in these formulations comprises sodium oleate, sodium stearate, Magnesium Stearate, Sodium Benzoate, sodium acetate, sodium-chlor, silicon-dioxide, talcum, stearic acid, its magnesium salts or calcium salt and/or polyoxyethylene glycol etc.Disintegrating agent includes but not limited to, starch, methylcellulose gum, agar, wilkinite, xanthan gum starch, agar, alginic acid or its sodium salt or effervescent mixture etc.Thinner comprises for example lactose, dextrose, sucrose, N.F,USP MANNITOL, Sorbitol Powder, Mierocrystalline cellulose and/or glycine.

Can also use medicine of the present invention such as the oral dosage form of time controlled released and slow releasing tablet or capsule, pill, pulvis, granule, elixir, tincture, suspensoid, syrup and emulsion.Advantageously by fat emulsion or suspension, prepare suppository.

Pharmaceutical composition or medicine can be through sterilizing and/or contain adjuvant, for example sanitas, stablizer, wetting agent or emulsifying agent, chaotropic agent (solution promoter), for regulating salt and/or the buffer reagent of osmotic pressure.In addition, they also can comprise other valuable materials in treatment.According to routine mixing, granulation or method for coating, prepare composition, and described composition is conventionally containing having an appointment 0.1%-75%, the activeconstituents of preferred about 1%-50%.

Can prepare liquid (especially injectable) composition by such as dissolving, dispersion etc.Active compound is dissolved in pharmacy neat solvent (such as water, salt solution, the dextrose aqueous solution, glycerine, ethanol etc.) or with it and is mixed, thereby form injectable solution or suspension.In addition, can prepare and be suitable for being dissolved in the solid form in liquid before injection.

For solids composition, vehicle comprises N.F,USP MANNITOL, lactose, starch, Magnesium Stearate, soluble saccharin, talcum, Mierocrystalline cellulose, glucose, sucrose, magnesiumcarbonate of pharmaceutical grade etc.Also available for example polyalkylene glycol (as propylene glycol) is mixed with suppository as carrier by the active compound limiting above.In some embodiments, advantageously by fat emulsion or suspension, prepare suppository.

Also can liposome delivery system the form of (for example little unilamellar vesicle, large unilamellar vesicle and multilamellar vesicle) use respectively medicine of the present invention and nucleic acid molecule.Liposome can consist of various phosphatide (comprising cholesterol, stearylamine or phosphatidylcholine).In some embodiments, the film of lipid composition and pharmaceutical aqueous solution hydration are formed to the lipid layer of the described medicine of parcel, this is well known to those skilled in the art.For example, can provide nucleic acid molecule as herein described by the composite form of means known in the art and lipophilic compound or non-immunogenic high-molecular weight compounds structure.In addition, liposome can carry on its surface described nucleic acid molecule, carries cytotoxic agent and mediated cell kills and wounds for use in target with in inside.United States Patent (USP) 6,011, provides the example of nucleic acid related complex in 020.

Also can be respectively using medicine of the present invention and nucleic acid molecule and soluble polymer phase coupling as determining the carrier of target medicine.Described polymkeric substance can comprise polyvinylpyrrolidone, pyran co-polymer, poly-hydroxypropyl-Methacrylamide-phenol, poly-hydroxyethyl l-asparagine phenol or the polyethylene oxide polylysine replacing through palmityl residue.In addition, can be respectively medicine of the present invention and nucleic acid molecule be coupled to the biodegradable polymkeric substance that a class can be used for realizing the controlled release of medicine, for example crosslinked or amphipathic nature block polymer of poly(lactic acid), poly-epsilon-caprolactone, polyhydroxybutyrate, poe, polyacetals, poly-dihydropyrane, polybutylcyanoacrylate class and hydrogel.

As needs, pharmaceutical composition to be administered and medicine also can contain the non-toxic auxiliary substances of small amount, for example wetting agent or emulsifying agent, pH buffer reagent and other materials, for example sodium acetate and Emulphor FM.

Can according to many factors, select to use respectively the dosage regimen of nucleic acid molecule of the present invention and medicine, comprise: patient's type, species, age, body weight, sex and medical condition; The severity of symptom to be treated; Route of administration; Patient's kidney and liver function; And concrete fit or its salt adopting.Gengral practitioner or animal doctor can easily determine and output prevention, antagonism or stop symptom to make progress required medicine effective quantity.

In treatment any disease disclosed herein, the effective plasma level horizontal extent of nucleic acid of the present invention is preferably 500fM-500 μ M.

Can be preferably with single per daily dose, every two days or every three days, weekly, every two weeks, with the single moon dosage or every three months dosage use respectively nucleic acid molecule of the present invention and medicine.

State feature also within the scope of the invention, medicine described herein has formed pharmaceutical composition disclosed herein.

Further aspect of the present invention relates to the experimenter's who is used for the treatment of this treatment of needs method, and wherein said method comprises at least one nucleic acid of the present invention of using pharmaceutical active amount.In one embodiment, experimenter suffers from disease or in suffering from the risk of described disease, wherein said disease is any described disease disclosed herein, any in the purposes of especially relevant any nucleic acid of the present invention in medicine preparation in those disclosed disease.

The SDF-1 describing when diagnosis or diagnostic reagent or diagnostic tool are suitable for directly or indirectly detecting about various illnesss described herein and disease as used herein preferably used.Described diagnosis is suitable for detection and/or follows up a case by regular visits to any illness and disease of describing respectively herein.Described detection is combined into as possibility by nucleic acid of the present invention and SDF-1's.Can directly or indirectly detect this combination.Corresponding Method and kit for is well known by persons skilled in the art.Especially, nucleic acid of the present invention can comprise mark, and described mark makes to detect nucleic acid of the present invention, and preferred combination is to the nucleic acid of SDF-1.Described mark is preferably selected from radio-labeling, enzyme labelling and fluorescent mark.In principle, all known assay methods for antibody exploitation all can be used for nucleic acid of the present invention, but target binding antibodies has been replaced to target binding nucleic acids.In using the antibody-assay method of unlabelled target binding antibodies, preferably by two, resist to detect, with radio-labeling, enzyme labelling and fluorescent mark, modify described two and resist, and at its Fc-fragment place in conjunction with described target binding antibodies.At nucleic acid, in the situation of preferred nucleic acid of the present invention, with the mark that is preferably selected from vitamin H, Cy-3 and Cy-5, modify described nucleic acid, and use the antibody (for example anti-biotin antibodies, anti-Cy3 antibody or anti-Cy5 antibody) for described mark to detect this mark, or when described in while being labeled as vitamin H, with streptavidin or the avidin of natural combination vitamin H, detect described mark.Then, preferably use respective markers (for example radio-labeling, enzyme labelling or fluorescent mark) to modify described antibody, streptavidin or avidin (anti-as two).

In another embodiment, by the second testing tool, detect or analyze nucleic acid molecule of the present invention, wherein said testing tool is molecular beacon.Those skilled in the art's known molecular beacon approach.In brief, nucleic acid probe (it is also referred to as molecular beacon) is the reverse complementary sequence of determined nucleic acid sample, and thereby can partly hybridize with determined nucleic acid sample.After bind nucleic acid sample, the fluorophor of molecular beacon is separated, causes fluorescent signal to change, and is preferably Strength Changes.This variation is relevant to the nucleic acid samples amount of existence.

Those skilled in the art understand, due to the relation between its corresponding acceptor of SDF-1 of general introduction herein, described disease and illness when can use the disease of nucleic acid molecule of the present invention diagnosis and illness to be used for the treatment of about described nucleic acid molecule just in principle and/or preventing the purposes of described disease.

In addition, the purposes of nucleic acid molecule of the present invention is present in hematopoiesis minimizing, invades or shifts minimizing, B cell occurs and chemotaxis minimizing, T cytochemistry chemotactic reduce and induced growth suppresses and apoptosis.

The detection of relevant SDF-1, preferred method comprises the following steps:

(a) sample that provides SDF-1 to be measured whether to exist

(b) provide nucleic acid of the present invention,

(c) allow described sample and described nucleic acid reaction, preferably in reaction vessel, react,

Wherein step (a) can be carried out before at step (b), or step (b) can be carried out before at step (a).

In a preferred embodiment, also provide step d), detection sample reacts with nucleic acid.Preferably the nucleic acid of step b) is fixed to surface.Described surface can be reaction vessel (for example hole of reaction tubes, flat board) surface, or can be device (for example pearl) surface being contained in described reaction vessel.Can nucleic acid be fixed to described surface by any means well known by persons skilled in the art, include but not limited to non-covalent or covalently bound.Preferably by the covalent chemical bond between described surface and described nucleic acid, connect.But state feature also within the scope of the invention, be about to described nucleic acid and be indirectly fixed to described surface, wherein this indirectly fixedly relating to, is used other components or the even body (interaction partner) of a pair of interaction.Described other components are preferably and treat the interactional compound of fixing nucleic acid specificity (its be also referred to as interact even body), thereby and mediate described nucleic acid and be attached to described surface.The even body of described interaction is preferably selected from nucleic acid, polypeptide, protein and antibody.The even body of described interaction is preferably antibody, more preferably monoclonal antibody.The even body of described interaction also can be nucleic acid, preferred function nucleic acid.That described functional nucleic acid is more preferably selected from is fit, mirror image isomer and at least with the nucleic acid of described nucleic acid moiety complementation.In another alternative embodiment, the combination on described nucleic acid and described surface is by interact even body (multi-partite interaction partner) mediation of many splits.Described many splits even body that interacts is preferably the even body of a pair of interaction that consists of the first member and the second member or the even body that interacts, wherein said the first member is contained in or is attached to described nucleic acid, and described the second member is contained in or is attached to described surface.Described many splits even body that interacts is preferably selected from the even body pair of interaction that comprises vitamin H and avidin, vitamin H and streptavidin and vitamin H and neutral streptavidin (neutravidin).Right the first member of the even body of described interaction is vitamin H preferably.

The preferred result of described method be formed SDF-1 and described nucleic acid through fixing mixture, wherein more preferably described mixture can be detected.Technical characterictic also, in the scope of embodiment, can detect SDF-1 from described mixture.

Method for detection of SDF-1 also comprises: from preferably removing sample for carrying out the reaction vessel of step c).

In another embodiment, described method also comprises the step that the even body of the interaction of SDF-1 is fixed on to surface (preferably surperficial as defined above), the even body of wherein said interaction is as definition herein, with preferably as defined when about corresponding method above, and more preferably in their various embodiments, comprise nucleic acid, polypeptide, protein and antibody.In this embodiment, particularly preferred testing tool is nucleic acid of the present invention, and wherein said nucleic acid can be preferably through mark or unlabelled.At described nucleic acid, be through mark in the situation that, it can directly or indirectly be detected.This detection also can relate to the use of the second testing tool, and described the second testing tool is also preferably selected from nucleic acid, polypeptide, protein and the specific form in various embodiments as herein described.Described testing tool is preferably specific to nucleic acid of the present invention.In a more preferred embodiment, described the second testing tool is molecular beacon.In a preferred embodiment, described nucleic acid or described the second testing tool or both can inclusion test marks.Described certification mark is preferably selected from vitamin H, bromodeoxyribouridine mark, digoxigenin mark, fluorescent mark, UV-mark, radio-labeling and chelator molecule.In addition, described the second testing tool also can with preferably contained by described nucleic acid, by described nucleic acid, comprised or the certification mark that is attached to described nucleic acid interacts.Particularly preferred combination is as follows:

Certification mark is vitamin H and the second testing tool is the antibody for vitamin H, or wherein

Certification mark is vitamin H and the second testing tool is avidin or the molecule that carries avidin, or wherein

Certification mark is vitamin H and the second testing tool is streptavidin or the molecule that carries streptavidin, or wherein

Certification mark is vitamin H and the second testing tool is neutral streptavidin or the molecule that carries neutral streptavidin, or wherein

Certification mark is bromodeoxyribouridine and the second testing tool is the antibody for bromodeoxyribouridine, or wherein

Certification mark is digoxigenin and the second testing tool is the antibody for digoxigenin, or wherein

Certification mark is sequestrant and the second testing tool is radionuclide, and wherein said certification mark is preferably attached to described nucleic acid.To be recognized that, this type of combination also can be applied to its amplifying nucleic acid and be attached to surperficial embodiment.In this embodiment, certification mark is preferably attached to the even body that interacts.

Finally, state feature also within the scope of the invention, with the third testing tool, detect the second testing tool, described the third testing tool is enzyme preferably, more preferably when detecting described the second testing tool, demonstrate the enzyme of enzymatic reaction, or described the third testing tool is the instrument for detection of radiation (radiation of more preferably being launched by radionuclide).The second testing tool and/or interact with described the second testing tool described in the preferred specific detection of described the third testing tool.

In addition, by the interaction of SDF-1 even body fixing from the teeth outwards and nucleic acid of the present invention is preferably joined among the embodiment interacting in the mixture forming between even body and SDF-1, sample can be removed from reaction system, more preferably from carrying out step c) and/or d) reaction vessel remove.

In one embodiment, nucleic acid of the present invention comprises fluorescence part, and the fluorescence of the described fluorescence part while forming mixture while wherein forming mixture between described nucleic acid and SDF-1 and between described nucleic acid and free SDF-1 is different.

In another embodiment, described nucleic acid is the derivative of nucleic acid of the present invention, and the fluorescent derivative that the derivative of wherein said nucleic acid comprises at least one adenosine is to replace adenosine.In a preferred embodiment, the fluorescent derivative of described adenosine is vinylidene adenosine.

In another embodiment, the mixture that utilizes fluoroscopic examination to be formed by derivative and the SDF-1 of nucleic acid of the present invention.

In an embodiment of described method, signal results from step (c) or step (d), and described signal is preferably relevant to the concentration of SDF-1 in sample.

One preferred aspect, can in 96 hole flat boards, carry out described mensuration, wherein composition is fixed on as described above in reaction vessel, and by hole as reaction vessel.

Also nucleic acid of the present invention can be used as to the parent material of medicinal design.Two kinds of possibility methods of main existence.Be a SCREENED COMPOUND library, and described library of compounds is preferably low-molecular weight compound library.In one embodiment, described screening is high flux screening.Quick and effective trial and error (trial-and-error) assessment that high flux screening preferably carries out compound in the mensuration based on target.Preferably by colorimetric measurement method, carry out described analysis.The library of associated use is well known by persons skilled in the art.

In addition, also nucleic acid of the present invention can be used for to the appropriate design of medicine.Rational drug design preferably designs pharmacy guide structure.From the three-dimensional structure of target, the database search of the structure that comprises many different compounds with computer program handle one time, described three-dimensional structure is determined by the method such as X-ray crystallography or NMR (Nuclear Magnetic Resonance) spectroscopy conventionally.Described selection completes by computer, can in laboratory, detect determined compound subsequently.

Can start to carry out Rational drug design from any nucleic acid of the present invention, and relate to the structural similitude of nucleic acid of the present invention or with the structure of nucleic acid of the present invention in mediate the structure that the part of combination is identical, preferred three-dimensional structure.Under any circumstance, described structure still demonstrates and the same or analogous combination feature of nucleic acid of the present invention.In further step in Rational drug design or as alternative step, preferably with the chemical group that is different from Nucleotide and nucleic acid, simulate the three-dimensional structure of those parts of the described nucleic acid that is attached to neurotransmitter.By this simulation, can design the compound that is different from described nucleic acid.Described compound is preferably small molecules or peptide.

For example by come SCREENED COMPOUND library by competitive assays well known by persons skilled in the art in the situation that, can find suitable SDF-1 analogue, SDF-1 agonist or SDF-1 antagonist.This competitive assays can be set up as follows.By nucleic acid of the present invention, preferably the mirror image isomer as the L-nucleic acid in conjunction with target is coupled to solid phase.In order to identify SDF-1 analogue, the SDF-1 through mark can be added to described assay method.Potential analogue will with mirror image isomer described in SDF-1 molecule competitive binding, this will follow the signal obtaining by respective markers to reduce.Screening agonist or antagonist can relate to use cell cultures assay method well known by persons skilled in the art.

Test kit of the present invention can comprise at least one or several nucleic acid of the present invention.In addition, test kit can comprise at least one or several positive or negative contrasts.Positive control can be for example SDF-1, especially for it, selects the SDF-1 of nucleic acid of the present invention or nucleic acid of the present invention and its combination, preferably with liquid form.Negative control can be for example the peptide limiting according to the biophysical properties that is similar to SDF-1, but it can not identified by nucleic acid of the present invention.In addition, described test kit can comprise one or more damping fluids.Various compositions can be dried or the form of freeze-drying, or are included in test kit with the form being dissolved in liquid.Described test kit can comprise one or several container, and described container can comprise the composition of test kit described in one or more then.In another embodiment, described test kit comprises specification sheets or operational manual, and it offers user by the relevant information of test kit and various compositions thereof of how using.

As preferably used herein, term treatment also comprises in a preferred embodiment prevention and/or follows up a case by regular visits to.

Pharmacokinetics and the biokinetics in several human bodies and non-human body fluid, tissue and organ mainly for assessment of it measured in the pharmacy of nucleic acid of the present invention and bioanalysis.For this reason, can use any open and detection method well known by persons skilled in the art herein.Further aspect of the present invention provides the sandwich hybridization assay method for detection of nucleic acid of the present invention.In described detection assay method, capture probe and detection probes have been used.First part of described capture probe and nucleic acid of the present invention is complementary, and the second part of detection probes and nucleic acid of the present invention is complementary.Capture probe and detection probes all can be formed by DNA Nucleotide, modified DNA Nucleotide, modified RNA Nucleotide, RNA Nucleotide, LNA Nucleotide and/or PNA Nucleotide.

Therefore, described capture probe comprises the fragment with the complementation of 5 ' of nucleic acid of the present invention-end, and detection probes comprises the fragment with the complementation of 3 ' of nucleic acid of the present invention-end.In said case, capture probe is fixed to surface or matrix by its 5 '-end, wherein said capture probe can be directly fixing in its 5 '-end, or be fixed by the connexon between its 5 '-end and surface or matrix.But connexon can be connected in principle, to each Nucleotide of capture probe.Described connexon can be formed by wetting ability connexon well known by persons skilled in the art, or is formed by D-DNA Nucleotide, modified D-DNA Nucleotide, D-RNA Nucleotide, modified D-RNA Nucleotide, D-LNA Nucleotide, PNA Nucleotide, L-RNA Nucleotide, L-DNA Nucleotide, modified L-RNA Nucleotide, modified L-DNA Nucleotide and/or L-LNA Nucleotide.

In addition, described capture probe also can comprise the fragment with the complementation of 3 ' of nucleic acid of the present invention-end, and described detection probes also can comprise the fragment with the complementation of 5 ' of nucleic acid of the present invention-end.In this case, described capture probe is fixed to surface or matrix by its 3 '-end, and wherein said capture probe can be directly fixing in its 3 '-end, or be fixed by the connexon between its 3 '-end and surface or matrix.But in principle, connexon can be connected to each Nucleotide with the fragment of nucleic acid complementation of the present invention.Connexon can be formed by wetting ability connexon well known by persons skilled in the art, or is formed by D-DNA Nucleotide, modified D-DNA Nucleotide, D-RNA Nucleotide, modified D-RNA Nucleotide, D-LNA Nucleotide, PNA Nucleotide, L-RNA Nucleotide, L-DNA Nucleotide, modified L-RNA Nucleotide, modified L-DNA Nucleotide and/or L-LNA Nucleotide.

Can be variable with the capture probe of nucleic acid hybridization of the present invention and the few nucleotide of detection probes, and can be dependent on and catch and/or the few nucleotide of detection probes and/or nucleic acid of the present invention self.Can should be the few nucleotide that nucleic acid of the present invention comprises with the maximum value of the capture probe of nucleic acid hybridization of the present invention and the Nucleotide sum of detection probes.The minimum few nucleotide of detection probes and capture probe (2-10 Nucleotide) should make them hybridize with 5 ' of nucleic acid of the present invention-end or 3 '-end respectively.In order to realize at nucleic acid of the present invention and to be present in high specificity and the selectivity between other nucleic acid in analyzed sample, the Nucleotide sum of capture probe and detection probes should be or mostly be the few nucleotide that nucleic acid of the present invention comprises most.

In addition, described detection probes is preferably carried described detectable marker molecules as previous in this paper or mark.In principle, described mark or marker molecules can be connected to each Nucleotide of described detection probes.Described mark or marker are preferably placed at 5 ' of detection probes-end or 3 '-end, wherein can Nucleotide in detection probes and nucleic acid complementation of the present invention and described mark between insert connexon.Described connexon can be formed by wetting ability connexon well known by persons skilled in the art, or is formed by D-DNA Nucleotide, modified D-DNA Nucleotide, D-RNA Nucleotide, modified D-RNA Nucleotide, D-LNA Nucleotide, PNA Nucleotide, L-RNA Nucleotide, L-DNA Nucleotide, modified L-RNA Nucleotide, modified L-DNA Nucleotide and/or L-LNA Nucleotide.

