CN103540683A - Biological kit for genetic detection of human papilloma virus 18 (HPV18) - Google Patents
Biological kit for genetic detection of human papilloma virus 18 (HPV18) Download PDFInfo
- Publication number
- CN103540683A CN103540683A CN201310294174.9A CN201310294174A CN103540683A CN 103540683 A CN103540683 A CN 103540683A CN 201310294174 A CN201310294174 A CN 201310294174A CN 103540683 A CN103540683 A CN 103540683A
- Authority
- CN
- China
- Prior art keywords
- primer
- hpv18
- pcr
- probe
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 19
- 241000388169 Alphapapillomavirus 7 Species 0.000 title claims abstract description 13
- 230000002068 genetic effect Effects 0.000 title abstract 5
- 239000000523 sample Substances 0.000 claims abstract description 40
- 238000000034 method Methods 0.000 claims abstract description 24
- 238000002360 preparation method Methods 0.000 claims abstract description 10
- 230000004544 DNA amplification Effects 0.000 claims abstract description 9
- 238000013461 design Methods 0.000 claims abstract description 9
- 238000012360 testing method Methods 0.000 claims description 43
- 238000006243 chemical reaction Methods 0.000 claims description 33
- 108090000623 proteins and genes Proteins 0.000 claims description 25
- 238000003908 quality control method Methods 0.000 claims description 15
- 239000000284 extract Substances 0.000 claims description 9
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 9
- 239000012498 ultrapure water Substances 0.000 claims description 9
- 239000003153 chemical reaction reagent Substances 0.000 claims description 8
- 108090000790 Enzymes Proteins 0.000 claims description 7
- 102000004190 Enzymes Human genes 0.000 claims description 7
- 230000003321 amplification Effects 0.000 claims description 7
- 239000007788 liquid Substances 0.000 claims description 7
- 238000007400 DNA extraction Methods 0.000 claims description 6
- 238000013016 damping Methods 0.000 claims description 6
- 239000012530 fluid Substances 0.000 claims description 6
- 239000012634 fragment Substances 0.000 claims description 5
- -1 dNTP Substances 0.000 claims description 4
- 238000002474 experimental method Methods 0.000 claims description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 4
- 201000010099 disease Diseases 0.000 claims description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 3
- 230000007170 pathology Effects 0.000 claims description 3
- MCTWTZJPVLRJOU-UHFFFAOYSA-N 1-methyl-1H-imidazole Chemical compound CN1C=CN=C1 MCTWTZJPVLRJOU-UHFFFAOYSA-N 0.000 claims description 2
- WFDIJRYMOXRFFG-UHFFFAOYSA-N Acetic anhydride Chemical compound CC(=O)OC(C)=O WFDIJRYMOXRFFG-UHFFFAOYSA-N 0.000 claims description 2
- 238000012408 PCR amplification Methods 0.000 claims description 2
- 230000004087 circulation Effects 0.000 claims description 2
- 230000000052 comparative effect Effects 0.000 claims description 2
- 238000013100 final test Methods 0.000 claims description 2
- PNDPGZBMCMUPRI-UHFFFAOYSA-N iodine Chemical compound II PNDPGZBMCMUPRI-UHFFFAOYSA-N 0.000 claims description 2
- 238000002156 mixing Methods 0.000 claims description 2
- 108091033319 polynucleotide Proteins 0.000 claims description 2
- 102000040430 polynucleotide Human genes 0.000 claims description 2
- 239000002157 polynucleotide Substances 0.000 claims description 2
- 239000002994 raw material Substances 0.000 claims description 2
- 150000003536 tetrazoles Chemical class 0.000 claims description 2
- 238000001962 electrophoresis Methods 0.000 claims 2
- 229920000936 Agarose Polymers 0.000 claims 1
- 238000004043 dyeing Methods 0.000 claims 1
- 238000003384 imaging method Methods 0.000 claims 1
- 108020004414 DNA Proteins 0.000 abstract description 14
- 238000003752 polymerase chain reaction Methods 0.000 abstract description 2
- 102000053602 DNA Human genes 0.000 abstract 2
- 239000013062 quality control Sample Substances 0.000 abstract 2
- 230000015572 biosynthetic process Effects 0.000 abstract 1
- 238000000746 purification Methods 0.000 abstract 1
- 238000003786 synthesis reaction Methods 0.000 abstract 1
- 239000013615 primer Substances 0.000 description 26
- 239000002987 primer (paints) Substances 0.000 description 26
- 208000022361 Human papillomavirus infectious disease Diseases 0.000 description 15