Can detect as follows nucleic acid of the present invention:

Make nucleic acid of the present invention with its one end and capture probe hybridization, and with its other end and detection probe.Then, by for example one or more washing steps, remove unconjugated detection probes.The detection probes amount that can measure subsequently combination, described detection probes is preferably carried mark or marker molecules.

As used herein preferably used, except as otherwise noted, term " disease " and " illness " should be used interchangeably.

As used herein, term " comprises " theme that is preferably not intended to limit before described term or by the described theme of described term.But in alternative embodiment, term " should be comprised " and is interpreted as " containing ", thereby be interpreted as the theme of restriction before described term or by the described theme of described term.

The nucleic acid molecule of the present invention that uses and each sequence identification number, the chemical property of target molecule SDF-1 in following table, have been summarized herein, its actual sequence and internal reference number.

Need know, used biotinylated people D-SDF-1(SEQ.ID.4) in fit (being d-nucleic acid level (D-RNA)) level, characterized described nucleic acid, or with SDF-1, L-SDF-1(people SDF-1 α, the SEQ-ID.1 of native configurations) in mirror image isomer (being L-nucleic acid (L-RNA)) level, characterized described nucleic acid.Different nucleic acid has an internal reference title (but fit for D-RNA(with a SEQ.ID respectively) molecule, and a SEQ.ID. is for L-RNA(mirror image isomer) molecule).

Table 1(B)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				18	L-RNA(mirror image isomer)	AGCGUGAAAGUAACACGUAAAAUGAAAGGUAACCACGCU	191-A6
19	L-RNA(mirror image isomer)	AAAGYRACAHGUMAAX AUGAAAGGUARC;X A=A or disappearance	Formula-1 of A type
				20	L-RNA(mirror image isomer)	AAAGYRACAHGUMAAUGAAAGGUARC	Formula-2 of A type
21	L-RNA(mirror image isomer)	AAAGYRACAHGUMAAAUGAAAGGUARC	Formula-3 of A type
				22	L-RNA(mirror image isomer)	AAAGYAACAHGUCAAUGAAAGGUARC	Formula-4 of A type
23	L-RNA(mirror image isomer	RSHRYR	Formula-the 5-5 ' of A type
				24	L-RNA(mirror image isomer	YRYDSY	Formula-the 5-3 ' of A type
25	L-RNA(mirror image isomer)	CUGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCAG	192-A10-002
				26	L-RNA(mirror image isomer)	UGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCA	192-A10-003
27	L-RNA(mirror image isomer)	GUGAAAGCAACAUGUCAAUGAAAGGUAGCCGC	192-A10-004
				28	L-RNA(mirror image isomer)	UGAAAGCAACAUGUCAAUGAAAGGUAGCCG	192-A10-005
29	L-RNA(mirror image isomer)	GAAAGCAACAUGUCAAUGAAAGGUAGCC	192-A10-006
				30	L-RNA(mirror image isomer)	AAAGCAACAUGUCAAUGAAAGGUAGC	192-A10-007
31	L-RNA(mirror image isomer)	GCGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCGC	192-A10-008
				32	L-RNA(mirror image isomer)	GCGCGAAAGCAACAUGUCAAUGAAAGGUAGCCGCGC	192-A10-015
33	L-RNA(mirror image isomer)	GCGGAAAGCAACAUGUCAAUGAAAGGUAGCCCGC	192-A10-014
				34	L-RNA(mirror image isomer)	CGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCG	192-A10-016
35	L-RNA(mirror image isomer)	GCGCAAAGCAACAUGUCAAUGAAAGGUAGCGUGC	192-A10-017
				36	L-RNA(mirror image isomer)	GUGCAAAGCAACAUGUCAAUGAAAGGUAGCGCGC	192-A10-018

Table 1(C)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				37	L-RNA(mirror image isomer)	CGCGAAAGCAACAUGUCAAUGAAAGGUAGCCGUG	192-A10-019
38	L-RNA(mirror image isomer)	GGGCAAAGCAACAUGUCAAUGAAAGGUAGCGCCC	192-A10-020
				39	L-RNA(mirror image isomer)	GGCCAAAGCAACAUGUCAAUGAAAGGUAGCGGCC	192-A10-021
40	L-RNA(mirror image isomer)	GCCCAAAGCAACAUGUCAAUGAAAGGUAGCGGGC	192-A10-022
				41	L-RNA(mirror image isomer)	CCCCAAAGCAACAUGUCAAUGAAAGGUAGCGGGG	192-A10-023
42	L-RNA(mirror image isomer)	X 2BBBS;X 2=S or disappearance	Formula-the 6-5 ' of A type
				43	L-RNA(mirror image isomer)	SBBVX 3;X 3=S or disappearance	Formula-the 6-3 ' of A type
44	L-RNA(mirror image isomer)	X 1X 2NNBV;X 1=R or disappearance, X 2=S or disappearance	Formula-the 7-5 ' of A type
				45	L-RNA(mirror image isomer)	BNBNX 3X 4;X 3=R or disappearance, X 4=Y or disappearance	Formula-the 7-3 ' of A type
46	L-RNA(mirror image isomer)	AGCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACGCU	193-C2-001
				47	L-RNA(mirror image isomer)	AGCGUGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGUACGCU	193-G2-001
48	L-RNA(mirror image isomer)	AGCGUGGUGUGAUCUAGAUGUAAUGGCUGAUCCUAGUCAGGUGCGCU	193-F2-001
				49	L-RNA(mirror image isomer)	GCGAGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCGC	193-G1-002
50	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCGC	193-D2-002
				51	L-RNA(mirror image isomer)	GCAUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCCC	193-A1-002
52	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAAUGGCUGAUCCUAGUCAGGGACGC	193-D3-002

Table 1(D)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				53	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAGAGGCUGAUCCUAGUCAGGUACGC	193-B3-002
54	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAAAGGCUGAUCCUAGUCAGGUACGC	193-H3-002
				55	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGUUCCUAGUCAGGUAUGC	193-E3-002
56	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUUAGGUACGC	193-D1-002
				57	L-RNA(mirror image isomer)	GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG	Formula-1 of Type B
58	L-RNA(mirror image isomer)	GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGG	Formula-2 of Type B
				59	L-RNA(mirror image isomer)	X 1GCRWG;X 1=A or disappearance	Formula-the 3-5 ' of Type B
60	L-RNA(mirror image isomer)	KRYSCX 4;X 4=U or disappearance	Formula-the 3-3 ' of Type B
				61	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACGC	193-C2-002
62	L-RNA(mirror image isomer)	CGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACG	193-C2-003
				63	L-RNA(mirror image isomer)	GUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUAC	193-C2-004
64	L-RNA(mirror image isomer)	UGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUA	193-C2-005
				65	L-RNA(mirror image isomer)	GGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGU	193-C2-006
66	L-RNA(mirror image isomer)	GUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGG	193-C2-007
				67	L-RNA(mirror image isomer)	GCGUGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGUACGC	193-G2-012

Table 1(E)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				68	L-RNA(mirror image isomer)	GCGCGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGCGCGC	193-G2-013
69	L-RNA(mirror image isomer)	GCGCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGCGC	193-G2-014
				70	L-RNA(mirror image isomer)	GGGCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGCCC	193-G2-015
71	L-RNA(mirror image isomer)	GGCCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGGCC	193-G2-016
				72	L-RNA(mirror image isomer)	GCCCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGGGC	193-G2-017
73	L-RNA(mirror image isomer)	X 2SSBS;X 2=G or disappearance	Formula-the 4-5 ' of Type B
				74	L-RNA(mirror image isomer)	BVSSX 3;X 3=C or disappearance	Formula-the 4-3 ' of Type B
75	L-RNA(mirror image isomer)	X 1GCGUG;X 1=A or disappearance	Formula-the 5-5 ' of Type B
				76	L-RNA(mirror image isomer)	UACGCX 4;X 4=U or disappearance	Formula-the 5-3 ' of Type B
77	L-RNA(mirror image isomer)	X 1X 2SVNS;X 1=A or disappearance, X 2=G or disappearance	Formula-the 6-5 ' of Type B
				78	L-RNA(mirror image isomer)	BVBSX 3X 4;X 3=C or disappearance, X 4=U or disappearance	Formula-the 6-3 ' of Type B
79	L-RNA(mirror image isomer)	GUGCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGCAC	197-B2
				80	L-RNA(mirror image isomer)	AGCGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACGCU	191-D5-001
81	L-RNA(mirror image isomer)	GUGUUGCGGAGGUUAGGGCUAGAAGUCGGUCAGCAGCAC	197-H1
				82	L-RNA(mirror image isomer)	CGUGCGCUUGAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUCACG	190-A3-001
83	L-RNA(mirror image isomer)	AGCGUGAAGGGGUUAGGGCUCGAAGUCGGCUGACACGCU	191-A5

Table 1(F)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				84	L-RNA(mirror image isomer)	GUGCUGCGGGGGUUAGGGCUCGAAGUCGGCCCGCAGCAC	197-H3
85	L-RNA(mirror image isomer)	GUGUUCCCGGGGUUAGGGCUUGAAGUCGGCCGGCAGCAC	197-B1
				86	L-RNA(mirror image isomer)	GUGUUGCAGGGGUUAGGGCUUGAAGUCGGCCUGCAGCAC	197-E3
87	L-RNA(mirror image isomer)	GUGCUGCGGGGGUUAGGGCUCAAAGUCGGCCUGCAGCAC	197-H2
				88	L-RNA(mirror image isomer)	GUGCUGCCGGGGUUAGGGCUAA-AGUCGGCCGACAGCAC	197-D1
89	L-RNA(mirror image isomer)	GUGCUGUGGGGGUCAGGGCUAGAAGUCGGCCUGCAGCAC	197-D2
				90	L-RNA(mirror image isomer)	GGUYAGGGCUHRX AAGUCGG;X A=A or disappearance	Formula-1 of C type
91	L-RNA(mirror image isomer)	GGUYAGGGCUHRAAGUCGG	Formula-2 of C type
				92	L-RNA(mirror image isomer)	GGUYAGGGCUHRAGUCGG	Formula-3 of C type
93	L-RNA(mirror image isomer)	GGUUAGGGCUHGAAGUCGG	Formula-4 of C type
				94	L-RNA(mirror image isomer)	UGAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUCA	190-A3-003
95	L-RNA(mirror image isomer)	GAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUC	190-A3-004
				96	L-RNA(mirror image isomer)	GGGGUUAGGGCUUAAAGUCGGCUGAUUCU	190-A3-007
97	L-RNA(mirror image isomer)	GCGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACGC	191-D5-002
				98	L-RNA(mirror image isomer)	CGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACG	191-D5-003
99	L-RNA(mirror image isomer)	CGGGCGAGGUUAGGGCUAGAAGUCGGUCGACCG	191-D5-004
				100	L-RNA(mirror image isomer)	CGGGCGAGGUUAGGGCUAGAAGUCGGUCGCCCG	191-D5-005

Table 1(G)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				101	L-RNA(mirror image isomer)	CGGCGAGGUUAGGGCUAGAAGUCGGUCGCCG	191-D5-006
102	L-RNA(mirror image isomer)	CGGGAGGUUAGGGCUAGAAGUCGGUCCCG	191-D5-007
				103	L-RNA(mirror image isomer)	GGGAGGUUAGGGCUAGAAGUCGGUCCC	191-D5-010
104	L-RNA(mirror image isomer)	CCGCGGUUAGGGCUAGAAGUCGGGCGG	191-D5-017
				105	L-RNA(mirror image isomer)	CCCGGGUUAGGGCUAGAAGUCGGCGGG	191-D5-029
106	L-RNA(mirror image isomer)	GGCGGGUUAGGGCUAGAAGUCGGCGCC	191-D5-024
				107	L-RNA(mirror image isomer)	CCCGCGGUUAGGGCUAGAAGUCGGGCGGG	191-D5-017-29a
108	L-RNA(mirror image isomer)	GCCGCGGUUAGGGCUAGAAGUCGGGCGGC	191-D5-017-29b
				109	L-RNA(mirror image isomer)	CCCCGGGUUAGGGCUAGAAGUCGGCGGGG	191-D5-019-29a
110	L-RNA(mirror image isomer)	CGGCGGGUUAGGGCUAGAAGUCGGCGCCG	191-D5-024-29a
				111	L-RNA(mirror image isomer)	GGGCGGGUUAGGGCUAGAAGUCGGCGCCC	191-D5-024-29b
112	L-RNA(mirror image isomer)	UGCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGCA	197-B2-001
				113	L-RNA(mirror image isomer)	GCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGC	197-B2-002
114	L-RNA(mirror image isomer)	CUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAG	197-B2-003
				115	L-RNA(mirror image isomer)	UGCGGGGGUUAGGGCUAGAAGUCGGCCUGCA	197-B2-004
116	L-RNA(mirror image isomer)	GCGGGGGUUAGGGCUAGAAGUCGGCCUGC	197-B2-005

Table 1(H)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				117	L-RNA(mirror image isomer)	GCCGGGGUUAGGGCUAGAAGUCGGCCGGC	197-B2-006
118	L-RNA(mirror image isomer)	GGCCGGGGUUAGGGCUAGAAGUCGGCCGGCC	197-B2-006-31a
				119	L-RNA(mirror image isomer)	CGCCGGGGUUAGGGCUAGAAGUCGGCCGGCG	197-B2-006-31b
120	L-RNA(mirror image isomer)	RKSBUSNVGR	Formula-the 5-5 ' of C type
				121	L-RNA(mirror image isomer)	YYNRCASSMY	Formula-the 5-3 ' of C type
122	L-RNA(mirror image isomer)	RKSBUGSVGR	Formula-the 6-5 ' of C type
				123	L-RNA(mirror image isomer)	YCNRCASSMY	Formula-the 6-3 ' of C type
124	L-RNA(mirror image isomer)	X SSSSV;X s=S or disappearance	Formula-the 7-5 ' of C type
				125	L-RNA(mirror image isomer)	BSSSX S;X s=S or disappearance	Formula-the 7-3 ' of C type
126	L-RNA(mirror image isomer)	SGGSV	Formula-the 8-5 ' of C type
				127	L-RNA(mirror image isomer)	YSCCS	Formula-the 8-3 ' of C type
128	L-RNA(mirror image isomer)	GCSGG	Formula-the 9-5 ' of C type
				129	L-RNA(mirror image isomer)	CCKGC	Formula-the 9-3 ' of C type
130	L-RNA(mirror image isomer)	SSSSR	Formula-the 10-5 ' of C type
				131	L-RNA(mirror image isomer)	YSBSS	Formula-the 10-3 ' of C type

Table 1(J)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				145	D-RNA(is fit)	GCUGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCAGC	192-A10-001
146	D-RNA(is fit)	GCUGUGAAAGUAACAUGUCAAUGAAAGGUAACCACAGC	192-G10
				147	D-RNA(is fit)	GCUGUGAAAGUAACACGUCAAUGAAAGGUAACCGCAGC	192-F10
148	D-RNA(is fit)	GCUGUGAAAGUAACACGUCAAUGAAAGGUAACCACAGC	192-B11
				149	D-RNA(is fit)	GCUGUAAAAGUAACAUGUCAAUGAAAGGUAACUACAGC	192-C9
150	D-RNA(is fit)	GCUGUAAAAGUAACAAGUCAAUGAAAGGUAACUACAGC	192-E10
				151	D-RNA(is fit)	GCUGUGAAAGUAACAAGUCAAUGAAAGGUAACCACAGC	192-C10
152	D-RNA(is fit)	GCAGUGAAAGUAACAUGUCAAUGAAAGGUAACCACAGC	192-D11
				153	D-RNA(is fit)	GCUGUGAAAGUAACAUGUCAAUGAAAGGUAACCACUGC	192-G11
154	D-RNA(is fit)	GCUAUGAAAGUAACAUGUCAAUGAAAGGUAACCAUAGC	192-H11
				155	D-RNA(is fit)	GCUGCGAAAGCGACAUGUCAAUGAAAGGUAGCCGCAGC	192-D10
156	D-RNA(is fit)	GCUGUGAAAGCAACAUGUCAAUGAAAGGUAGCCACAGC	192-E9
				157	D-RNA(is fit)	GCUGUGAAAGUAACAUGUCAAUGAAAGGUAGCCGCAGC	192-H9
158	D-RNA(is fit)	AGCGUGAAAGUAACACGUAAAAUGAAAGGUAACCACGCU	191-A6
				159	D-RNA(is fit)	CUGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCAG	192-A10-002
160	D-RNA(is fit)	UGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCA	192-A10-003

Table 1(K)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				161	D-RNA(is fit)	GUGAAAGCAACAUGUCAAUGAAAGGUAGCCGC	192-A10-004
162	D-RNA(is fit)	UGAAAGCAACAUGUCAAUGAAAGGUAGCCG	192-A10-005
				163	D-RNA(is fit)	GAAAGCAACAUGUCAAUGAAAGGUAGCC	192-A10-006
164	D-RNA(is fit)	AAAGCAACAUGUCAAUGAAAGGUAGC	192-A10-007
				165	D-RNA(is fit)	GCGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCGC	192-A10-008
166	D-RNA(is fit)	GCGCGAAAGCAACAUGUCAAUGAAAGGUAGCCGCGC	192-A10-015
				167	D-RNA(is fit)	GCGGAAAGCAACAUGUCAAUGAAAGGUAGCCCGC	192-A10-014
168	D-RNA(is fit)	CGUGAAAGCAACAUGUCAAUGAAAGGUAGCCGCG	192-A10-016
				169	D-RNA(is fit)	GCGCAAAGCAACAUGUCAAUGAAAGGUAGCGUGC	192-A10-017
170	D-RNA(is fit)	GUGCAAAGCAACAUGUCAAUGAAAGGUAGCGCGC	192-A10-018
				171	D-RNA(is fit)	CGCGAAAGCAACAUGUCAAUGAAAGGUAGCCGUG	192-A10-019
172	D-RNA(is fit)	GGGCAAAGCAACAUGUCAAUGAAAGGUAGCGCCC	192-A10-020
				173	D-RNA(is fit)	GGCCAAAGCAACAUGUCAAUGAAAGGUAGCGGCC	192-A10-021
174	D-RNA(is fit)	GCCCAAAGCAACAUGUCAAUGAAAGGUAGCGGGC	192-A10-022
				175	D-RNA(is fit)	CCCCAAAGCAACAUGUCAAUGAAAGGUAGCGGGG	192-A10-023
176	D-RNA(is fit)	AGCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACGCU	193-C2-001

Table 1(L)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				177	D-RNA(is fit)	AGCGUGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGUACGCU	193-G2-001
178	D-RNA(is fit)	AGCGUGGUGUGAUCUAGAUGUAAUGGCUGAUCCUAGUCAGGUGCGCU	193-F2-001
				179	D-RNA(is fit)	GCGAGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCGC	193-G1-002
180	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCGC	193-D2-002
				181	D-RNA(is fit)	GCAUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUGCCC	193-A1-002
182	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAAUGGCUGAUCCUAGUCAGGGACGC	193-D3-002
				183	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAGAGGCUGAUCCUAGUCAGGUACGC	193-B3-002
184	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAAAGGCUGAUCCUAGUCAGGUACGC	193-H3-002
				185	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGUUCCUAGUCAGGUAUGC	193-E3-002
186	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUUAGGUACGC	193-D1-002
				187	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACGC	193-C2-002
188	D-RNA(is fit)	CGUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUACG	193-C2-003
				189	D-RNA(is fit)	GUGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUAC	193-C2-004
190	D-RNA(is fit)	UGGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGUA	193-C2-005
				191	D-RNA(is fit)	GGUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGGU	193-C2-006

Table 1(M)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				192	D-RNA(is fit)	GUGUGAUCUAGAUGUAGUGGCUGAUCCUAGUCAGG	193-C2-007
193	D-RNA(is fit)	GCGUGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGUACGC	193-G2-012
				194	D-RNA(is fit)	GCGCGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGCGCGC	193-G2-013
195	D-RNA(is fit)	GCGCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGCGC	193-G2-014
				196	D-RNA(is fit)	GGGCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGCCC	193-G2-015
197	D-RNA(is fit)	GGCCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGGCC	193-G2-016
				198	D-RNA(is fit)	GCCCGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGGGGC	193-G2-017
199	D-RNA(is fit)	GUGCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGCAC	197-B2
				200	D-RNA(is fit)	AGCGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACGCU	191-D5-001
201	D-RNA(is fit)	GUGUUGCGGAGGUUAGGGCUAGAAGUCGGUCAGCAGCAC	197-H1
				202	D-RNA(is fit)	CGUGCGCUUGAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUCACG	190-A3-001
203	D-RNA(is fit)	AGCGUGAAGGGGUUAGGGCUCGAAGUCGGCUGACACGCU	191-A5
				204	D-RNA(is fit)	GUGCUGCGGGGGUUAGGGCUCGAAGUCGGCCCGCAGCAC	197-H3
205	D-RNA(is fit)	GUGUUCCCGGGGUUAGGGCUUGAAGUCGGCCGGCAGCAC	197-B1

Table 1(N)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				206	D-RNA(is fit)	GUGUUGCAGGGGUUAGGGCUUGAAGUCGGCCUGCAGCAC	197-E3
207	D-RNA(is fit)	GUGCUGCGGGGGUUAGGGCUCAAAGUCGGCCUGCAGCAC	197-H2
				208	D-RNA(is fit)	GUGCUGCCGGGGUUAGGGCUAA-AGUCGGCCGACAGCAC	197-D1
209	D-RNA(is fit)	GUGCUGUGGGGGUCAGGGCUAGAAGUCGGCCUGCAGCAC	197-D2
				210	D-RNA(is fit)	UGAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUCA	190-A3-003
211	D-RNA(is fit)	GAGAUAGGGGUUAGGGCUUAAAGUCGGCUGAUUCUC	190-A3-004
				212	D-RNA(is fit)	GGGGUUAGGGCUUAAAGUCGGCUGAUUCU	190-A3-007
213	D-RNA(is fit)	GCGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACGC	191-D5-002
				214	D-RNA(is fit)	CGUGGCGAGGUUAGGGCUAGAAGUCGGUCGACACG	191-D5-003
215	D-RNA(is fit)	CGGGCGAGGUUAGGGCUAGAAGUCGGUCGACCG	191-D5-004
				216	D-RNA(is fit)	CGGGCGAGGUUAGGGCUAGAAGUCGGUCGCCCG	191-D5-005
217	D-RNA(is fit)	CGGCGAGGUUAGGGCUAGAAGUCGGUCGCCG	191-D5-006
				218	D-RNA(is fit)	CGGGAGGUUAGGGCUAGAAGUCGGUCCCG	191-D5-007
219	D-RNA(is fit)	GGGAGGUUAGGGCUAGAAGUCGGUCCC	191-D5-010
				220	D-RNA(is fit)	CCGCGGUUAGGGCUAGAAGUCGGGCGG	191-D5-017
221	D-RNA(is fit)	CCCGGGUUAGGGCUAGAAGUCGGCGGG	191-D5-029
				222	D-RNA(is fit)	GGCGGGUUAGGGCUAGAAGUCGGCGCC	191-D5-024
223	D-RNA(is fit)	CCCGCGGUUAGGGCUAGAAGUCGGGCGGG	191-D5-017-29a

Table 1(O)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				224	D-RNA(is fit)	GCCGCGGUUAGGGCUAGAAGUCGGGCGGC	191-D5-017-29b
225	D-RNA(is fit)	CCCCGGGUUAGGGCUAGAAGUCGGCGGGG	191-D5-019-29a
				226	D-RNA(is fit)	CGGCGGGUUAGGGCUAGAAGUCGGCGCCG	191-D5-024-29a
227	D-RNA(is fit)	GGGCGGGUUAGGGCUAGAAGUCGGCGCCC	191-D5-024-29b
				228	D-RNA(is fit)	UGCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGCA	197-B2-001
229	D-RNA(is fit)	GCUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAGC	197-B2-002
				230	D-RNA(is fit)	CUGCGGGGGUUAGGGCUAGAAGUCGGCCUGCAG	197-B2-003
231	D-RNA(is fit)	UGCGGGGGUUAGGGCUAGAAGUCGGCCUGCA	197-B2-004
				232	D-RNA(is fit)	GCGGGGGUUAGGGCUAGAAGUCGGCCUGC	197-B2-005
233	D-RNA(is fit)	GCCGGGGUUAGGGCUAGAAGUCGGCCGGC	197-B2-006
				234	D-RNA(is fit)	GGCCGGGGUUAGGGCUAGAAGUCGGCCGGCC	197-B2-006-31a
235	D-RNA(is fit)	CGCCGGGGUUAGGGCUAGAAGUCGGCCGGCG	197-B2-006-31b
				236	D-RNA(is fit)	CGUGGUCCGUUGUGUCAGGUCUAUUCGCCCCGGUGCAGGGCAUCCGCG	194-A2-001
237	D-RNA(is fit)	GCAGUGUGACGCGGACGUGAUAGGACAGAGCUGAUCCCGCUCAGGUGAG	196-B12-003
				238	D-RNA(is fit)	CAACAGCAGUGUGACGCGGACGUGAUAGGACAGAGCUGAUCCCGCUCAG	196-B12-004

Table 1(P)

Seq.-ID	RNA/ peptide	Sequence	Internal reference number
				239	L-RNA(mirror image isomer)	5’-PEG-UAAGGAAACUCGGUCUGAUGCGGUAGCGCUGUGCAGAGCU	The contrast mirror image isomer of PEGization
240	L-RNA(mirror image isomer)	GATCACACCACGC-(C18-PEG-introns)-(C18-PEG-introns)-1-NH 2-3’	193-G2-012-5 '-PEG capture probe
				241	L-RNA(mirror image isomer)	5’-NH 2-(C18-PEG-introns)-(C18-PEG-introns)-GCGUACCUGAC	193-G2-012-5 '-PEG detection probes

Accompanying drawing summary

The present invention further illustrates by accompanying drawing, embodiment and sequence table, can obtain other feature, embodiment and advantage, wherein from these accompanying drawings, embodiment and sequence table

Fig. 1 shows the sequence alignment in conjunction with the relevant RNA part of people SDF-1, has wherein marked in a preferred embodiment with its integral body for requisite sequence motifs in conjunction with people SDF-1 (" A type ");

Fig. 2 A shows the derivative (the people SDF-1RNA part of " A type " sequence motifs) of RNA ligand 1 92-A10-001;

Fig. 2 B shows the derivative (the people SDF-1RNA part of " A type " sequence motifs) of RNA ligand 1 92-A10-001;

Fig. 3 shows the sequence alignment in conjunction with the relevant RNA part of people SDF-1, has wherein marked in a preferred embodiment with its integral body for requisite sequence motifs in conjunction with people SDF-1 (" Type B ");

Fig. 4 A shows the derivative (the people SDF-1RNA part of " Type B " sequence motifs) of RNA ligand 1 93-C2-001 and 193-G2-001;

Fig. 4 B shows the derivative (the people SDF-1RNA part of " Type B " sequence motifs) of RNA ligand 1 93-C2-001 and 193-G2-001;

Fig. 5 shows the sequence alignment in conjunction with the relevant RNA part of people SDF-1, has wherein marked in a preferred embodiment with its integral body for requisite sequence motifs in conjunction with people SDF-1 (" C type ");

Fig. 6 shows the derivative (the people SDF-1RNA part of " C type " sequence motifs) of RNA ligand 1 90-A3-001;

Fig. 7 A shows the derivative (the people SDF-1RNA part of " C type " sequence motifs) of RNA ligand 1 90-D5-001;

Fig. 7 B shows the derivative (the people SDF-1RNA part of " C type " sequence motifs) of RNA ligand 1 90-D5-001;

Fig. 8 shows the derivative (the people SDF-1RNA part of " C type " sequence motifs) of RNA ligand 1 97-B2;

Fig. 9 shows other RNA parts in conjunction with people SDF-1;

Let others have a look at SDF-1 inducibility Jurkat human T cell leukemia cell's chemotaxis of Figure 10, wherein Jurkat human T cell leukemia cell, to the SDF-1 of various concentration, move after 3 hours, obtain the dose-response curve about people SDF-1, be expressed as the fluorescent signal changing with SDF-1 concentration;

The let others have a look at result of the fit 192-A10-001 of SDF-1 associativity and the binding analysis of biotinylated people D-SDF-1 at 37 ℃ of Figure 11, is expressed as the fit combination changing with biotinylated people D-SDF-1 concentration;

Figure 12 is shown in the chemotactic effect of the people SDF-1 associativity mirror image isomer 192-A10-001 recording in chemotactic assay experiment; Allow cell to 0.3nM people SDF-1(at 37 ℃ with the mirror image isomer 192-A10-001 preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 192-A10-001 concentration;

Figure 13 fit 192-A10-001 of SDF-1 associativity that lets others have a look at, 192-F10-001, 192-C9-001, 192-E10-001, 192-C10-001, 192-D11-001, 192-G11-001, 192-H11-001, 192-D10-001, the result of 192-E9-001 and 192-H9-001 and the competitive binding analysis of biotinylated people D-SDF-1 at 37 ℃, the unlabelled fit 192-A10-001 being expressed as at 1nM and 5nM, 192-F10-001, 192-C9-001, 192-E10-001, 192-C10-001, 192-D11-001, 192-G11-001, 192-H11-001, 192-D10-001, under 192-E9-001 and 192-H9-001, through the fit 192-A10-001(of mark as by unlabelled fit alternative with reference to) combination,

The let others have a look at result of the fit 192-A10-008 of SDF-1 associativity and the binding analysis of biotinylated people D-SDF-1 at 37 ℃ of Figure 14, is expressed as the fit combination changing with biotinylated people D-SDF-1 concentration;

Figure 15 shows Biacore 2000 influence charts (sensorgram), and it is passed amine coupling process and is fixed on PioneerF1 induction chip to have marked people SDF-1 associativity mirror image isomer 192-A10-008 and people SDF-1() K of combination _dbe worth, be expressed as the response value (RU) of time to time change; List in addition switch rate and the K of mirror image isomer 192-A10-008 and 192-A10-001 _dvalue;

Figure 16 shows the chemotactic effect of testing the people SDF-1 associativity mirror image isomer 192-A10-008 recording by chemotactic assay; Allow cell to 0.3nM people SDF-1(at 37 ℃ with the mirror image isomer 192-A10-008 preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 192-A10-008 concentration;

Figure 17 shows Biacore 2000 influence charts, and it is passed amine coupling process and is fixed on PioneerF1 induction chip to have marked mirror image isomer 193-G2-01 and people SDF-1() K of combination _dbe worth, be expressed as the response value (RU) of time to time change; List in addition switch rate and the K of mirror image isomer 193-G2-001 _dvalue;

The let others have a look at result of the fit 193-G2-012 of SDF-1 associativity and the binding analysis of biotinylated people D-SDF-1 at 37 ℃ of Figure 18, is expressed as the fit combination changing with biotinylated people D-SDF-1 concentration;

Figure 19 fit 190-A3-001 of SDF-1 associativity that lets others have a look at, 190-A3-003, 190-A3-004, 190-A3-007, 191-D5-001, 191-D5-002, 191-D5-003, 191-D5-004, 191-D5-005, the result of 191-D5-006 and 191-D5-007 and the competitive binding analysis of biotinylated people D-SDF-1 at 37 ℃, be expressed as at 500nM, the unlabelled fit 190-A3-001 of 50nM and 10nM, 190-A3-003, 190-A3-004, 190-A3-007, 191-D5-001, 191-D5-002, 191-D5-003, 191-D5-004, 191-D5-005, under 191-D5-006 and 191-D5-007, through the fit 190-A3-001 of mark or 191-D5-001(as by unlabelled fit alternative with reference to) combination,

The let others have a look at result of the fit 190-A3-004 of SDF-1 associativity and 191-D5-007 and the binding analysis of biotinylated people D-SDF-1 at 37 ℃ of Figure 20, is expressed as the fit combination changing with biotinylated people D-SDF-1 concentration;

Figure 21 shows Biacore 2000 influence charts, and it is passed amine coupling process and is fixed on PioneerF1 induction chip to have marked mirror image isomer 191-D5-007 and people SDF-1() K of combination _dbe worth, be expressed as the response value (RU) of time to time change; List in addition switch rate and the K of mirror image isomer 191-D5-007 _dvalue;

Figure 22 shows the chemotactic effect of testing the people SDF-1 associativity mirror image isomer 190-A3-004 recording by chemotactic assay; Allow cell to 0.3nM people SDF-1(at 37 ℃ with the mirror image isomer 190-A3-004 preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 190-A3-004 concentration;

Figure 23 A shows the chemotactic effect of testing people SDF-1 associativity mirror image isomer the 193-G2-012-5 '-PEG, 197-B2-006-5 '-PEG, 191-D5-007-5 '-PEG and the 191-A10-008-5 '-PEG that record by chemotactic assay; Allow cell to 0.3nM people SDF-1(at 37 ℃ with mirror image isomer 193-G2-012-5 '-PEG, 197-B2-006-5 '-PEG, 191-D5-007-5 '-PEG and the 191-A10-008-5 ' of various amounts-PEG preincubation) migration, be expressed as the per-cent with mirror image isomer 193-G2-012-5 '-PEG, 197-B2-006-5 '-PEG, 191-D5-007-5 '-PEG and 191-A10-008-5 '-contrast that PEG concentration changes;

Figure 23 B shows by chemotactic assay and tests the people SDF-1 associativity mirror image isomer 197-B2-006-5 ' PEG that records and the chemotactic effect of 197-B2-006-31b-5 '-PEG; Allow cell to 0.3nM people SDF-1(at 37 ℃ with mirror image isomer 197-B2-006-5 ' PEG and 197-B2-006-31b-5 '-PEG preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 197-B2-006-5 ' PEG and 197-B2-006-31b-5 '-PEG concentration;

Figure 24 A shows Biacore 2000 influence charts, and it is passed amine coupling process and is fixed on PioneerF1 induction chip to have marked mirror image isomer 193-G2-012-5 '-PEG, 191-A10-008-5 '-PEG and 191-A10-001-5 '-PEG and people SDF-1() K of combination _dbe worth, be expressed as the response value (RU) of time to time change;

Figure 24 B shows Biacore 2000 influence charts, and it is passed amine coupling process and is fixed on PioneerF1 induction chip to have marked mirror image isomer 197-B2-006-5 ' PEG, 197-B2-006-31b-5 '-PEG and 191-D5-007-5 '-PEG and people SDF-1() K of combination _dbe worth, be expressed as the response value (RU) of time to time change;

Figure 25 A shows by chemotactic assay and tests the people SDF-1 associativity mirror image isomer 192-A10-001, the 192-A10-001-5 '-HES130 that record and the chemotactic effect of 192-A10-001-5 '-HES100; Allow cell to 0.3nM people SDF-1(at 37 ℃ with mirror image isomer 192-A10-001,192-A10-001-5 '-HES130 and 192-A10-001-5 '-HES100 preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 192-A10-001,192-A10-001-5 '-HES130 and 192-A10-001-5 '-HES100 concentration;

Figure 25 B shows by chemotactic assay and tests the people SDF-1 associativity mirror image isomer 192-A10-001, the 192-A10-001-5 '-PEG30 that record and the chemotactic effect of 192-A10-001-5 '-PEG40; Allow cell to 0.3nM people SDF-1(at 37 ℃ with mirror image isomer 192-A10-001,192-A10-001-5 '-PEG30 and 192-A10-001-5 '-PEG40 preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 192-A10-001,192-A10-001-5 '-PEG30 and 192-A10-001-5 '-PEG40 concentration;

Figure 26 shows the chemotactic effect of testing the contrast mirror image isomer recording by chemotactic assay; Allow cell to 0.3nM people or mouse SDF-1(at 37 ℃ with various amounts contrast mirror image isomer preincubation) migration, be expressed as the per-cent of the contrast changing with contrast mirror image isomerism bulk concentration;

Figure 27 shows mouse SDF-1 inducibility Jurkat human T cell leukemia cell's chemotaxis, wherein Jurkat human T cell leukemia cell, to various SDF-1 concentration migrations, after 3 hours, has obtained the dose-response curve about SDF-1, is expressed as fluorescent signal;

Figure 28 shows by chemotactic assay and tests the people SDF-1 associativity mirror image isomer 192-A10-001 that records and the chemotactic effect of 191-D5-007-5 ' PEG; Allow cell to 0.3nM people SDF-1(at 37 ℃ with mirror image isomer 192-A10-001 and 191-D5-007-5 ' the PEG preincubation of various amounts) migration, be expressed as the per-cent of the contrast changing with mirror image isomer 192-A10-001 and 191-D5-007-5 ' PEG concentration;

Figure 29 show SDF-1 associativity mirror image isomer 192-A10-001 end user [ ¹²⁵j] the CXCR4-receptors bind of-SDF-1 α mirror image isomer 192-A10-001 preincubation of various amounts (at the 37 ℃ with) effect in measuring, according to mirror image isomer 192-A10-001 concentration mark and draw specific binding [ ¹²⁵i]-SDF-1 α; With

Figure 30 inhibition that SDF-1 associativity mirror image isomer 192-A10-001 stimulates the map kinase of the cell of the expression CXCR4 that uses 1nM people SDF-1 α and produce of leting others have a look at;

Figure 31 shows the aortic annulus inhibition that the contrast mirror image isomer of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and PEGization sprouts to SDF-1 inducibility in mensuration (aortic ring sprouting assay) of sprouting, wherein the ring from rat aorta is embedded in collagen stroma, and with containing or not containing 6 days (a: contrast of SDF-1 incubation of mirror image isomer; B:10nM SDF-1; C:10nM SDF-1+1 μ M people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG; The contrast mirror image isomer of d:10nM SDF-1+1 μ M PEGization);

Figure 32 show aortic annulus sprout measure in the inhibition that SDF-1 inducibility is sprouted of the contrast mirror image isomer of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and PEGization, wherein with mean value +/-SD show the index that sprouts (every condition 5 is encircled) ( ^*: (the Mann-Whitney-checks significantly different from contrast of SDF-1 value; P=0.009); ^*: SDF-1+ is in conjunction with (the Mann-Whitney-checks significantly different from the value of SDF-1 of the value of mirror image isomer 193-G2-012-5 '-PEG of people SDF-1; P=0.028);

Figure 33 shows that the rat plasma SDF-1 level of processing with end user SDF-1 associativity mirror image isomer 193-G2-012-5 ' not-PEG compares, the level of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and SDF-1 in rat plasma after intravenous injection people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG, wherein within the time of 96 hours, measure blood plasma in people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and SDF-1 level.

Embodiment

Embodiment 1: people SDF-1 binding nucleic acids

Use biotinylated people D-SDF-1 as target, can produce several people SDF-1 binding nucleic acids, the nucleotide sequence of described nucleic acid is shown in Fig. 1-9.Use biotinylated people D-SDF-1 to characterize described nucleic acid in fit (being D-nucleic acid) level, or use the SDF-1(L-SDF-1 of native configurations) in mirror image isomer level (being L-nucleic acid), characterize described nucleic acid.

Adopt and use the competitive or direct pull-down assay method of biotinylated people D-SDF-1 to use biotinylated people D-SDF-1 to analyze fit (embodiment 4).The SDF-1(L-SDF-1 of the surface plasmon resonance measurement amount of being undertaken by Biacore instrument 2000 (embodiment 6) and external chemotactic assay (embodiment 5) use native configurations) detected mirror image isomer.

The nucleic acid molecule so producing demonstrates different sequence motifs, and three kinds of main Types are defined in Fig. 1,2A and 2B(A type), Fig. 3,4A and 4B(B type), Fig. 5,6,7A, 7B and 8(C type).For the definition of nucleotide sequence motif, used IUPAC to abridge for uncertain Nucleotide:

Except as otherwise noted, the sequence of any nucleotide sequence or fragment and frame shows with the direction of 5 '->3 ' respectively.

1.1 A type SDF-1 binding nucleic acids

As shown in Figure 1, the sequence of all A type SDF-1 binding nucleic acids all comprises a core nucleotide sequence, and described core sequence both sides are connected with 5 '-and 3 '-terminal fragment that can phase mutual cross.But not this hybridization of certain generation in described molecule.

Adopt and use the direct and competitive pull-down assay method of biotinylated people D-SDF-1 to characterize described nucleic acid in fit level, to they are carried out to classification (embodiment 4) according to their bonding behavior.The sequence of selecting is synthesized to mirror image isomer (embodiment 3), and use the SDF-1(L-SDF of native configurations) according to cell in vitro, cultivate chemotactic assay method and detect (embodiment 5), and detect (embodiment 6) by the surface plasmon resonance measurement amount of using Biacore instrument 2000 to carry out.

The sequence of defined frame or fragment may be different between A type SDF-1 binding nucleic acids, and this has affected the binding affinity to SDF-1.Binding analysis based on carrying out being summarized as the different SDF-1 binding nucleic acids of A type SDF-1 binding nucleic acids, following core nucleotide sequence and nucleotide sequence thereof separately and more preferably essential in conjunction with SDF-1 with its integral body:

The core nucleotide sequence consensus sequence of the A type SDF-1 binding nucleic acids of all evaluations

(formula-1 of A type), wherein X _adisappearance or be ' A '.If ' A ' disappearance, can be summarised as the sequence of core nucleotide sequence formula-2 of A type

in core nucleotide sequence, there is extra Nucleotide ' A ' and still in conjunction with the A type SDF-1 binding nucleic acids 191-A6(core nucleotide sequence of SDF-1:

) make to comprise alternative core nucleotide sequence (

formula-3 of A type).As the every other nucleic acid example of A type SDF-1 binding nucleic acids, according to the binding affinity of people SDF-1 being characterized to described A type SDF-1 binding nucleic acids 192-A10-001.Use pull-down binding assay (K _d=1.5nM, Figure 11) with by surface plasmon resonance measurement amount method (K _d=1.0nM, Figure 15) measure equilibrium association constant K _d.Use cell in vitro to cultivate the IC that chemotactic assay method is measured the 192-A10-001 of 0.12nM ₅₀(inhibition concentration 50%) (Figure 12).Then, by measuring the competitive pull-down combination of relative 192-A10-001, all A type SDF-1 binding nucleic acids (Figure 13 shown in Fig. 1 have been analyzed; Be not that all detected A type SDF-1 binding nucleic acids are shown in Figure 13).In these competitive assay, A type SDF-1 binding nucleic acids 192-B11 and 192-C10 show the binding affinity that equals 192-A10-001.Measure A type SDF-1 binding nucleic acids 192-G10,192-F10,192-C9,192-E10,192-D11,192-G11,192-H11 and 191-A6 and obtain more weak binding affinity.The binding affinity utmost point of A type SDF-1 binding nucleic acids 192-D10,192-E9 and 192-H9 is very weaker than 192-A10-001(Figure 13).