- 239000000047 product Substances 0.000 description 11
- 210000004027 cell Anatomy 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 5
- 208000015181 infectious disease Diseases 0.000 description 5
- 206010008342 Cervix carcinoma Diseases 0.000 description 4
- 208000006105 Uterine Cervical Neoplasms Diseases 0.000 description 4
- 241000700605 Viruses Species 0.000 description 4
- 201000010881 cervical cancer Diseases 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 241000701806 Human papillomavirus Species 0.000 description 2
- 108091034117 Oligonucleotide Proteins 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000003149 assay kit Methods 0.000 description 2
- 238000001574 biopsy Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 239000012528 membrane Substances 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 238000009595 pap smear Methods 0.000 description 2
- 238000012545 processing Methods 0.000 description 2
- 239000007790 solid phase Substances 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- 101150078635 18 gene Proteins 0.000 description 1
- 238000001712 DNA sequencing Methods 0.000 description 1
- 241000282412 Homo Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 208000009608 Papillomavirus Infections Diseases 0.000 description 1
- 235000011114 ammonium hydroxide Nutrition 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 238000002573 colposcopy Methods 0.000 description 1
- 230000008878 coupling Effects 0.000 description 1
- 238000010168 coupling process Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 230000002380 cytological effect Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 210000002919 epithelial cell Anatomy 0.000 description 1
- 210000000981 epithelium Anatomy 0.000 description 1
- 238000011010 flushing procedure Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
- 210000001541 thymus gland Anatomy 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 230000001018 virulence Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention provides a biological kit for genetic detection of human papilloma virus 18 (HPV18), a preparation method of the biological kit and an application of the biological kit on the aspect of genetic detection. The technical scheme of the invention relates to the design, synthesis and purification of a primer and a probe as well as the preparation of a cell extracting solution and a standard sample. The kit comprises a DNA (Deoxyribonucleic Acid) extracting solution, an HPV18PCR (Polymerase Chain Reaction) solution, an HPV18 strong positive quality control sample and an HPV18 negative quality control sample. By using the kit provided by the invention, the genetic detection for the HPV18 can be realized by using a PCR gene amplification method, so that the HPV18 can be screened and clinically diagnosed. When used for genetic detection, the kit provided by the invention is simple and convenient in step, high in defection efficiency and reliable in result.
Description
Technical field
The present invention relates to the technique of gene detection of biology field, relate in particular to for human papillomavirus 18(HPV18) detection method of biological reagent, its preparation method and the gene of gene test.
Background technology
Human papillomavirus (human papilloma virus, HPV) is a kind of DNA(thymus nucleic acid of minimum) virus.HPV is spherical in shape, and diameter is about 45～55nm, has the epithelium of having a liking for, widely distributed in humans and animals.HPV is widespread in nature, and generally infection rate was also very high in ten minutes for human infection HPV.Comprehensive more external reports, in general population HPV infection rate from lower than 1% to up to 50%, the people in property is enlivened crowd more than 20%～80% has HPV to infect history.
HPV virus can be divided into many hypotypes clinically, and the virus of different subtype may cause different diseases.In addition, according to the degree of virulence or dangerous size, different hypotypes can be divided into low danger and high-risk two large classes, wherein the infection of the high-risk hypotype of HPV can cause anogenital cancer and cervical cancer epithelial cell pathology.Human papillomavirus 18(HPV18) belonging to high-risk hypotype, is the important paathogenic factor of cervical cancer.