As mentioned above, A type SDF-1 binding nucleic acids 192-B11 and 192-C10 show the binding affinity to SDF-1 that equals 192-A10-001.But they list a little difference of demonstration at the nucleotides sequence of core nucleotide sequence.Therefore, can pass through nucleotide sequence

(formula-4 of A type) summarize three kinds in conjunction with the consensus sequence of the molecule of the almost equal high-affinity of having of SDF-1, wherein the nucleotide sequence of the core nucleotide sequence of 192-A10-001 (nucleotide sequence:

) representative has the nucleotide sequence of binding affinity of best A type SDF-1 binding nucleic acids.

5 or 6 Nucleotide in 6 Nucleotide of 5 '-terminal fragment of A type SDF-1 binding nucleic acids can with 6 Nucleotide of 3 '-terminal fragment of A type SDF-1 binding nucleic acids in corresponding 5 or 6 Nucleotide hybridization, thereby form end spiral.Although these Nucleotide are variable on several positions, different IPs thuja acid allows 5 '-and 5 or 6 hybridization in 6 Nucleotide separately of 3 '-terminal fragment.5 '-end and the 3 '-terminal fragment of the A type SDF-1 binding nucleic acids showing in Fig. 1 can be summarized as the general formula (' RSHRYR ', the formula-5-5 ' of A type) of 5 ' terminal fragment and the general formula (' YRYDSY ', the formula-5-3 ' of A type) of 3 '-terminal fragment.By measuring the competitive pull-down combination of relative initial molecule 192-A10-001 and 192-A10-008, analyzed the brachymemma derivative (Fig. 2 A and 2B) of A type SDF-1 binding nucleic acids 192-A10-001.These experiments show can be by 6 terminal nucleotide (5 ' ends: GCUGUG of 192-A10-001; 3 ' end: 5 Nucleotide (5 ' ends: CUGUG that CGCAGC) are reduced to derivative 192-A10-002; 3 ' end: CGCAG) and do not reduce binding affinity.Yet, when being truncated to 4 terminal nucleotide (5 ' ends: UGUG; 3 ' end: CGCA; 192-A10-003) or still less (192-A10-004/-005/-006/-007) causes the binding affinity of SDF-1 to reduce (Fig. 2 A).5 '-end and the 3 '-terminal fragment of the length of 5 and 4 Nucleotide of the derivative with A type SDF-1 binding nucleic acids 192-A10-001 of the mensuration showing in Fig. 2 A and Fig. 2 B can be summarised as to the general formula (' X of 5 '-terminal fragment ₂bBBS ', the formula-6-5 ' of A type) and the general formula (' SBBVX of 3 '-terminal fragment ₃'; Formula-the 6-3 ' of A type) in, X wherein ₂disappearance or be ' S ', X ₃disappearance or be ' S '.

5 '-with the nucleotide sequence of 3 '-terminal fragment, the binding affinity of A type SDF-1 binding nucleic acids is had to impact.This is not only shown by nucleic acid 192-F10 and 192-E10, but also shows (Fig. 2 B by the derivative of 192-A10-001; ).The core nucleotide sequence of 192-F10 and 192-E10 is identical with 192-B11 and 192-C10's, but comprises a little difference at 3 ' of 5 '-terminal fragment-end with at 5 ' of 3 '-terminal fragment-end, thereby causes binding affinity to reduce.

With ' GCGCG ' and ' CGCGC ' (192-A10-015) replace 5 ' of A type SDF-1 binding nucleic acids 192-A10-002-and 3 '-terminal nucleotide ' CUGUG ' and ' CGCAG ' cause binding affinity reduction, yet use ' GCGUG ' and ' CGCGC ' replacement (192-A10-008) cause with for identical (Fig. 2 B of 192-A10-002 binding affinity, Figure 15, Figure 12, Figure 16).In addition, relatively 192-A10-001 or derivatives thereof 192-A10-008(both there is the identical binding affinity to SDF-1) binding affinity, will have separately 45 '-and 9 derivatives (192-A10-014/-015/-016/-017/-018/-019/-020/-021/-022/-023) of the A type SDF-1 binding nucleic acids 192-A10-001 of 3 '-terminal nucleotide detect as fit.All clones show and are weaker than, are very weaker than or the utmost point is very weaker than 192-A10-001(6 Nucleotide and forms end spiral) or there is 192-A10-008(Fig. 2 B of 5 ends) the binding affinity to SDF-1., 5 ' therefore-and the consecutive nucleotides number of the Nucleotide of 3 '-terminal fragment for very important with effective combination of SDF-1.As shown in for A type SDF-1 binding nucleic acids 192-A10-002 and 192-A10-08,5 '-and the preferably combination of 3 '-terminal fragment be ' CUGUG ' and ' CGCAG ' (5 ' of A type SDF-1 binding nucleic acids 192-A10-002-and 3 '-terminal fragment) and ' GCGUG ' and ' CGCGC ' (5 ' of A type SDF-1 binding nucleic acids 192-A10-008-with 3 '-terminal fragment).

Yet, by combining 5 ' of all tested A type SDF-1 binding nucleic acids-and 3 '-terminal fragment, show that the general formula of 5 '-terminal fragment of A type SDF-1 binding nucleic acids is ' X ₁x ₂nNBV ' (formula-7-5 ' of A type), the general formula of 3 '-terminal fragment of A type SDF-1 binding nucleic acids is ' BNBNX ₃x ₄' (formula-7-3 ' of A type), wherein

X ₁' R ' or disappearance, X ₂' S ', X ₃' S ' and X ₄' Y ' or disappearance;

Or

X ₁disappearance, X ₂' S ' or disappearance, X ₃' S ' or disappearance and X ₄disappearance.

1.2 Type B SDF-1 binding nucleic acids

As shown in Figure 3, the sequence of all Type B SDF-1 binding nucleic acids all comprises a core nucleotide sequence, and described core sequence both sides are connected with 5 '-and 3 '-terminal fragment that can phase mutual cross.But not this hybridization of certain generation in described molecule.

Adopt and use the direct and competitive pull-down assay method of biotinylated people D-SDF-1 to characterize described nucleic acid in fit level, to they are carried out to classification (embodiment 4) according to their bonding behavior.The sequence of selecting is synthesized to mirror image isomer (embodiment 3), and use the SDF-1(L-SDF of native configurations) according to cell in vitro, cultivate chemotactic assay method and detect (embodiment 5), and by using Biacore instrument 2000 to detect (embodiment 6) according to surface plasmon resonance measurement amount method.

The sequence of defined frame or fragment may be different between Type B SDF-1 binding nucleic acids, and this has affected the binding affinity to SDF-1.Binding analysis based on carrying out being summarized as the different SDF-1 binding nucleic acids of Type B SDF-1 binding nucleic acids, following core nucleotide sequence and nucleotide sequence thereof separately and more preferably essential in conjunction with SDF-1 with its integral body:

The core nucleotide sequence consensus sequence of the Type B SDF-1 binding nucleic acids of all evaluations

(formula-1 of Type B).By measuring the K of the 1.5nM that relative A type SDF-1 binding nucleic acids 192-A10-001(measures in pull-down binding assay _d[Figure 11], the K of the 1.0nM measuring by surface plasma resonance method of masurement _d[Figure 15], the IC of 0.12nM ₅₀; [Figure 12]) competitive pull-down in conjunction with and analyzed Type B SDF-1 binding nucleic acids 193-G2-001,193-C2-001 and 193-F2-001 different on a position of core nucleotide sequence.In three kinds of tested Type B SDF-1 binding nucleic acids, each all demonstrates the combination to people SDF-1 that is better than A type SDF-1 binding nucleic acids 192-A10-001, wherein equally good (Fig. 3) of the binding affinity of 193-G2-001 and 193-C2-001 and 193-F2-001.Data show that difference in the nucleotide sequence of core nucleotide sequence of Type B SDF-1 binding nucleic acids 193-G2-001,193-C2-001 and 193-F2-001 is on the not impact of the binding affinity of SDF-1.For example,, according to the binding affinity of people SDF-1 being characterized to described Type B SDF-1 binding nucleic acids 193-G2-001.Use pull-down binding assay (K _d=0.3nM) with by surface plasmon resonance measurement amount method (K _d=0.5nM, Figure 17) measure equilibrium association constant K _d.Use cell in vitro to cultivate the IC that chemotactic assay method is measured the 193-G2-001 of 0.08nM ₅₀(inhibition concentration 50%).On the contrary, the Type B SDF-1 binding nucleic acids 193-B3-002 that the sequence of core nucleotide sequence is different, 193-H3-002,193-E3-002 and 193-D1-002 binding property poorer (Fig. 3).Therefore, there is raising the Type B SDF-1 binding nucleic acids of the binding affinity of SDF-1 is had and has sequence

the core nucleotide sequence of (formula-2 of Type B).

In 6 Nucleotide of 5 '-terminal fragment of Type B SDF-1 binding nucleic acids, have 4,5 or 6 Nucleotide can with 6 Nucleotide of 3 '-terminal fragment of Type B SDF-1 binding nucleic acids in corresponding 4,5 or 6 Nucleotide hybridization, thereby form end spiral.Although these Nucleotide are variable on several positions, different IPs thuja acid allows 5 '-and 5 or 6 hybridization in 6 Nucleotide separately of 3 '-terminal fragment.5 '-end and the 3 '-terminal fragment of the Type B SDF-1 binding nucleic acids showing in Fig. 3 can be summarised as to the general formula (formula-3-5 ' of Type B of 5 ' terminal fragment; ' X ₁gCRWG ', wherein X ₁' A ' or disappearance) and the general formula (formula-3-3 ' of Type B of 3 '-terminal fragment; ' KRYSCX ₄', X wherein ₄' U ' or disappearance).Type B SDF-1 binding nucleic acids 193-G1-002,193-D2-002,193-A1-002 and 193-D3-002 have more weak to SDF-1 binding affinity, although their core nucleotide sequences (formula-2 of Type B) total identical with 193-F2-001 with 193-C2-001,193-G2-001 are (Fig. 3).The disadvantageous binding property of Type B SDF-1 binding nucleic acids 193-G1-002,193-D2-002,193-A1-002 and 193-D3-002 can for by 5 '-and the few nucleotide and sequence of 3 '-terminal fragment due to.

By measuring the competitive pull-down combination of relative initial molecule 193-G2-001 and 193-G2-012, analyzed the brachymemma derivative (Fig. 4 A and 4B) of Type B SDF-1 binding nucleic acids 193-G2-001 and 193-C2-001.These experiments show 6 terminal nucleotide (5 ' ends: AGCGUG of Type B SDF-1 binding nucleic acids 193-G2-001 and 193-C2-001; 3 ' end: UACGCU) be reduced to 5 Nucleotide (5 ' ends: GCGUG; 3 ' end: UACGC) produce the molecule (193-C2-002 and 193-G2-012) with similar binding affinity.With pull-down binding assay, measure equilibrium association constant K _d(K _d=0.3nm, Figure 18).Yet, when being truncated to 4 terminal nucleotide (5 ' ends: CGUG; 3 ' end: UACG; 193-C2-003) or still less cause the binding affinity of SDF-1 to reduce when (193-C2-004,193-C2-005,193-C2-006,193-C2-007), described avidity can be by measuring (Fig. 4 A) with competitive pull-down binding assay.5 '-and the nucleotide sequence of 5 terminal nucleotide of 3 '-end there is respectively the impact on the binding affinity of Type B SDF-1 binding nucleic acids.With ' GCGCG ' and ' CGCGC ', (193-G2-013) replace 5 '-and 3 '-terminal nucleotide ' GCGUG ' and ' UACGC ' (193-C2-002,193-G2-12) cause binding affinity reduction.In addition, detected and there are 4 kinds of different derivatives (193-G2-014/-015/-016/-017) of Type B SDF-1 binding nucleic acids 193-GZ-001 that Nucleotide length is the end spiral of 4 base pairs.They all show the binding affinity of SDF-1 are reduced to (Fig. 4 B)., 5 ' therefore-and 3 '-terminal nucleotide sequence and length for effective combination of SDF-1 be essential.5 '-end and the 3 '-terminal fragment of length of 5 and 4 Nucleotide with the derivative of the Type B SDF-1 binding nucleic acids 193-C2-003 that shows in Fig. 4 A and 4B and 193-G2-012 can be summarized as the general formula (' X of 5 '-terminal fragment ₂sSBS ', the formula-4-5 ' of Type B, wherein X ₂disappearance or be ' G ') and the general formula (' BVSSX of 3 '-terminal fragment ₃', the formula-4-3 ' of Type B, wherein X ₃disappearance or be ' C ').As shown in for Type B SDF-1 binding nucleic acids 193-G2-001 and 193-C2-01 and their derivative 193-G2-012 and 193-C2-002,5 '-and the preferred embodiment of 3 '-terminal fragment be ' X ₁gCGUG ' (5 '-terminal fragment; The formula 5-5 ' of Type B) and ' UACGCX ₄' (3 '-terminal fragment; The formula 5-3 ' of Type B), X wherein ₁' A ' or disappearance, and X ₄' U ' or disappearance.

Yet, by combining 5 ' of all tested Type B SDF-1 binding nucleic acids-and 3 '-terminal fragment, show that the general formula of 5 '-terminal fragment of Type B SDF-1 binding nucleic acids is ' X ₁x ₂sVNS ' (formula-6-5 ' of Type B), the general formula of 3 '-terminal fragment of Type B SDF-1 binding nucleic acids is ' BVBSX ₃x ₄' (formula-6-3 ' of Type B), wherein

X ₁' A ' or disappearance, X ₂' G ', X ₃' C ' and X ₄' U ' or disappearance;

Or

X ₁disappearance, X ₂' G ' or disappearance, X ₃' C ' or disappearance and X ₄disappearance;

1.3 C type SDF-1 binding nucleic acids

As shown in Figure 5, the sequence of all C type SDF-1 binding nucleic acids all comprises a core nucleotide sequence, and described core sequence both sides are connected with 5 '-and 3 '-terminal fragment that can phase mutual cross.But not this hybridization of certain generation in described molecule.

Adopt and use the direct and competitive pull-down assay method of biotinylated people D-SDF-1 to characterize described nucleic acid in fit level, to they are carried out to classification (embodiment 4) according to their bonding behavior.The sequence of selecting is synthesized to mirror image isomer (embodiment 3), and use the SDF-1(L-SDF of native configurations) according to cell in vitro, cultivate chemotactic assay method and detect (embodiment 5), and by using Biacore instrument 2000 to detect (embodiment 6) according to surface plasmon resonance measurement amount method.

The sequence of defined frame or fragment may be different between C type SDF-1 binding nucleic acids, and this has affected the binding affinity to SDF-1.Binding analysis based on carrying out being summarized as the different SDF-1 binding nucleic acids of C type SDF-1 binding nucleic acids, following core nucleotide sequence and nucleotide sequence thereof separately and more preferably essential in conjunction with SDF-1 with its integral body:

The core nucleotide sequence consensus sequence of the C type SDF-1 binding nucleic acids of all evaluations

(formula-1 of C type), wherein X _adisappearance or be ' A '.Except C type SDF-1 binding nucleic acids 197-D1, the core nucleotide sequence of the sequence of the C type SDF-1 binding nucleic acids of all evaluations has nucleotide sequence

(formula-2 of C type).In core nucleotide sequence, lack a Nucleotide ' A ' and still in conjunction with the C type SDF-1 binding nucleic acids 197-D1(core nucleotide sequence of SDF-1:

) make to comprise alternative core nucleotide sequence (

formula-3 of C type).First, by measuring relative A type SDF-1 binding nucleic acids 192-A10-001(by pull-down assay method with by the K of surface plasmon resonance measurement amount method measurement _d=1.5nM; IC ₅₀=0.12nM) competitive pull-down in conjunction with and analyzed all C type SDF-1 binding nucleic acids shown in Fig. 5.In competitive assay, C type SDF-1 binding nucleic acids 191-D5-001,197-B2,190-A3-001,197-H1,197-H3 and 197-E3 show the binding affinity that is weaker than 192-A10-001.The binding affinity that records 191-A5,197-B1,197-D1,197-H2 and 197-D2 is weak (Fig. 5) very.By further competitive pull-down binding assay, surface plasmon resonance measurement amount method and external chemotactic assay method, further characterized described molecule or derivatives thereof.According to the binding affinity of people SDF-1 having been characterized to C type SDF-1 binding nucleic acids 191-D5-001, wherein by surface plasmon resonance measurement amount method, determine equilibrium association constant K _d(K _d=0.8nM, Figure 21).Use cell in vitro to cultivate the IC that chemotactic assay method is measured the 191-D5-001 of 0.2nM ₅₀(inhibition concentration 50%).By surface plasmon resonance measurement amount method, determine the binding affinity (K of C type SDF-1 binding nucleic acids 197-B2 to people SDF-1 _d=0.9nM), cell cultures chemotactic assay method analyzes the IC of its 0.2nM in vitro ₅₀(inhibition concentration 50%).It is similar to the binding affinity of SDF-1 (Fig. 5 and 8) that these data show that C type SDF-1 binding nucleic acids 191-D5-001 and 197-B2 have.

190-A3-001(48 Nucleotide of C type SDF-1 binding nucleic acids) the 5 '-terminal fragment that comprises 17 Nucleotide and 3 '-terminal fragment of 12 Nucleotide, wherein on the other hand, at 4 Nucleotide of 5 ' end of 5 '-terminal fragment and can phase mutual cross at 4 Nucleotide of 3 ' end of 3 '-terminal fragment, thereby form end spiral.In addition, the Nucleotide in 5 '-terminal fragment ' UGAGA ' also can with 3 '-terminal fragment in Nucleotide ' UCUCA ' hybridization, thereby form end spiral.5 '-terminal fragment of molecule 1 90-A3-001 be reduced in 8 Nucleotide (' GAGAUAGG ') and 3 '-terminal fragment, be reduced to 9 Nucleotide (' CUGAUUCUC ') (wherein 5 '-and 8,9 Nucleotide of 3 '-terminal fragment in 6 can phase mutual cross) on the binding affinity for SDF-1 without impact (190-A3-004; Fig. 6 and Figure 19).Use competitive pull-down binding assay (K _d=4.6nM, Figure 20) with by surface plasmon resonance measurement amount method (K _d=4.7nM) measure the equilibrium association constant K of 190-A3-004 _d.Use cell in vitro to cultivate the IC that chemotactic assay method is measured the 190-A3-004 of 0.1nM ₅₀(inhibition concentration 50%) (Figure 22).Yet, at 5 '-terminal fragment, be truncated to 2 Nucleotide and cause the extremely strong reduction (190-A3-007 of binding affinity; Fig. 6 and Figure 19).

C type SDF-1 binding nucleic acids 191-D5-001,197-B2 and 197-H1(core nucleotide sequence:

), 197-H3/191-A5(core nucleotide sequence:

) and 197-E3/197-B1(core nucleotide sequence:

) total almost identical core nucleotide sequence (formula-4 of C type; Nucleotide sequence:

).5 '-and 3 '-terminal fragment (197-H3 and 197-E3 have identical with 197-B2 5 '-with 3 '-terminal fragment) that 191-D5-001,197-B2 and 197-H1 are total not similar.Yet, 9 (191-D5-001,197-H1) Nucleotide in corresponding 10 (197-B2,197-E3,197-H3) Nucleotide of 5 '-terminal fragment or 10 Nucleotide can be hybridized (Fig. 5) with corresponding 10 Nucleotide (197-B2,197-E3,197-H3) of 3 '-terminal fragment or 9 (191-D5-001,197-H1) Nucleotide in 10 Nucleotide.Thereby, the nucleotide sequence that 5 '-terminal fragment of above-mentioned C type SDF-1 binding nucleic acids 197-B2,191-D5-001,197-H1,197-E3 and 197-H3 and 191-A5,197-B1,197-H2,197-D1 and 197-D2 comprises common general ' RKSBUSNVGR ' (formula-5-5 ' of C type).The nucleotide sequence that 3 '-terminal fragment of above-mentioned C type SDF-1 binding nucleic acids 197-B2,191-D5-001,197-H1,197-E3 and 197-H3 and 191-A5,197-B1,197-H2,197-D1 and 197-D2 comprises common general ' YYNRCASSMY ' (formula-5-3 ' of C type), wherein 5 ' and 3 '-terminal fragment of preferred C type SDF-1 binding nucleic acids 197-B2,191-D5-001,197-H1,197-E3 and 197-H3.Can by C type SDF-1 bind nucleic acid 197-B2,191-D5-001,197-H1,197-E3 and 197-H3 these preferably 5 '-and 3 '-terminal fragment be summarised as general formula ' RKSBUGSVGR ' (formula-6-5 ' of C type; 5 '-terminal fragment) and ' YCNRCASSMY ' (formula-6-3 ' of C type; 3 '-terminal fragment).

Build the derivative of the brachymemma of C type SDF-1 binding nucleic acids 191-D5-001, and with respect to initial molecule 191-D5-001, it is detected to (Fig. 7 A, Fig. 7 B and Figure 19) in competitive pull-down binding assay.First, as shown in Figure 7 A, first by 5 '-and the length of 3 '-terminal fragment from 10 Nucleotide (191-D5-001) separately, foreshorten to 7 Nucleotide (191-D5-004) separately, wherein in 10 of 5 '-terminal fragment and 3 '-terminal fragment Nucleotide (191-D5-001) 6 of 9 or 7 Nucleotide (191-D5-004) can phase mutual cross.Respectively from 5 '-and the Nucleotide of 3 '-terminal fragment be reduced to 7 Nucleotide (wherein 67 Nucleotide can phase mutual cross) and cause the binding affinity of SDF-1 to reduce (191-D5-004).Modify the terminal fragment of C type SDF-1 binding nucleic acids 191-D5-004, wherein use ' C ' (191-D5-005) to replace the non-matching Nucleotide ' A ' in 3 '-terminal fragment of 191-D5-004.Described modification causes the raising of combination.This derivative---C type SDF-1 binding nucleic acids 191-D5-005 shows the associativity to SDF-1 similar to 191-D5-001.Brachymemma 5 ' respectively again-and 3 '-terminal fragment to 5 Nucleotide, producing overall length is the molecule (191-D5-007) of 29 Nucleotide.Because the similarity of 191-D5-001 and C type SDF-1 binding nucleic acids 197-B2,191-D5-001,197-H1,191-A5,197-H3,197-B1,197-E3,197-D1,197-H2 and 197-D2, and because for data shown in 191-D5-007, can infer 5 '-and 3 '-terminal fragment can be truncated in principle 5 Nucleotide, wherein successfully detect the nucleotide sequence ' CGGGA ' of 5 '-terminal fragment and ' UCCCG ' of 3 '-terminal fragment (C type SDF-1 binding nucleic acids 191-D5-007).Surprisingly, the combination of C type SDF-1 binding nucleic acids 191-D5-007 and SDF-1 is than 191-D5-001 more better (being used competitive binding assay method to measure in fit level).Use pull-down binding assay (K _d=2.2nM, Figure 20) with by surface plasma resonance method of masurement (K _d=0.8nM, Figure 21) measure the equilibrium association constant K of 191-D5-007 _d.Use cell in vitro to cultivate the IC that chemotactic assay method is measured the 191-D5-007 of 0.1nM ₅₀(inhibition concentration 50%).Further two terminal fragments are all truncated to 4 Nucleotide (191-D5-010, Fig. 7 A).

There are 5 ' of 4 Nucleotide separately-also show the binding affinity of SDF-1 is reduced to (Fig. 7 B) with other derivative (191-D5-017/-024/-029) relative 191-D5-007 in competitive pull-down binding assay of the C type SDF-1 binding nucleic acids 191-D5-001 of 3 '-terminal fragment.Also detected have 5 Nucleotide separately alternative 5 '-and 3 '-terminal fragment and (191-D5-017-29a, 191-D5-017-29b, 191-D5-019-29a, 191-D5-024-29a, 191-D5-024-29b).The general formula of 5 ' of these derivatives-terminal fragment is ' X _ssSSV ' (formula-7-5 ' of C type), the general formula of 3 ' of these derivatives-fragment is ' BSSSX _s' formula-7-3 ' of C type), X wherein _sdisappearance or be S '.2 demonstrations in 5 tested variants identical with 191-D5-007 to the binding affinity of SDF-1 (191-D5-024-29a, 191-D5-024-29b; Fig. 7 B).Can be by the best combination avidity showing SDF-1, and the sequence of 5 '-end and 3 '-terminal fragment that comprises respectively the 191-D5-001 derivative (191-D5-007,191-D5-024-29a, 191-D5-024-29b) of 5 '-end and the 3 '-terminal fragment of 5 Nucleotide is summarised as general formula (5 '-terminal fragment: ' SGGSR ', the formula-8-5 ' of C type; 3 '-terminal fragment:, YSCCS ', the formula-8-3 ' of C type).

By measuring the competitive pull-down combination of relative initial molecule 197-B2 and 191-D5-007, analyzed the brachymemma derivative (Fig. 8) of C type SDF-1 binding nucleic acids 197-B2.By use competitive pull-down binding assay with respect to 191-D5-007, show that 197-B2 has identical with 191-D5-007 to SDF-1 binding affinity.By 5 '-and 3 '-terminal fragment from 10 Nucleotide (197-B2) separately, foreshorten to separately 5 Nucleotide (197-B2-005) and without detriment to binding affinity, wherein the Nucleotide of 5 '-terminal fragment and 3 '-terminal fragment can complete intercrossing.If 5 '-end (' GCGGG ') and 3 '-end (' CCUGC ') fragment of replacing 197-B2-005 with ' GCCGG ' (5 '-terminal fragment) and ' CCGGC ' (3 '-terminal fragment) of 197-B2-006, kept completely to the binding affinity of SDF-1 so.Because 197-B2 and 191-D5-001(and their derivative) total identical core nucleotide sequence

and detected 5 '-and several derivatives of the 191-D5 of 3 '-terminal fragment that have the length with 4 Nucleotide separately, thus omitted 5 '-and the further brachymemma of 3 '-terminal fragment.Design two kinds of other derivatives, described derivative respectively 5 '-and 3 '-end comprise 6 Nucleotide (5 '-and 3 '-terminal fragment).Two kinds of molecules (197-B2-006-31a and 197-B2-006-31b) to the binding affinity of SDF-1 with for avidity shown in 191-D5-007 and 197-B2-006 identical (Fig. 8).Can be by the best combination avidity showing SDF-1, and the sequence of 5 '-end and 3 '-terminal fragment of 197-B2 derivative that comprises respectively 5 '-end and the 3 '-terminal fragment of 5 Nucleotide is summarised as general formula (5 '-terminal fragment: ' GCSGG ', the formula-9-5 ' of C type; 3 '-terminal fragment:, CCKGC ', the formula-9-3 ' of C type).

By combining C type SDF-1 binding nucleic acids 191-D5-001(5 '-terminal fragment: ' SGGSR ', the formula-8-5 ' of C type; 3 '-terminal fragment:, YSCCS ', the formula-8-3 ' of C type) and 197-B2(5 '-terminal fragment: ' GCSGG ', the formula-9-5 ' of C type; 3 '-terminal fragment:, CCKGC ', formula-the 9-3 ' of C type) brachymemma derivative preferably 5 '-and 3 '-fragment, the common preferred formula that draws 5 '-end and 3 '-terminal fragment is ' SSSSR ' (5 '-terminal fragment, formula-10-5 ' of C type) and ' YSBSS ' (3 '-terminal fragment: the formula-10-3 ' of C type).

1.4 other SDF-1 binding nucleic acids

In addition, not other three kinds of SDF-1 binding nucleic acids of the SDF-1 associativity motif of total ' A type ', ' Type B ' and ' C type ' have been identified.By using pull-down binding assay, they are fit (Fig. 9) by analysis.

Be appreciated that any sequence showing in Fig. 1-9 is nucleic acid of the present invention, comprise its clipped form, but also comprise its extension form, but condition be respectively still can be in conjunction with target through the nucleic acid molecule of described brachymemma and extension.

The 40kda-PEG of embodiment 2:SDF associativity mirror image isomer and other modifiers

For the blood plasma residence time in the body of prolongation mirror image isomer, as described in example 3 above by mirror image isomerism body 193-G2-012,192-A10-008,191-D5-007,197-B2-006 and 197-B2-006-31b are covalently coupled to 40kDa polyoxyethylene glycol (the PEG) (clone of PEGization: 193-G2-012-5 '-PEG in 5 ' end, 192-A10-008-5 ' PEG, 191-D5-007-5 ' PEG, 197-B2-006-5 ' PEG and 197-B2-006-31b-5 ' PEG).

The mirror image isomer molecule of PEGization has been analyzed in cell cultures TAX assay method (embodiment 5) neutralization by the plasmon resonance measurement method (embodiment 6) of using Biacore to carry out in vitro.All mirror image isomers of modifying through 40kDa-PEG-still can suppress the chemotaxis of SDF-1 inducibility, and can be in conjunction with SDF-1(Figure 23 A, 23B, 24A and Figure 24 B within the scope of low nmole).

In addition use, the clone of 40kDa-PEG, 30kDa-PEG, 100kDa-HES or 130kDa-HESization: 192-A10-001-5 ' PEG40,192-A10-001-5 ' PEG30,192-A10-001-5 ' HES100,192-A10-001-5 ' HES130; Coupling method in embodiment 3) modify SDF associativity mirror image isomer 192-A10-001.As shown in Figure 25 A and Figure 25 B, PEG-part and HES-part suppress SDF-1 inducibility chemotactic potential all without impact to mirror image isomer.

Embodiment 3: the synthetic and derivatize of fit and mirror image isomer

3.1 is synthetic on a small scale

Utilize 2 ' TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993), use ABI 394 synthesizers (Applied Biosystems, Foster City, CA, USA), by solid phase synthesis, prepare fit and mirror image isomer.The rA of D-and L-configuration (N-Bz)-, rC (Ac)-, rG (N-ibu)-and rU-phosphoramidite purchased from ChemGenes, Wilmington, MA.Fit and mirror image isomer carries out purifying by gel electrophoresis.

3.2 extensive synthetic and modifications

Utilize 2 ' TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993), use

synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg), by solid phase synthesis, prepare mirror image isomer.L-rA (N-Bz)-, L-rC (Ac)-, L-rG (N-ibu)-and L-rU-phosphoramidite purchased from ChemGenes, Wilmington, MA, USA.5 '-amino-modifier is purchased from American International Chemicals Inc.(Framingham, MA, USA).The synthetic of mirror image isomer starts from respectively through L-riboG; The CPG that L-riboC, L-riboA, L-riboU modify, aperture is 1000

(Link Technology, Glasgow, UK).For coupling (each circulation is 15 minutes), the phosphoramidite solution of the 0.2M separately that uses the benzylthio-tetrazolium (American International Chemicals Inc., Framingham, MA, USA) of 0.3M in acetonitrile and 3.5 equivalents in acetonitrile.Use the circulation of oxidation end-blocking.Other for the synthetic standard solvent of oligonucleotide and reagent purchased from Biosolve(Valkenswaard, NL).Synthetic mirror image isomer, DMT-ON; After going protection, use Source15RPC medium (Amersham), by the people such as preparative RP-HPLC(Wincott F, 1995) it is carried out to purifying.With 80% acetic acid, remove 5 ' DMT-group (at room temperature 90 minutes).Subsequently, add the 2M NaOAc aqueous solution, and use 5K regenerated cellulose film (Millipore, Bedford, MA), by tangential flow filtration, mirror image isomer is carried out to desalination.

3.3 PEGization

In order to extend the mirror image isomer blood plasma residence time in vivo, mirror image isomer is covalently coupled to 40kDa polyoxyethylene glycol (PEG) part in 5 '-end.

For PEGization (about the ins and outs of PEGization method, can referring to European patent application EP 1 306 382), 5 ' of purifying-amido modified mirror image isomer be dissolved in to H ₂dMF(5ml) and damping fluid A(5ml O(2.5ml); By mixing citric acid H ₂o[7g], boric acid [3.54g], phosphoric acid [2.26ml] and 1M NaOH[343ml] and add H ₂o is prepared to final volume 1L; With 1M HCl, regulate pH=8.4) mixture in.

With 1M NaOH, make the pH of mirror image isomerism liquid solution reach 8.4.Then, at 37 ℃, with 6 parts (every part of 0.25 equivalents), within every 30 minutes, add 40kDa PEG-NHS ester (Nektar Therapeutics, Huntsville, AL), until reach the maximum yield of 75-85%.In adding the process of PEG-NHS ester, with 1M NaOH, the pH of reaction mixture is remained on to 8-8.5.

By described reaction mixture and 4ml urea soln (8M) and 4ml buffer B (0.1M at H ₂acetic acid triethyl ammonium in O) mix, and be heated to 95 ℃ 15 minutes.Then, adopt acetonitrile gradient (buffer B; The acetic acid triethyl ammonium in acetonitrile of damping fluid C:0.1M), use Source 15RPC medium (Amersham), by RP-HPLC, use source 15RPC medium (Amersham) to carry out the mirror image isomer of purifying PEGization.With the excessive PEG of 5% damping fluid C wash-out, with the mirror image isomer of 10-15% damping fluid C wash-out PEGization.By purity >95%(, this assesses by HPLC) product fraction merge, and mix mutually with 40ml3M NaOAC.By tangential flow filtration (5K regenerated cellulose film, Millipore, Bedford MA), the mirror image isomer of PEGization is carried out to desalination.

3.4 HESization

In order to extend the blood plasma residence time in the body of mirror image isomer, mirror image isomer is covalently coupled to and is greater than the different molecular weight of 130kDa and the hydroxyethylamyle (HES) that degree of exchange (substitution degree) is greater than 0.5.5 ' of mirror image isomer-end is preferably to put together site.

For HESization (about the ins and outs of HESization method, can be referring to German Offenlegungsschrift DE 101 12 825 A1, and about D/L-nucleic acid referring to PCT WO02/080979 A2), 5 ' of purifying-amido modified mirror image isomer is dissolved in to sodium bicarbonate (0.3M, 1ml), and by pH regulator to 8.5.

Relevant mirror image isomer, to N, in dinethylformamide (1ml), add 5 times of excessive free HES acid (3.3mmol, Supramol, Rosbach, Germany) and two (the heavy amido of N-succinyl-) carbonic ether (3.3mmol), thus the N-hydroxy-succinamide ester solution of the activation of HES produced.In order to dissolve all reactants, by mixture of short duration stirring at 60 ℃, be cooled to 25 ℃, then at 25 ℃, stir 1.5h.In the solution of HES of activation, add mirror image isomerism liquid solution, under 25 ℃ and pH8.5, stir the mixture of gained.By analyzing IEX-HPLC monitoring reaction.Conventionally be conjugated in 1 hour and proceed to and be greater than 75%.

In order to carry out IEX-HPLC purifying by Source 15Q medium (GE, Freiburg, Germany), by the buffer A of reaction mixture and 10 times of amounts (NaClO4 of 10mM in water/acetonitrile (9:1), pH 4 for 1mM EDTA, 25mM Tris) mixing.Buffer A with 5% (NaClO4 in water/acetonitrile (9:1) of 500mM, pH 4 for 1mM EDTA, 25mM Tris) the excessive HES of wash-out, wherein uses the buffer B wash-out HES-mirror image isomer conjugate of 20-30%.Purity is greater than to 95%(as estimated by HPLC) product fraction merge, then by tangential flow filtration (5K regenerated cellulose film, Millipore, Bedford MA), carry out desalination.

Embodiment 4: the mensuration of binding constant (Pull-down binding assay)

4.1 direct pull-down binding assays

At 37 ℃, according to pull-down, measure and measure the fit avidity to biotinylation people D-SDF-1.Use [γ- ³²p] the ATP(Hartmann Analytic of-mark, Braunschweig, Germany), by T4 polynucleotide kinase (Invitrogen, Karlsruhe, Germany) to fit 5 '-phosphoric acid mark that carries out.Fit specific activity through mark is 200,000-800,000cpm/pmol.After denature and renature by fit at 37 ℃ with 10,20,30 or the concentration of 40pM and the biotinylated people D-SDF-1 mono-of different amounts arise from and select damping fluid (20mM Tris-HCl pH 7.4; 137mM NaCl; 5mM KCl; 1mM MgCl ₂; 1mM CaCl ₂; 0.1%[w/vol] Tween-20) in incubation 4-12 hour to be issued to balance at lower concentration.With 10 μ g/ml human serum albumin (Sigma-Aldrich, Steinheim, Germany) and 10 μ g/ml yeast rna (Ambion, Austin, USA) supplement to select damping fluid, to prevent that binding partners is adsorbed to used plastic ware or the fixing surface of matrix.The concentration range of biotinylated D-SDF-1 is set to 8pM-100nM; Total reaction volume is 1ml.Peptide and peptide-fit mixture are fixed on to 1.5 μ l Streptavidin Ultralink Plus particles (Pierce Biotechnology, Rockford, USA) above, and described particle is used and is selected damping fluid pre-equilibration, and is resuspended in the cumulative volume of 6 μ l.Particle keeps suspending 30 minutes at corresponding temperature in hot vortex mixer.After clear liquid suitable washing, in scintillometer, fixing radioactivity is carried out quantitatively in separation.In connection with per-cent, the concentration of biotinylated people D-SDF-1 is drawn, and by using software algorithm (GRAFIT; Erithacus Software; Surrey U.K.) and suppose that the stoichiometry of 1:1 obtains dissociation constant.

4.2 competition pull-down binding assays

Fit for more different combination D-SDF-1, implements competitive fractionation testing method.For reaching this object, obtainable tool avidity fit carried out to radio-labeling (referring to above) and as object of reference.After denature and renature, it is carried out to incubation with biotinylated D-SDF-1 in 37 ℃ under certain conditions in 1ml selects damping fluid, and described condition causes at NeutrAvidin agarose or Streptavidin Ultralink Plus(both from Pierce) about 5-10% and combination described peptide (uncontested) after upper fixing and washing.By the fit variant of unlabelled D-RNA of excessive denature and renature with different concentration (as 2,10 with 50nM) with through the adding together with fit of mark, to carry out parallel association reaction.Fit and the fit competitive binding target of reference to be measured, thus binding signal reduced, and described signal reduces the combination feature that depends on them.The fit of tool activity of finding in described assay method can be used as new object of reference subsequently for the comparative analysis of other fit variants.

Embodiment 5: the analysis to the inhibition of SDF-1 inducibility chemotaxis of being undertaken by SDF-1 associativity mirror image isomer

By Jurkat human T cell leukemia cell (available from DSMZ, Braunschweig) at 37 ℃ and 5%CO ₂lower cultivation is containing Glutamax(Invitrogen, Karlsruhe, Germany) in RPMI 1640 substratum (it contains 10% fetal bovine serum albumin ,100 unit/ml penicillin and 100 μ g/ml Streptomycin sulphates (Invitrogen, Karlsruhe, Germany)).Experiment the day before yesterday, by cell with 0.3 * 10 ⁶/ ml(9 * 10 ⁶/ 30ml) be seeded in the standard medium (Invitrogen, Karlsruhe, Germany) in new culturing bottle.

About experiment, by cell centrifugation (carrying out 5 minutes with 300g), resuspension, counting and the Hanks balanced salt solution that contains 1mg/ml bovine serum albumin and 20mM HEPES with 15ml HBH(; Invitrogen, Karlsruhe, Germany) clean once.Then with 3 * 10 ⁶/ ml or 1.33 * 10 ⁶/ ml resuspension cell, this depends on the type of used screen plate.Then allow the solution transport number hour of the porous-film of cell by screen plate to the mirror image isomers that contain SDF-1 and different amounts.Use has porous polycarbonate film (hole sizes of 5 μ m) (Corning; 3421) Transwell plate and inset or MultiScreen MIC plate (Millipore, MAMIC5S10).

5.1 schemes for Transwell plate

In the lower compartment of Transwell plate, in 600 μ l HBH, preparation stimulates solution (mirror image isomer of SDF-1+ different concns), and incubation 20 – 30 minutes.All conditions carries out at least 2 times.Inset is transferred to and is contained in the hole that stimulates solution, and to inset (3 * 10 ⁵individual cells/well) in, add 3 * 10 of 100 μ l ⁶the cell suspending liquid of/ml.Then allow cell at 37 ℃, move 3 hours.

After this, take out inset, and (440 μ M are in PBS to adding 60 μ l resazurin (resazurin) (Sigma, Deisenhofen, Germany) working solutions in hole (also to calibration hole); Biochrom, Berlin, Germany).Then by flat board incubation 2.5-3 hour at 37 ℃.After incubation, the 200 μ l in each hole are transferred to black 96 holes dull and stereotyped.At 544nm(, excite in detecting dull and stereotyped reader (BMG, Offenburg, Germany) Fluostar Optima) and 590nm(launch) locate to carry out the measurement of fluorescent signal.

5.2 schemes for Millipore MultiScreen flat board

In the low profile 96 pipe flat boards of 0.2ml, will stimulate solution (mirror image isomer of SDF-1+ different concns) to be formulated as 10X solution.With pipettor, 135 μ l HBH are added in the lower compartment of MultiScreen flat board, and add 15 μ l to stimulate solution.All conditions carries out in triplicate.At 20-30 minute, screen plate is inserted and is equipped with in the flat board that stimulates solution, and to filtering plate hole (1 * 10 ⁵individual cells/well) in, add 1.33 * 10 of 75 μ l ⁶the cell suspending liquid of/ml.Then allow cell at 37 ℃, move 3 hours.

After this, take out inset, in lower hole, add 20 μ l resazurin working solutions (440 μ M are in PBS).Then by flat board incubation 2.5-3 hour at 37 ℃.

After incubation, the 100 μ l in each hole are transferred to black 96 holes dull and stereotyped.Carry out as mentioned above the measurement of fluorescent signal.

5.3 assessment

About assessment, with regard to background fluorescence (acellular in hole), proofread and correct fluorescent value.Then calculate the difference between the experiment condition in the situation that containing and do not contain SDF-1.The value that does not contain the sample of mirror image isomer (only SDF-1) is set as to 100%, the value of the sample containing mirror image isomer is calculated as to the percentage ratio of this value.About dose-response curve, percent value is mapped to mirror image isomerism bulk concentration, and from the curve of gained, determine IC according to figure ₅₀-value (in the concentration of active 50% mirror image isomer while existing containing the mirror image isomer in the situation that not).

5.4 result

the dose-dependently of the Jurkat cell 5.4.1 producing by people SDF-1 stimulates

Finder SDF-1 stimulates the migration of Jurkat cell in the mode of dose-dependently, half maximal stimulation is at about 0.3nM place (Figure 11).

that 5.4.2 by SDF-1 associativity mirror image isomer, is undertaken becomes to people SDF-1 inducibility turn the dose-dependent inhibition of use into

When the solution that allows cell to the SDF-1 associativity mirror image isomer that contains people SDF-1 and progressive concentration moves, observe the inhibition of dose-dependently.In embodiment 1, specifically described measured lens conformational isomer IC separately ₅₀.When using non-specific contrast mirror image isomer but not during SDF-1 associativity mirror image isomer, do not observe retarding effect and reach 1 μ M(Figure 26).

5.4.3 by SDF-1 associativity mirror image isomer, undertaken to mouse SDF-1 inducibility the dose-dependent inhibition of chemotaxis

SDF-1 has good conservative property in across species: from the SDF-1 of mouse and people SDF-1a, only differ an amino acid (the 18th for Isoleucine but not α-amino-isovaleric acid).Mouse SDF-1 can stimulate the chemotaxis (Figure 27) of Jurkat cell, and finds that described effect is mirrored isomer 192-A10-001 and has the potential identical with people SDF-1 with 191-D5-007-5 '-PEG() inhibition (Figure 28).

Embodiment 6: the binding analysis being undertaken by surface plasma resonance method of masurement

Use Biacore instrument 2000(Biacore AB, Uppsala, Sweden) combination of analyzing prism conformational isomer and people SDF-1 α.When realizing coupling by amido, by the SDF-1 α 1-2 hour (cellulose ester that Millipore VSWP mixes of dialysing against the current; Hole dimension is 0.025 μ M) to remove interfering amine.Before protein coupling, by inject the 1:1 dilution of 35 μ l 0.4M NHS and 0.1M EDC with the flow velocity of 5 μ l/ minutes, activate CM4 induction chip (Biacore AB, Uppsala, Sweden).The chemokine that the flow velocity injection concentration of then take 2 μ l/ minutes is 0.1-1.5 μ g/ml, until device response value at 1000-2000RU(relative unit) scope in.By inject 35 μ l acidic alcohol amine aqueous solutions (pH 8.5) with the flow velocity of 5 μ l/ minutes, make unreacted NHS ester inactivation.By binding buffer liquid pre-treatment twice for induction chip, and with 10 μ l/ minute balance 1-2 hour until baseline is seen quasi-stable.For all proteins, by a series of, selecting damping fluid (Tris-HCl 20mM, NaCl 137mM, KCl5mM, CaCl ₂1mM, MgCl ₂1mM, Tween 20 0.1%[w/v], pH 7.4) in concentration be 1000,500,250,125,62.5,31.25 and the mirror image isomer injection liquid of 0nM assess kinetic parameter and dissociation constant.In all experiments, at 37 ℃, with Kinject order, analyze, described command definition under the flow velocity of 10 μ l/ minutes the association time be 180 seconds and Dissociation time is 360 seconds.Data analysis and dissociation constant (K _d) calculating adopt BIAevaluation 3.0 softwares (BIACORE AB, Uppsala, Sweden) to carry out, it has used Langmuir 1:1 stoichiometry fitting algorithm.

Embodiment 7: by SDF-1 associativity mirror image isomer, undertaken to [ ¹²⁵j]-SDF-1 and the inhibition of expressing the cell of CXCR4

7.1 method

The cDNA clone (NM_003467.2) of encoding human CXCR4 acceptor is purchased from OriGene Technologies(Rockville, MD) and be cloned into pCR3.1-carrier (Invitrogen, Karlsruhe, Germany).Use Lipofectamin 2000(Invitrogen) carrier of gained is transfected into CHO-K1 cell (DSMZ, Braunschweig, Germany), by process to select the clone of stably express with Geneticin.By RT-PCR, verify the expression of acceptor.

About in conjunction with measuring, by the cell of expressing CXCR4 with 1 * 10 ⁵the cell density of individual cells/well is inoculated into 24 holes that are coated with poly-lysine dull and stereotyped, at 37 ℃ and 5%CO ₂overnight incubation in CHO-Ultra substratum (Cambrex, Verviers, Belgium) (it contains 50Ge unit/ml penicillin, 50 μ g/ml Streptomycin sulphates and 0.5mg/ml Geneticin).

About in conjunction with experiment, remove substratum, with the Hanks balanced salt solution that additionally contains 20mM HEPES, 1mg/ml bovine serum albumin, 0.1mg/ml bacitracin (HBB), clean cell once.Then by cell at room temperature with 50pM[ ¹²⁵j]-SDF-1(PerkinElmer, Rodgau, Germany) and the mirror image isomer of Variable Composition incubation 1 hour in 0.2ml HBB together.

By add unlabelled people SDF-1(R & D Systems, Wiesbaden, Germany in several holes) measure non-specific binding to the final concentration of 0.5 μ M.

After incubation period, remove supernatant liquor, with ice-cold HBB wash-out hole 3 times.Then use 0.1ml0.1M NaOH lysing cell.Lysate is transferred to scintillation vial (szintillation vial), and adds after 4ml Unisafe 1 Liquid Szintillation mixture (Zinsser, Frankfurt, Germany), in Beckman LS6500 scintillometer, count.

Because the value ratio of non-specific binding (combination of situation about existing at the unlabelled SDF-1 of a large amount) is in the situation that the value of the total binding that the mirror image isomer of high density (500pM) exists is higher, so the difference between maximum combined (" max ") and the combination in the situation that 500pM mirror image isomer exists is used for calculating IC ₅₀value.

7.2 result

Combining [ ¹²⁵i]-SDF-1 shown the concentration mapping of mirror image isomer, the combination of SDF-1 can be mirrored isomer 192-A10-001 blocking-up, IC ₅₀for about 60pM(Figure 29).

Embodiment 8: the inhibition by SDF-1 associativity mirror image isomer to the activation of SDF-1 inducibility map kinase

8.1 method

By the Chinese hamster ovary celI of expressing CXCR4 with 0.5 * 10 ⁶the cell density of individual cells/well is inoculated into 6 holes dull and stereotyped, and at 37 ℃ and 5%CO ₂in CHO-Ultra substratum (Cambrex, Verviers, Belgium) (it contains 50Ge unit/ml penicillin, 50 μ g/ml Streptomycin sulphates and 0.5mg/ml Geneticin), cultivate approximately 3 hours.After cell attachment, remove substratum, and replace the Ham ' s F12 substratum that contains 50Ge unit/ml penicillin, 50 μ g/ml Streptomycin sulphates.Then by cell at 37 ℃ and 5%CO ₂under the incubation that spends the night.In stimulation first 3 hours, then replace substratum once with fresh Ham ' s F12 substratum.With the mirror image isomer irritation cells 5 of 1nM people SDF-1 and different amounts or 10 minutes.Then, remove substratum, with ice-cold phosphate-buffered saline (PBS) the Rapid Cleaning cell of 1ml once, then use SDS-sample buffer (Tris/HCl pH 6.8,62.5mM; Glycerine, 10%; SDS, 2%; Tetrabromophenol sulfonphthalein, 0.01%; β mercaptoethanol, 5%) carry out cracking.In each hole, add 1 μ l0.5 unit/μ l Benzonase(Merck, Darmstadt, Germany), after at room temperature incubation 5-10 minute, lysate is transferred in Eppendorf pipe, and at 95 ℃, incubation is 5 minutes, then at 20 ℃ of –, stores until further analyze.

The lysate of separated 25 μ l on 10% sex change SDS-polyacrylamide gel.Then by electroblotting, protein transduction is moved on HybondECL nitrocellulose filter (Amersham/GE Healthcare, Munich, Germany).After trace, with ponceau (0.2% in 3% trichoroacetic acid(TCA)), film is dyeed to control the applied sample amount of protein, film is shifted, then by containing TBS-T(Tris buffer salt solution (the 20mM Tris/HCl of 10% skimming milk, pH 7.6,137mM NaCl) and 0.1%Tween 20) at 8 ℃ of 2 –, be incubated overnight to seal.

Then by incubation 2 hours at room temperature together with the anti-phosphoric acid-MAP-of film and rabbit kinase antibody (1:1000 is in 10% Ruzhong in TBS-T).With TBS-T, cleaning after three times (each 5 minutes), by film incubation 1 hour at room temperature together with anti-rabbit igg-HRP-conjugate (1:2000 is in 10% Ruzhong in TBS-T).Then film is cleaned to (each 5 minutes) 3 times again with TBS-T, then at LumiGlo ^rin chemical illuminating reagent, incubation is 1 minute.By to Hyperfilm ^tMeCL chemoluminescence film (Amersham/GE Healthcare) exposes 30 seconds and detects luminous in-2 minutes.Antibody and luminous detection reagent are the components of PhosphoPlus p44/42MAP kinases (Thr202/Tyr204) antibody kit (from Cell Signaling Technology) (New England Biolabs, Frankfurt a.M., Germany).

8.2 structure

The strength increase of the band of the map kinase that reflection activates shows, the intense stimulus of using 1nM people SDF-1 to stimulate the cell of expression CXCR4 to cause map kinase for 5 minutes.The activation of this map kinase can be mirrored isomer 191-A10-001 and suppress (Figure 30) in dose-dependent mode.

Embodiment 9: the functional analysis to people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG of carrying out in aortic annulus sprouts assay method

In order to detect people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG in blood vessel generation organ culture is measured, also there is function, carry out the aortic annulus mensuration of sprouting.Described mensuration (wherein estimating to extend from the vascular sample of explant length and the abundance of (vessel-like extensions)) has become the most widely used organ culture model (Auerbach et al.2003) occurring for blood vessel.Shown that SDF-1 induces sprout (Salcedo et al.1999) in the mensuration of described type.

Rat aorta is cut into ring, is embedded in collagen stroma, by its with SDF-1 and SDF-1+ people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG or SDF+ not in conjunction with incubation together with the contrast mirror image isomer of the non-functional PEGization of SDF-1.After 6-7 days, by taking pictures and the mensuration index analysis sprout (that is, endotheliocyte to outgrowth) of sprouting.

Method

From the aorta of male rat available from Bagheri Life sciences(Berlin, Germany).New system is for aorta, then on ice, proceed to and contain 50Ge unit/ml penicillin, 50 μ g/ml Streptomycin sulphates are (both from Invitrogen, Karlsruhe, Germany) and 2.5 μ g/ml amphotericin B (Cambrex, USA) in MCDB 131-substratum (Invitrogen, Karlsruhe, Germany).

About experiment, single aorta is transferred to Tissue Culture Dish together with substratum, remove residual reticular tissue.Then use scalper that aorta is cut into the long ring of about 1-2mm.To encircle at Medium199(Invitrogen, Karlsruhe, Germany) in fully clean (at least 5 times), be then placed in the hole (collagen solution of 450 μ l is equipped with in every hole) of 24 hole flat boards.By by 9ml rat tails collagen, (3mg/ml is in 0.1% acetic acid; Sigma, Deisenhofen, Germany) with 1.12ml 10X Medium 199(Invitrogen, Karlsruhe, Germany), 1.12ml 10X collagen damping fluid (0.05N NaOH, 200mM HEPES, 260mM NaHCO ₃) and 0.6ml 200mM Glutamin mix to prepare described glue source solution.So that the direction Arranged rings of cut border and hole bottom vertical.By flat board incubation at 37 ℃ being allowed collagen solidify at least 1 hour.Then every hole adds 1ml MCDB131-substratum and additive (SDF-1 and mirror image isomer).Then incubation ring 6-7 days at 37 ℃.As the contrast of sprouting, use extraly VEGF(vascular endothelial growth factor) test.

By taking pictures to record with digital camera, sprout.In some cases, by adding 1ml10% paraformaldehyde to fix ring, then will at its 2-8 ℃, store for further proof.With Scion Image image processing software, analyze photo.By means of clapping after the image calibration of stage micrometer, in the distance of an edge 0.33mm from ring, rule.Histogram (plot histogram) by Software Create along this line, prints histogram, and peak value (representing the bud through line) is counted.This number is used as to the index that sprouts.The 4-5 of each condition ring assessed.Use the WinSTAT of Excel to carry out statistical study.

Result

Provable, SDF-1 induction is sprouted, and can block this effect by employment SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG.For the contrast mirror image isomer of non-functional PEGization, do not observe the blocking-up (Figure 31 and 32) that SDF-1 inducibility is sprouted.

Embodiment 10: to inject people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG in single dose intravenous, rat is used to the blood plasma level of rear SDF-1 and people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG

In order to detect people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG, whether there is in vivo function, form with intravenous push is used people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG to rat, measures the blood plasma level of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and SDF-1.In contrast, measure the blood plasma level of untreated rat SDF-1.

Animal, uses and sample collection

People SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG is dissolved to final concentration 0.5mg/ml, then filtration sterilization in PBS.With the form of injecting in single dose intravenous, to male Sprague Dawley rat (the about 300g of body weight), use 1.0mg/kg people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG.At several time points, collect blood sample (as shown in Figure 33) to follow the tracks of the plasma clearance of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG.

Sandwich hybridization assay method for quantitative mirror image isomer

By the amount of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG in the quantitative sample of sandwich hybridization assay method.Sandwich hybridization is measured the very seemingly ELISA(enzyme-linked immunosorbent assay of normally used mirror image isomer of ratio juris): fixing and detection.The hybridization of the end of detection based on biotinylated detection probes and mirror image isomer.After the remaining strand end mediation hybridization of mirror image isomer, mixture is to fixing through fixing capture probe.After removing unconjugated mixture, finally by streptavidin/alkaline phosphatase conjugate, transform chemical luminous substrate and detect the detection probes of hybridizing with mirror image isomer.Described in the people such as Drolet (Drolet et.al, 2000), such sandwich hybridization assay method is also used to detect and quantitatively RNA is fit.

the preparation of hybridization plate

By 193-G2-012 capture probe (Seq.ID.:240) at 4 ℃ with 100nM(in 0.5M sodium phosphate, 1mM EDTA, pH 8.5) spending the night is fixed to white DNA-BIND96 hole dull and stereotyped (Corning Costar, Wiesbaden, Germany).At 25 ℃, with the BSA(of 0.5%w/v, in 0.25M sodium phosphate, 0.5mM EDTA, pH 8.5) wash-out hole twice, and seal 2 hours, again clean, then at room temperature store until use.Before hybridization, and use cleaning buffer solution (3 * SSC, 0.5%[w/v] sarcosyl, pH7.0; Preparation in advance does not contain the 20 * stoste [3M NaCl, 0.3M Trisodium Citrate] of sodium lauroyl sareosine, and corresponding dilution) clean 2 times.

sample preparation

To measure in duplicate all samples.Plasma sample is thawed on ice, vortex, and of short duration centrifugal in freezing desk centrifuge.Tissue homogenate is at room temperature thawed, under room temperature with maximum velocity centrifugation 5 minutes.According to following proportioning, at room temperature use hybridization buffer (the 193-G2-012 detection probes [Seq.ID.241] in the cleaning buffer solution of 40nM) dilute sample:

1:10 10 μ l sample mouth+90 μ l hybridization buffers

1:100 20 μ l1:10+180 μ l hybridization buffers

Measure all samples dilution.Calibration curve by people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG standard substance serial dilution to 12 points of span 0.001-40nM scope.Calibration standard is with identical at the calibration standard of sample of research..

hybridization and detection

Sample is heated 5 minutes at 95 ℃, be then cooled to room temperature.In 25 ℃, under 500rpm, in vibrator, mirror image isomer/detection probes mixture is annealed to through fixing capture probe 45 minutes.By using respectively cleaning buffer solution and 1 * TBST(20mM Tris-Cl, 137mM NaCl, 0.1%Tween 20, pH 7.5) clean and remove unconjugated mirror image isomer for twice.In the vibrator of 500rpm, by the streptavidin alkaline phosphatase diluting with 1:5000, at 25 ℃, detect the mixture 1 hour of hybridization in 1 * TBST.In order to remove unconjugated conjugate, again use 1 * TBST wash-out hole.Finally use 100ml CSDP substrate (Applied Biosystems, Darmstadt, Germany) to be full of hole, and at 25 ℃ incubation 45 minutes.With FLUOstar Optima trace flat board, read meter (BMG Labtechnologies, Offenburg, Germany) and measure chemoluminescence.

Data analysis

Following sample diluent is used for to quantitative data analysis:

Rat edta plasma 1:100

By the data from vehicle group (not using mirror image isomer) as a setting signal deduct.

ELISA for quantitative mirror image isomer

Use vitro enzyme linked immunosorbent assay to be quantitatively present in the amount of the SDF-1 in plasma sample, it is special antibody (people SDF-1 α ELISA test kit for the people SDF-1 α being coated on 96 hole flat boards that described assay method is used; RayBiotech, Norcross GA, USA).According to manufacturers instruction, measure.

Result

As shown in Figure 33, the blood plasma level (about 50pM) within the scope of lower picomole of conventional SDF-1 in untreated rat.On the contrary, it is different that the blood plasma level of the rat that employment SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG processes seems: after using people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG, in first 8 hours, SDF-1 blood plasma level is increased to about 700pM.In 12-72 hour, the blood plasma level of SDF-1 is reduced to about 50pM again.The described time-histories of SDF-1 blood plasma level can be directly associated with the blood plasma level of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG.Because being that the kidney of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG is removed, the blood plasma level of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG was reduced to lower than 50nM from about 1100nM in 72 hours.Yet, never the mirror image isomer of PEGization (about 15000Da) or there is other molecules (as SDF-1) lower than the molecular weight of the filtration limit of kidney, the about 54000Da of people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG(MW) in 1 hour, be not eliminated out health.Endogenous SDF-1 is by people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG combination, thereby form SDF-1-mirror image isomer-mixture, wherein the removing of SDF-1 and/or degraded are delayed, and as a result of this caused SDF-1 blood plasma level to raise in first 8 hours.Because people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG is along with the time continues to remove (wherein clearance rate is as more much lower in SDF-1 than many less molecules), thereby the blood plasma level of the mixture being formed by people SDF-1 associativity mirror image isomer 193-G2-012-5 '-PEG and SDF-1 reduces (Figure 33).

The present invention relates to following embodiment:

Embodiment 1. nucleic acid molecule, its preferred combination SDF-1, described nucleic acid molecule is selected from A type nucleic acid molecule, Type B nucleic acid molecule, C type nucleic acid molecule and has the nucleic acid molecule of arbitrary nucleotide sequence shown in SEQ.ID.No.142, SEQ.ID.No.143 and SEQ.ID.No.144.

The nucleic acid molecule of embodiment 2. embodiments 1, wherein said A type nucleic acid molecule comprises following core nucleotide sequence:

5’AAAGYRACAHGUMAAUGAAAGGUARC?3’（SEQ.ID.19）

X wherein _adisappearance or be A.

The nucleic acid molecule of embodiment 3. embodiments 2, wherein said A type nucleic acid molecule comprises the core nucleotide sequence that is selected from following sequence:

5’AAAGYRACAHGUMAAX _AUGAAAGGUARC?3’（SEQ.ID.No.20）、

5 ' AAAGYRACAHGUMAAAUGAAAGGUARC 3 ' (SEQ.ID.No.21) and

5 ' AAAGYAACAHGUCAAUGAAAGGUARC 3 ' (SEQ.ID.No.22), described core nucleotide sequence preferably comprises 5 ' AAAGYAACAHGUCAAUGAAAGGUARC 3 ' (SEQ.ID.No.22).

The nucleic acid molecule of any one in embodiment 4. embodiments 2 and 3, wherein said nucleic acid molecule comprises the first nucleotide fragments, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

The nucleic acid molecule of any one in embodiment 5. embodiments 2 and 3, wherein said nucleic acid molecule comprises the second nucleotide fragments, described core nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

Embodiment 6. embodiments 4 and 5 nucleic acid molecule, wherein said nucleic acid molecule comprises described first and described the second nucleotide fragments, and described first and the optional phase mutual cross of described the second nucleotide fragments, wherein after hybridization, form duplex structure.

The nucleic acid molecule of any one in embodiment 7. embodiment 4-6, wherein said duplex structure is by 4-6 base pair, and preferably 5 base pairs form.

The nucleic acid molecule of any one in embodiment 8. embodiment 4-7, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁x ₂nNBV 3 ' (SEQ.ID.No.44), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BNBNX ₃x ₄3 ' (SEQ.ID.No.45),

X wherein ₁disappearance or be R, X ₂for S, X ₃for S and X ₄disappearance or be Y;

Or

X ₁disappearance, X ₂disappearance or be S, X ₃disappearance or be S and X ₄disappearance.

The nucleic acid molecule of any one in embodiment 9. embodiment 4-8, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' RSHRYR 3 ' (SEQ.ID.No.23), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YRYDSY 3 ' (SEQ.ID.No.24)

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCUGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCAGC 3 '.

The nucleic acid molecule of any one in embodiment 10. embodiment 4-8, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₂bBBS 3 ' (SEQ.ID.No.42), and described the second nucleotide fragments comprises nucleotide sequence 5 ' SBBVX ₃3 ' (SEQ.ID.No.43),

X wherein ₂disappearance or be S, and X ₃disappearance or be S;

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' CUGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCAG 3 ';

Or described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CGCGC 3 '.

The nucleic acid molecule of any one in embodiment 11. embodiment 2-10, wherein said nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.5-18,25-41,133,137,139-141.

The nucleic acid molecule of embodiment 12. embodiments 1, wherein said Type B nucleic acid molecule comprises following core nucleotide sequence:

5’GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG3’（SEQ.ID.No.57）。

The nucleic acid molecule of embodiment 13. embodiments 12, wherein said Type B nucleic acid molecule comprises core nucleotide sequence GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGG(SEQ.ID.No.58).

The nucleic acid molecule of any one in embodiment 14. embodiments 12 and 13, wherein said nucleic acid molecule comprises the first nucleotide fragments, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

The nucleic acid molecule of any one in embodiment 15. embodiments 12 and 13, wherein said nucleic acid molecule comprises the second nucleotide fragments, described core nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

The nucleic acid molecule of any one in embodiment 16. embodiments 14 and 15, wherein said nucleic acid molecule comprises described the first and second nucleotide fragments, and the optional phase mutual cross of described the first and second nucleotide fragments, wherein after hybridization, forms duplex structure.

The nucleic acid molecule of any one in embodiment 17. embodiment 14-16, wherein said duplex structure is by 4-6 base pair, and preferably 5 base pairs form.

The nucleic acid molecule of any one in embodiment 18. embodiment 14-17, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁x ₂sVNS 3 ' (SEQ.ID.No.77), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BVBSX ₃x ₄3 ' (SEQ.ID.No.78), wherein

X ₁disappearance or be A, X ₂g, X ₃c and X ₄disappearance or be U;

Or

X ₁disappearance, X ₂disappearance or be G, X ₃disappearance or be C and X ₄disappearance.

The nucleic acid molecule of any one in embodiment 19. embodiment 14-18, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁gCRWG 3 ' (SEQ.ID.No.59), and described the second nucleotide fragments comprises nucleotide sequence 5 ' KRYSCX ₄3 ' (SEQ.ID.No.60),

X wherein ₁disappearance or be A, and X ₄disappearance or be U.

The nucleic acid molecule of any one in embodiment 20. embodiment 14-19, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₁gCGUG 3 ' (SEQ.ID.No.75), and described the second nucleotide fragments comprises nucleotide sequence 5 ' UACGCX ₄3 ' (SEQ.ID.No.76),

X wherein ₁disappearance or be A, and X ₄disappearance or be U,

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' AGCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' UACGCU 3 '.

The nucleic acid molecule of any one in embodiment 21. embodiment 14-18, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X ₂sSBS 3 ' (SEQ.ID.No.73), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BVSSX ₃3 ' (SEQ.ID.No.74),

X wherein ₂disappearance or be G, and X ₃disappearance or be C,

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCGUG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' UACGC 3 '.

The nucleic acid molecule of any one in embodiment 22. embodiment 12-21, wherein said nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.46-56,61-72 and 132.

The nucleic acid molecule of embodiment 23. embodiments 1, wherein said C type nucleic acid molecule comprises core nucleotide sequence GGUYAGGGCUHRX _aaGUCGG(SEQ.ID.No.90),

X wherein _adisappearance or be A.

The nucleic acid molecule of embodiment 24. embodiments 23, wherein said C type nucleic acid molecule comprises the core nucleotide sequence that is selected from following sequence:

5’GGUYAGGGCUHRAAGUCGG?3’（SEQ.ID.No.91）、

5 ' GGUYAGGGCUHRAGUCGG 3 ' (SEQ.ID.No.92) and

5 ' GGUUAGGGCUHGAAGUCGG 3 ' (SEQ.ID.No.93), described core nucleotide sequence preferably comprises 5 ' GGUUAGGGCUHGAAGUCGG 3 ' (SEQ.ID.No.93).

The nucleic acid molecule of any one in embodiment 25. embodiments 23 and 24, wherein said nucleic acid molecule comprises the first nucleotide fragments, described core nucleotide sequence and the second nucleotide fragments with 5 '->3 ' direction.

The nucleic acid molecule of any one in embodiment 26. embodiments 23 and 24, wherein said nucleic acid molecule comprises the second nucleotide fragments, described core nucleotide sequence and the first nucleotide fragments with 5 '->3 ' direction.

Embodiment 27. embodiments 25 and 26 nucleic acid molecule, wherein said nucleic acid molecule comprises described the first and second nucleotide fragments, the optional phase mutual cross of at least a portion of at least a portion of wherein said the first nucleotide fragments and described the second nucleotide fragments wherein forms duplex structure after hybridization.

The nucleic acid molecule of any one in embodiment 28. embodiment 25-27, the length of the length of wherein said the first nucleotide fragments and described the second fragment is respectively 0-17 Nucleotide separately, preferred 4-10 Nucleotide, and more preferably 4-6 Nucleotide.

The nucleic acid molecule of any one in embodiment 29. embodiments 27 and 28, wherein said duplex structure comprises 4-10 base pair, preferably 4-6 base pair, more preferably 5 base pairs.

The nucleic acid molecule of embodiment 30. embodiments 29, wherein said duplex structure comprises 4-10 base pair continuously, preferably 4-6 continuous base pair, more preferably 5 continuous base pairs.

The nucleic acid molecule of any one in embodiment 31. embodiment 25-30, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' RKSBUSNVGR 3 ' (SEQ.ID.No.120), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YYNRCASSMY 3 ' (SEQ.ID.No.121)

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' RKSBUGSVGR 3 ' (SEQ.ID.No.122), and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' YCNRCASSMY 3 ' (SEQ.ID.No.123).

The nucleic acid molecule of any one in embodiment 32. embodiment 25-30, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X _ssSSV 3 ' (SEQ.ID.No.124), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BSSSX _s3 ' (SEQ.ID.No.125), wherein X _sdisappearance or be S.

The nucleic acid molecule of any one in embodiment 33. embodiment 25-30 and 32, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' SSSSR 3 ' (SEQ.ID.No.130), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YSBSS 3 ' (SEQ.ID.No.131)

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' SGGSR 3 ' (SEQ.ID.No.126), and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' YSCCS 3 ' (SEQ.ID.No.127).

The nucleic acid molecule of any one in embodiment 34. embodiment 25-30,32 and 33, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' GCSGG 3 ' (SEQ.ID.No.128), and described the second nucleotide fragments comprises nucleotide sequence 5 ' CCKGC 3 ' (SEQ.ID.No.129)

Described the first nucleotide fragments preferably comprises nucleotide sequence 5 ' GCCGG 3 ', and described the second nucleotide fragments preferably comprises nucleotide sequence 5 ' CCGGC 3 '.

The nucleic acid molecule of any one in embodiment 35. embodiment 25-30, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' CGUGCGCUUGAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUCACG 3 '.

The nucleic acid molecule of any one in embodiment 36. embodiment 25-30, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' UGAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUCA 3 '.

The nucleic acid molecule of any one in embodiment 37. embodiment 25-30, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' GAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUC 3 '.

The nucleic acid molecule of any one in embodiment 38. embodiment 23-37, wherein said nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.79-89,94-119 and 134-136.

The nucleic acid molecule of embodiment 39. embodiments 1, wherein said nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.142-144.

The nucleic acid molecule of any one in embodiment 40. embodiment 1-39, wherein said nucleic acid molecule is the antagonist for SDF-1.

The nucleic acid molecule of any one in embodiment 41. embodiment 1-39, wherein said nucleic acid molecule is the antagonist of described SDF-1 receptor system, the described SDF-1 acceptor of wherein said SDF-1 receptor system is CXCR4 acceptor preferably.

The nucleic acid molecule of any one in embodiment 42. embodiments 1 or 41, wherein said SDF-1 is that the described SDF-1 acceptor of people SDF-1 and/or described SDF-1 receptor system is people SDF-1 acceptor.

The nucleic acid molecule of any one in embodiment 43. embodiment 1-42, wherein SDF-1 comprises aminoacid sequence shown in SEQ ID No.1.

The nucleic acid of any one in embodiment 44. embodiment 1-43, wherein said nucleic acid comprises modifier.

The nucleic acid of embodiment 45. embodiments 44, wherein said modifier is selected from HES part and peg moiety.

The nucleic acid of embodiment 46. embodiments 45, wherein said modifier is the peg moiety consisting of straight or branched PEG, the molecular weight of wherein said peg moiety is about 2-180kD preferably, more preferably from about 60-140kD and most preferably from about 40kD.

The nucleic acid of embodiment 47. embodiments 45, wherein said modifier is HES part, the molecular weight of wherein said HES part is about 10-130kD preferably, more preferably from about 30-130kD and most preferably from about 100kD.

The nucleic acid of any one in embodiment 48. embodiment 1-47, the Nucleotide of wherein said nucleic acid is L-Nucleotide, preferably the Nucleotide of arbitrary sequence shown in SEQ.ID.No.19,20,21,22,57,58,90,91,92 and 93.

Embodiment 49. pharmaceutical compositions, the nucleic acid that it comprises any one in embodiment 1-48, and optionally comprise other components, wherein said other components are selected from the acceptable vehicle of pharmacy and forms of pharmacologically active agents.

The purposes of the nucleic acid of any one in medicine preparation in embodiment 50. embodiment 1-48.

The purposes of embodiment 51. embodiments 50, wherein said medicine is used to treat and/or prevent disease or illness, wherein said disease or illness are mediated by SDF-1, described disease or illness are preferably selected from a rear portion disease (back-of-the-eye diseases), as diabetic retinopathy and age-related macular degeneration; Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Rheumatoid arthritis/osteoarthritis and ephritis.

The purposes of embodiment 52. embodiments 50, wherein said medicine is used to suppress blood vessel generation, new vessel formation, inflammation and transfer.

The purposes of the nucleic acid of any one in diagnostic tool preparation in embodiment 53. embodiment 1-48.

The purposes of embodiment 54. embodiments 53, wherein said diagnostic tool is used to diagnose the illness, and wherein said disease is mediated by SDF-1, and described disease is preferably selected from a rear portion disease, as diabetic retinopathy and age-related macular degeneration; Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Rheumatoid arthritis/osteoarthritis and ephritis.

The purposes of embodiment 55. embodiments 53, wherein said diagnostic tool is used to diagnose blood vessel generation, new vessel formation, inflammation and/or transfer.

The mixture that embodiment 56. comprises the nucleic acid of any one in SDF-1 and embodiment 1-48, wherein said mixture is crystalline complex preferably.

The purposes of the nucleic acid of any one in SDF-1 detects in embodiment 57. embodiment 1-48.

Embodiment 58. is for screening the method for SDF-1 antagonist or SDF-1 agonist, and described method comprises the following steps:

-candidate SDF-1 antagonist and/or candidate SDF-1 agonist be provided,

-nucleic acid of any one in embodiment 1-48 is provided,

-detection system that signal is provided in the situation that SDF-1 antagonist and/or SDF-1 agonist exist is provided, and

-determine whether described candidate SDF-1 antagonist is whether SDF-1 antagonist and/or described candidate SDF-1 agonist are SDF-1 agonists.

Embodiment 59. is for screening the method for SDF-1 agonist and/or SDF-1 antagonist, and described method comprises the following steps:

-SDF-1 that is fixed on phase is provided, described preferred solid phase mutually,

-nucleic acid of any one in embodiment 1-48 is provided, the nucleic acid of any one in the embodiment 1-48 being preferably labeled,

-add candidate SDF-1 agonist and/or candidate SDF-1 antagonist, and

-determine whether described candidate SDF-1 agonist is whether SDF-1 agonist and/or described candidate SDF-1 antagonist are SDF-1 antagonists.

The method of embodiment 60. embodiments 59, is characterized in that carrying out described definite to estimate whether described nucleic acid substitutes by described candidate SDF-1 agonist or by candidate SDF-1 antagonist.

Embodiment 61. is for detection of the test kit of SDF-1, the nucleic acid that it comprises any one in embodiment 1-48.

The SDF-1 antagonist that embodiment 62. can obtain by the method for any one in embodiment 58-60.

Reference

The complete reference documents and materials of the document of quoting herein except as otherwise noted, (disclosed and be incorporated to by reference herein) are as follows:

Aiuti,A.,I.J.Webb,et?al.(1997).″The?chemokine?SDF-1?is?a?chemoattractant?for?human?CD34+hematopoietic?progenitor?cells?and?provides?a?new?mechanism?to?explain?the?mobilization?of?CD34+progenitors?to?peripheral?blood.″J?Exp?Med?185(1):111-20.

Altschul?SF,Gish?W,Miller?W,Myers?EW,Lipman?DJ(1990),Basic?local?alignment?search?tool.J?Mol?Biol.215(3):403-10.

Altschul?SF,Madden?TL,Schaffer?AA,Zhang?J,Zhang?Z,Miller?W,Lipman?DJ(1997).Gapped?BLAST?and?PSI-BLAST:a?new?generation?of?protein?database?search?programs.Nucleic?Acids?Res.25(17):3389-402.

Ambati,J.,A.Anand,et?al.(2003).An?animal?model?of?age-related?macular?degeneration?in?senescent?Ccl-2-?or?Ccr-2-deficient?mice.Nat?Med.9:1390-7.

Arya,S.K.,C.C.Ginsberg,et?al.(1999).″In?vitro?phenotype?of?SDF1?gene?mutant?that?delays?the?onset?of?human?immunodeficiency?virus?disease?in?vivo.″J?Hum?Virol?2(3):133-8.

Auerbach?et?al.(2003)Angiogenesis?assays:a?critical?overview.Clin.Chem.49:32-40.

Baggiolini,M.(1998).″Chemokines?and?leukocyte?traffic.″Nature?392(6676):565-8.

Baggiolini,M.,B.Dewald,et?al.(1994).″Interleukin-8?and?related?chemotactic?cytokines--CXC?and?CC?chemokines.″Adv?Immunol?55:97-179.

Balabanian,K.,B.Lagane,et?al.(2005).″WHIM?syndromes?with?different?genetic?anomalies?are?accounted?for?by?impaired?CXCR4desensitization?to?CXCL12.″Blood?105(6):2449-57.

Balabanian,K.,J.Couderc,et?al.(2003).″Role?of?the?chemokine?stromal?cell-derived?factor?1?in?autoantibody?production?and?nephritis?in?murine?lupus.″J?Immunol?170(6):3392-400.

Balkwill,F.(2004).″Cancer?and?the?chemokine?network.″Nat?Rev?Cancer?4(7):540-50.

Bazan,J.F.,K.B.Bacon,et?al.(1997).″A?new?class?of?membrane-bound?chemokine?with?a?CX3C?motif.″Nature?385(6617):640-4.

Bertolini,F.,C.Dell′Agnola,et?al.(2002).″CXCR4neutralization,a?novel?therapeutic?approach?for?non-Hodgkin′s?lymphoma.″Cancer?Res?62(11):3106-12.

Bleul,C.C.,J.L.Schultze,et?al.(1998).″B?lymphocyte?chemotaxis?regulated?in?association?with?microanatomic?localization,differentiation?state,and?B?cell?receptor?engagement.″J?Exp?Med187(5):753-62.

Bleul,C.C.,M.Farzan,et?al.(1996).″The?lymphocyte?chemoattractant?SDF-1?is?a?ligand?for?LESTR/fusin?and?blocks?HIV-1entry.″Nature?382(6594):829-33.

Brooks,H.L.,Jr.,S.Caballero,Jr.,et?al.(2004).″Vitreous?levels?of?vascular?endothelial?growth?factor?and?stromal-derived?factor?1?in?patients?with?diabetic?retinopathy?and?cystoid?macular?edema?before?and?after?intraocular?injection?of?triamcinolone.″Arch?Ophthalmol122(12):1801-7.

Buckley,C.D.,N.Amft,et?al.(2000).″Persistent?induction?of?the?chemokine?receptor?CXCR4?by?TGF-beta?1?on?synovial?T?cells?contributes?to?their?accumulation?within?the?rheumatoid?synovium.″J?Immunol?165(6):3423-9.

Burger,J.A.,N.Tsukada,et?al.(2000).″Blood-derived?nurse-like?cells?protect?chronic?lymphocytic?leukemia?B?cells?from?spontaneous?apoptosis?through?stromal?cell-derived?factor-1.″Blood96(8):2655-63.

Butler,J.M.,S.M.Guthrie,et?al.(2005).″SDF-1?is?both?necessary?and?sufficient?to?promote?proliferative?retinopathy.″J?Clin?Invest?115(1):86-93.

Cabioglu,N.,A.Sahin,et?al.(2005).″Chemokine?receptor?CXCR4?expression?in?breast?cancer?as?a?potential?predictive?marker?of?isolated?tumor?cells?in?bone?marrow.″Clin?Exp?Metastasis?22(1):39-46.

Corcione,A.,L.Ottonello,et?al.(2000).″Stromal?cell-derived?factor-1?as?a?chemoattractant?for?follicular?center?lymphoma?B?cells.″J?Natl?Cancer?Inst?92(8):628-35.

Crump,M.P.,J.H.Gong,et?al.(1997).″Solution?structure?and?basis?for?functional?activity?of?stromal?cell-derived?factor-1;dissociation?of?CXCR4?activation?from?binding?and?inhibition?of?HIV-1.″Embo?J?16(23):6996-7007.

D′Apuzzo,M.,A.Rolink,et?al.(1997).″The?chemokine?SDF-1,stromal?cell-derived?factor?1,attracts?early?stage?B?cell?precursors?via?the?chemokine?receptor?CXCR4.″Eur?J?Immunol?27(7):1788-93.

De?Klerck,B.,L.Geboes,et?al.(2005).″Pro-inflammatory?properties?of?stromal?cell-derived?factor-1(CXCL12)in?collagen-induced?arthritis.″Arthritis?Res?Ther?7(6):R1208-20.

Drolet?DW,Nelson?J,Tucker?CE,Zack?PM,Nixon?K,Bolin?R,Judkins?MB,Farmer?JA,Wolf?JL,Gill?SC,Bendele?RA(2000).Pharmacokinetics?and?safety?of?an?anti-vascular?endothelial?growth?factor?aptamer(NX1838)following?injection?into?the?vitreous?humor?of?rhesus?monkeys.Pharm.Res.17:1503

Eaton,B.E.,L.Gold,et?al.(1997).″Post-SELEX?combinatorial?optimization?of?aptamers.″Bioorg?Med?Chem?5(6):1087-96.

Fedyk,E.R.,D.Jones,et?al.(2001).″Expression?of?stromal-derived?factor-1?is?decreased?by?IL-1?and?TNF?and?in?dermal?wound?healing.″J?Immunol?166(9):5749-54.

Fong,D.S.,L.P.Aiello,et?al.(2004).″Diabetic?retinopathy.″Diabetes?Care?27(10):2540-53.

Geminder,H.,O.Sagi-Assif,et?al.(2001).″A?possible?role?for?CXCR4?and?its?ligand,the?CXC?chemokine?stromal?cell-derived?factor-1,in?the?development?of?bone?marrow?metastases?in?neuroblastoma.″J?Immunol?167(8):4747-57.

Godessart,N.(2005).″Chemokine?receptors:attractive?targets?for?drug?discovery.″Ann?N?Y?Acad?Sci?1051:647-57.

Grassi,F.,S.Cristino,et?al.(2004).″CXCL12?chemokine?up-regulates?bone?resorption?and?MMP-9?release?by?human?osteoclasts:CXCL12?levels?are?increased?in?synovial?and?bone?tissue?of?rheumatoid?arthritis?patients.″J?Cell?Physiol?199(2):244-51.

Grunewald,M.,I.Avraham,et?al.(2006).″VEGF-induced?adult?neovascularization:recruitment,retention,and?role?of?accessory?cells.″Cell?124(1):175-89.

Guleng,B.,K.Tateishi,et?al.(2005).″Blockade?of?the?stromal?cell-derived?factor-1/CXCR4?axis?attenuates?in?vivo?tumor?growth?by?inhibiting?angiogenesis?in?a?vascular?endothelial?growth?factor-independent?manner.″Cancer?Res?65(13):5864-71.

Gulino,A.V.,D.Moratto,et?al.(2004).″Altered?leukocyte?response?to?CXCL12?in?patients?with?warts?hypogammaglobulinemia,infections,myelokathexis(WHIM)syndrome.″Blood?104(2):444-52.

Hartmann,T.N.,M.Burger,et?al.(2004).″The?role?of?adhesion?molecules?and?chemokine?receptor?CXCR4(CD184)in?small?cell?lung?cancer.″J?Biol?Regul?Homeost?Agents?18(2):126-30.

Hwang,J.H.,H.K.Chung,et?al.(2003).″CXC?chemokine?receptor?4?expression?and?function?in?human?anaplastic?thyroid?cancer?cells.″J?Clin?Endocrinol?Metab?88(1):408-16.

Jiang,W.,P.Zhou,et?al.(1994).″Molecular?cloning?of?TPAR1,a?gene?whose?expression?is?repressed?by?the?tumor?promoter?12-O-tetradecanoylphorbol?13-acetate(TPA).″Exp?Cell?Res?215(2):284-93.

Jose,P.J.,D.A.Griffiths-Johnson,et?al.(1994).″Eotaxin:a?potent?eosinophil?chemoattractant?cytokine?detected?in?a?guinea?pig?model?of?allergic?airways?inflammation.″J?Exp?Med?179(3):881-7.

Juarez,J.and?L.Bendall(2004).″SDF-1?and?CXCR4?in?normal?and?malignant?hematopoiesis.″Histol?Histopathol?19(1):299-309.

Kanbe,K.,K.Takagishi,et?al.(2002).″Stimulation?of?matrix?metalloprotease?3?release?from?human?chondrocytes?by?the?interaction?of?stromal?cell-derived?factor?1?and?CXC?chemokine?receptor?4.″Arthritis?Rheum?46(1):130-7.

Kang,H.,G.Watkins,et?al.(2005).″Stromal?cell?derived?factor-1:its?influence?on?invasiveness?and?migration?of?breast?cancer?cells?in?vitro,and?its?association?with?prognosis?and?survival?in?human?breast?cancer.″Breast?Cancer?Res?7(4):R402-10.

Kawai,T.,U.Choi,et?al.(2005).″Enhanced?function?with?decreased?internalization?of?carboxy-terminus?truncated?CXCR4responsible?for?WHIM?syndrome.″Exp?Hematol?33(4):460-8.

Koshiba,T.,R.Hosotani,et?al.(2000).″Expression?of?stromal?cell-derived?factor?1?and?CXCR4?ligand?receptor?system?in?pancreatic?cancer:a?possible?role?for?tumor?progression.″Clin?Cancer?Res?6(9):3530-5.

Krumbholz,M.,D.Theil,et?al.(2006).″Chemokines?in?multiple?sclerosis:CXCL12?and?CXCL13?up-regulation?is?differentially?linked?to?CNS?immune?cell?recruitment.″Brain?129:200-211.

Kryczek,I.,A.Lange,et?al.(2005).″CXCL12?and?vascular?endothelial?growth?factor?synergistically?induce?neoangiogenesis?in?human?ovarian?cancers.″Cancer?Res?65(2):465-72.

Kucia,M.,R.Reca,et?al.(2005).″Trafficking?of?normal?stem?cells?and?metastasis?of?cancer?stem?cells?involve?similar?mechanisms:pivotal?role?of?the?SDF-1-CXCR4?axis.″Stem?Cells?23(7):879-94.

Kusser,W.(2000).″Chemically?modified?nucleic?acid?aptamers?for?in?vitro?selections:evolving?evolution.″J?Biotechnol?74(1):27-38.

Lapteva,N.,A.G.Yang,et?al.(2005).″CXCR4?knockdown?by?small?interfering?RNA?abrogates?breast?tumor?growth?in?vivo.″Cancer?Gene?Ther?12(1):84-9.

M.J.Damha,K.K.Ogilvie,Methods?in?Molecular?Biology,Vol.20Protocols?for?oligonucleotides?and?analogs,ed.S.Agrawal,p.81-114,Humana?Press?Inc.1993

Ma,Q.,D.Jones,et?al.(1998).″Impaired?B-lymphopoiesis,myelopoiesis,and?derailed?cerebellar?neuron?migration?in?CXCR4-and?SDF-1-deficient?mice.″Proc?Natl?Acad?Sci?U?S?A?95(16):9448-53.

Marechal,V.,F.Arenzana-Seisdedos,et?al.(1999).″Opposite?effects?of?SDF-1?on?human?immunodeficiency?virus?type?1replication.″J?Virol?73(5):3608-15.

Matthys,P.,S.Hatse,et?al.(2001).″AMD3100,a?potent?and?specific?antagonist?of?the?stromal?cell-derived?factor-1?chemokine?receptor?CXCR4,inhibits?autoimmune?joint?inflammation?in?IFN-gamma?receptor-deficient?mice.″J?Immunol?167(8):4686-92.

McGinnis?S,Madden?TL(2004).BLAST:at?the?core?of?a?powerful?and?diverse?set?of?sequence?analysis?tools.Nucleic?Acids?Res.32(Web?Server?issue):W20-5.

Meleth,A.D.,E.Agron,et?al.(2005).″Serum?inflammatory?markers?in?diabetic?retinopathy.″Invest?Ophthalmol?Vis?Sci?46(11):4295-301.

Menu,E.,K.Asosingh,et?al.(2006).″The?involvement?of?stromal?derived?factor?1alpha?in?homing?and?progression?of?multiple?myeloma?in?the?5TMM?model.″Haematologica.

Miller,M.D.and?M.S.Krangel(1992).″Biology?and?biochemistry?of?the?chemokines:a?family?of?chemotactic?and?inflammatory?cytokines.″Crit?Rev?Immunol?12(1-2):17-46.

Moser,B.,M.Wolf,et?al.(2004).″Chemokines:multiple?levels?of?leukocyte?migration?control.″Trends?Immunol?25(2):75-84.

Muller,A.,B.Homey,et?al.(2001).″Involvement?of?chemokine?receptors?in?breast?cancer?metastasis.″Nature?410(6824):50-6.

Murdoch,C.(2000).″CXCR4:chemokine?receptor?extraordinaire.″Immunol?Rev?177:175-84.

Murphy,P.M.,M.Baggiolini,et?al.(2000).″International?union?of?pharmacology.XXII.Nomenclature?for?chemokine?receptors.″Pharmacol?Rev?52(1):145-76.

Nagasawa,T.,H.Kikutani,et?al.(1994).″Molecular?cloning?and?structure?of?a?pre-B-cell?growth-stimulating?factor.″Proc?Natl?Acad?Sci?U?S?A?91(6):2305-9.

Nagasawa,T.,S.Hirota,et?al.(1996).″Defects?of?B-cell?lymphopoiesis?and?bone-marrow?myelopoiesis?in?mice?lacking?the?CXC?chemokine?PBSF/SDF-1.″Nature?382(6592):635-8.

Needleman&Wunsch(1970),A?general?method?applicable?to?the?search?for?similarities?in?the?amino?acid?sequence?of?two?proteins.J?Mol?Biol.48(3):443-53.

Oppenheim,J.J.,C.O.Zachariae,et?al.(1991).″Properties?of?the?novel?proinflammatory?supergene″intercrine″cytokine?family.″Annu?Rev?Immunol?9:617-48.

Orimo,A.,P.B.Gupta,et?al.(2005).″Stromal?fibroblasts?present?in?invasive?human?breast?carcinomas?promote?tumor?growth?and?angiogenesis?through?elevated?SDF-1/CXCL12?secretion.″Cell?121(3):335-48.

Pearson&Lipman(1988),Improved?tools?for?biological?sequence?comparison.Proc.Nat′l.Acad.Sci.USA?85:2444

Perissinotto,E.,G.Cavalloni,et?al.(2005).″Involvement?of?chemokine?receptor?4/stromal?cell-derived?factor?1?system?during?osteosarcoma?tumor?progression.″Clin?Cancer?Res?11(2?Pt?1):490-7.

Phillips,R.J.,M.D.Burdick,et?al.(2003).″The?stromal?derived?factor-1/CXCL12-CXC?chemokine?receptor?4?biological?axis?in?non-small?cell?lung?cancer?metastases.″Am?J?Respir?Crit?Care?Med167(12):1676-86.

Ponath,P.D.,S.Qin,et?al.(1996).″Cloning?of?the?human?eosinophil?chemoattractant,eotaxin.Expression,receptor?binding,and?functional?properties?suggest?a?mechanism?for?the?selective?recruitment?of?eosinophils.″J?Clin?Invest?97(3):604-12.

Rubin,J.B.,A.L.Kung,et?al.(2003).″A?small-molecule?antagonist?of?CXCR4?inhibits?intracranial?growth?of?primary?brain?tumors.″Proc?Natl?Acad?Sci?U?S?A?100(23):13513-8.

Salcedo?et?al.(1999)Vascular?endothelial?growth?factor?and?basic?fibroblast?growth?factor?induce?expression?of?CXCR4?on?human?endothelial?cells.In?vivo?neovascularization?induced?by?stromal-derived?factor-1a.Am.J.Pathol.154:1125-1135.

Salcedo,R.and?J.J.Oppenheim(2003).″Role?of?chemokines?in?angiogenesis:CXCL12/SDF-1?and?CXCR4?interaction,a?key?regulator?of?endothelial?cell?responses.″Microcirculation?10(3-4):359-70.

Salcedo,R.,K.Wasserman,et?al.(1999).″Vascular?endothelial?growth?factor?and?basic?fibroblast?growth?factor?induce?expression?of?CXCR4?on?human?endothelial?cells:In?vivo?neovascularization?induced?by?stromal-derived?factor-1alpha.″Am?J?Pathol?154(4):1125-35.

Salvucci,O.,L.Yao,et?al.(2002).″Regulation?of?endothelial?cell?branching?morphogenesis?by?endogenous?chemokine?stromal-derived?factor-1.″Blood?99(8):2703-11.

Saur,D.,B.Seidler,et?al.(2005).″CXCR4?expression?increases?liver?and?lung?metastasis?in?a?mouse?model?of?pancreatic?cancer.″Gastroenterology?129(4):1237-50.

Schall,T.J.and?K.B.Bacon(1994).″Chemokines,leukocyte?trafficking,and?inflammation.″Curr?Opin?Immunol?6(6):865-73.

Scotton,C.J.,J.L.Wilson,et?al.(2002).″Multiple?actions?of?the?chemokine?CXCL12?on?epithelial?tumor?cells?in?human?ovarian?cancer.″Cancer?Res?62(20):5930-8.

Sengupta,N.,S.Caballero,et?al.(2005).″Preventing?stem?cell?incorporation?into?choroidal?neovascularization?by?targeting?homing?and?attachment?factors.″Invest?Ophthalmol?Vis?Sci?46(1):343-8.

Shirozu,M.,T.Nakano,et?al.(1995).″Structure?and?chromosomal?localization?of?the?human?stromal?cell-derived?factor?1(SDF1)gene.″Genomics?28(3):495-500.

Smith&Waterman(1981),Adv.Appl.Math.2:482

Soriano,A.,C.Martinez,et?al.(2002).″Plasma?stromal?cell-derived?factor(SDF)-1?levels,SDF1-3′A?genotype,and?expression?of?CXCR4?on?T?lymphocytes:their?impact?on?resistance?to?human?immunodeficiency?virus?type?1?infection?and?its?progression.″J?Infect?Dis?186(7):922-31.

Springer,T.A.(1995).″Traffic?signals?on?endothelium?for?lymphocyte?recirculation?and?leukocyte?emigration.″Annu?Rev?Physiol?57:827-72.

Sun,Y.X.,A.Schneider,et?al.(2005).″Skeletal?localization?and?neutralization?of?the?SDF-1(CXCL12)/CXCR4?axis?blocks?prostate?cancer?metastasis?and?growth?in?osseous?sites?in?vivo.″J?Bone?Miner?Res?20(2):318-29.

Takenaga,M.,H.Tamamura,et?al.(2004).″A?single?treatment?with?microcapsules?containing?a?CXCR4?antagonist?suppresses?pulmonary?metastasis?of?murine?melanoma.″Biochem?Biophys?Res?Commun?320(1):226-32.

Tamamura,H.,M.Fujisawa,et?al.(2004).″Identification?of?a?CXCR4?antagonist,a?T140?analog,as?an?anti-rheumatoid?arthritis?agent.″FEBS?Lett?569(1-3):99-104.

Tashiro,K.,H.Tada,et?al.(1993).″Signal?sequence?trap:a?cloning?strategy?for?secreted?proteins?and?type?I?membrane?proteins.″Science?261(5121):600-3.

Venkatesan,N.,S.J.Kim,et?al.(2003).″Novel?phosphoramidite?building?blocks?in?synthesis?and?applications?toward?modified?oligonucleotides.″Curr?Med?Chem?10(19):1973-91.

Wang,J.,E.Guan,et?al.(2001).″Role?of?tyrosine?phosphorylation?in?ligand-independent?sequestration?of?CXCR4?in?human?primary?monocytes-macrophages.″J?Biol?Chem?276(52):49236-43.

Wang,N.,Q.L.Wu,et?al.(2005).″Expression?of?chemokine?receptor?CXCR4?in?nasopharyngeal?carcinoma:pattern?of?expression?and?correlation?with?clinical?outcome.″J?Transl?Med?3:26.

Wincott?F,DiRenzo?A,Shaffer?C,Grimm?S,Tracz?D,Workman?C,Sweedler?D,Gonzalez?C,Scaringe?S,Usman?N(1995).Synthesis,deprotection,analysis?and?purification?of?RNA?and?ribozymes.Nucleic?Acids?Res.23(14):2677-84

Yamaguchi,J.,K.F.Kusano,et?al.(2003).″Stromal?cell-derived?factor-1?effects?on?ex?vivo?expanded?endothelial?progenitor?cell?recruitment?for?ischemic?neovascularization.″Circulation?107(9):1322-8.

Yasumoto,K.,K.Koizumi,et?al.(2006).″Role?of?the?CXCL12/CXCR4?axis?in?peritoneal?carcinomatosis?of?gastric?cancer.″Cancer?Res?66(4):2181-7.

Zeelenberg,I.S.,L.Ruuls-Van?Stalle,et?al.(2001).″Retention?of?CXCR4?in?the?endoplasmic?reticulum?blocks?dissemination?of?a?T?cell?hybridoma.″J?Clin?Invest?108(2):269-77.

Zeelenberg,I.S.,L.Ruuls-Van?Stalle,et?al.(2003).″The?chemokine?receptor?CXCR4?is?required?for?outgrowth?of?colon?carcinoma?micrometastases.″Cancer?Res?63(13):3833-9.

Zhou,Y.,P.H.Larsen,et?al.(2002).″CXCR4?is?a?major?chemokine?receptor?on?glioma?cells?and?mediates?their?survival.″J?Biol?Chem?277(51):49481-7.

Zou,Y.R.,A.H.Kottmann,et?al.(1998).″Function?of?the?chemokine?receptor?CXCR4?in?haematopoiesis?and?in?cerebellar?development.″Nature?393(6685):595-9.

Can be by disclosed feature of the present invention in this specification sheets, claims and/or accompanying drawing separately and using its arbitrary combination as realizing foundation of the present invention with various forms of the present invention.

Claims (32)

1. in conjunction with the nucleic acid molecule of SDF-1, thereby this nucleic acid molecule comprises the first nucleotide fragments, core nucleotide sequence and the second nucleotide fragments with 5 ' → 3 ' direction, or by 5 ' → 3 ' direction, comprise the second nucleotide fragments, core nucleotide sequence and the first nucleotide fragments, wherein said core nucleotide sequence comprises following core nucleotide sequence: GGUYAGGGCUHRX _aaGUCGG(SEQ.ID.No.90),

X wherein _adisappearance or be A;

The length of the length of wherein said the first nucleotide fragments and described the second fragment is respectively 4-10 Nucleotide separately.

2. the nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises the core nucleotide sequence that is selected from following sequence:

5’GGUYAGGGCUHRAAGUCGG?3’（SEQ.ID.No.91），

5 ' GGUYAGGGCUHRAGUCGG 3 ' (SEQ.ID.No.92), and

5’GGUUAGGGCUHGAAGUCGG?3’（SEQ.ID.No.93）。

3. the nucleic acid molecule of claim 1, the optional phase mutual cross of at least a portion of at least a portion of wherein said the first nucleotide fragments and described the second nucleotide fragments, thus after hybridization, form duplex structure.

4. the nucleic acid molecule of claim 1, the length of the length of wherein said the first nucleotide fragments and described the second fragment is respectively 4-6 Nucleotide separately.

5. the nucleic acid molecule of claim 3, wherein said duplex structure comprises 4-10 base pair.

6. the nucleic acid molecule of claim 5, wherein said duplex structure comprises 4-6 base pair.

7. the nucleic acid molecule of claim 1, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' RKSBUSNVGR 3 ' (SEQ.ID.No.120), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YYNRCASSMY 3 ' (SEQ.ID.No.121).

8. the nucleic acid molecule of any one in claim 1-4, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' X _ssSSV 3 ' (SEQ.ID.No.124), and described the second nucleotide fragments comprises nucleotide sequence 5 ' BSSSX _s3 ' (SEQ.ID.No.125), wherein X _sdisappearance or be S.

9. the nucleic acid molecule of any one in claim 1-4, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' SSSSR 3 ' (SEQ.ID.No.130), and described the second nucleotide fragments comprises nucleotide sequence 5 ' YSBSS 3 ' (SEQ.ID.No.131).

10. the nucleic acid molecule of any one in claim 1-4, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' GCSGG 3 ' (SEQ.ID.No.128), and described the second nucleotide fragments comprises nucleotide sequence 5 ' CCKGC 3 ' (SEQ.ID.No.129).

The nucleic acid molecule of 11. claims 1, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' UGAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUCA 3 '.

The nucleic acid molecule of 12. claims 1, wherein said the first nucleotide fragments comprises nucleotide sequence 5 ' GAGAUAGG 3 ', and described the second nucleotide fragments comprises nucleotide sequence 5 ' CUGAUUCUC 3 '.

The nucleic acid molecule of any one in 13. claim 1-4, wherein said nucleic acid molecule has arbitrary nucleotide sequence shown in SEQ.ID.No.79-81,83-89,94-119 and 134-136.

The nucleic acid molecule of 14. claims 1, wherein said nucleic acid molecule is the antagonist for SDF-1.

The nucleic acid molecule of 15. claims 14, wherein said nucleic acid molecule is the antagonist of described SDF-1 receptor system.

The nucleic acid molecule of 16. claims 15, the described SDF-1 acceptor of wherein said SDF-1 receptor system is CXCR4 acceptor.

The nucleic acid molecule of 17. claims 1, wherein said SDF-1 is people SDF-1.

The nucleic acid molecule of 18. claims 1, wherein said nucleic acid molecule comprises modifier.

The nucleic acid molecule of 19. claims 18, wherein said modifier is selected from HES part and peg moiety.

The nucleic acid molecule of 20. claims 19, wherein said modifier is the peg moiety consisting of straight or branched PEG.

The nucleic acid molecule of 21. claims 20, the molecular weight of wherein said peg moiety is 2-180kD.

The nucleic acid molecule of 22. claims 20, the molecular weight of wherein said peg moiety is 60-140kD.

The nucleic acid molecule of 23. claims 20, the molecular weight of wherein said peg moiety is about 40kD.

The nucleic acid molecule of 24. claims 20, wherein said modifier is HES part, the molecular weight of wherein said HES part is 10-130kD.

The nucleic acid molecule of 25. claims 1, the Nucleotide of wherein said nucleic acid molecule is L-Nucleotide.

26. pharmaceutical compositions, the nucleic acid molecule that it comprises any one in claim 1-25, and optionally comprise other components, wherein said other components are selected from the acceptable vehicle of pharmacy and forms of pharmacologically active agents.

The purposes of the nucleic acid molecule of any one in medicine preparation in 27. claim 1-25.

The purposes of 28. claims 27, wherein said medicine is used to treat and/or prevent disease or illness, and wherein said disease or illness are mediated by SDF-1.

29. the purposes of claim 28, wherein said disease or illness are selected from a rear portion disease (back-of-the-eye diseases); Mammary cancer, ovarian cancer, prostate cancer, carcinoma of the pancreas, thyroid carcinoma, nasopharyngeal carcinoma, colorectal carcinoma, lung cancer and cancer of the stomach; Osteosarcoma; Melanoma; Neurospongioma; Myeloblastoma and neuroblastoma; Leukemia; WHIM syndrome; Immunodeficiency syndrome; Angiogenesis; Inflammation; Multiple sclerosis; Rheumatoid arthritis/osteoarthritis and ephritis.

The purposes of 30. claims 29, wherein said disease or illness are selected from diabetic retinopathy and age-related macular degeneration

The purposes of 31. claims 27, wherein said medicine is used to suppress blood vessel generation, new vessel formation, inflammation and transfer.

32. mixtures that comprise the nucleic acid molecule of any one in SDF-1 and claim 1-25.

Images