At present the examination of cervical cancer is mainly based on cytological detection method, have uterine neck Pasteur (Pap) smear, Biopsy under Colposcopy, Thinprep pap test learn or thin slice to prepare cytolgical examination (TCT) etc. multiple.
Uterine neck Pap smear is the conventional means of population screening, but drawn materials, smear is made quality, read chip technology affects, accuracy is low, false positive rate is high, poor repeatability, susceptibility is also limited, rate of missed diagnosis can reach 30%.TCT method can cause discomfort, operation is inconvenient, expense is high, is difficult for accepting for extensive patients.Cervical tissue biopsy has wound, is unfavorable for mass survey.
Summary of the invention
The object of the present invention is to provide a kind of have high specificity, highly sensitive detection kit, for rapid detection human papillomavirus 18(HPV18) type.It is simple that HPV18 detects, and sample can be gathered or patient asks for by doctor, is the important supplement to cytology detection method.
For achieving the above object, the invention provides a kind of biological reagent for HPV 18 (HPV18) gene test, its preparation method and in the method for gene test.
On the one hand, the invention provides a kind of test kit for HPV18 gene test.The component of described test kit comprises: primer, probe, Taq polysaccharase, 10 * buffer damping fluid, dNTP, touchstone product, negative quality control product and ultrapure water.
Wherein, synthetic primer is synthetic by the raw material that comprises CPG, tetrazole, diacetyl oxide and 1-Methylimidazole, iodine, dNTP.According to different somatotype design different primers and the probe of HPV.
On the other hand, the present invention also provides the preparation method for the test kit of HPV18 gene test, and it comprises the steps:
1) determine testing gene fragment: according to the preliminary selected candidate gene segment of the directivity report of scientific and technical literature, then in R&D process with the comparison of sample Correlation with Pathology to be checked, the final testing gene segment of confirming with the tool dependency of clinical disease;
2) according to described testing gene fragment, design and produce primer and probe, adopt polynucleotide synthesizer to produce described primer;
3) extract cell genomic dna: with DNA extraction liquid, extract patient's genome and control group genomic dna;
4) determine pcr amplification condition, it comprises the amplification condition of enzyme, probe, primer, genomic dna consumption and PCR: the primer segment of various combination, according to the specificity of experimental result, the technical characterictics such as susceptibility, repetition test is carried out the detection reaction of many described testing gene segments simultaneously, finally determines the optimum reaction condition that comprises described primer, probe optimum concn and enzyme, wherein, the result of pcr gene amplification is detected by fluorescent PCR instrument;
5) carry out repeatability and detect further determine reaction conditions: by great many of experiments, comparative experiments result repeatedly comprises the factor of sharpness and susceptibility, finally determines reaction conditions;
6) according to the final described reaction conditions of determining, prepare test kit, its component comprises: primer, probe, dNTP, 10 * buffer damping fluid, Taq polysaccharase, touchstone product, negative quality control product and ultrapure water.
Another aspect, the present invention also provides the method that adopts test kit of the present invention to carry out HPV18 gene test.
Adopt test kit of the present invention to carry out HPV18 gene test, the component of wherein said test kit comprises: cell extract, primer, probe, dNTP, 10 * buffer damping fluid, Taq polysaccharase, touchstone product, negative quality control product and ultrapure water.
It is template that the present invention be take with the patient's of genome extraction test kit extraction cell genomic dna, the components such as the primer providing with test kit, probe, dNTP, enzyme, reagent standard, 20 μ L reaction systems, according to specific ratio, add respectively, adopt pcr gene amplification technique, realize the gene test to HPV.
Concrete detecting step is as follows:
1) reagent is prepared: get PCR reaction solution standby.
2) application of sample: to being ready in the 0.2ml centrifuge tube of reagent, add respectively sample (comprising sample and positive quality control product) the supernatant liquor 1 μ l after processing, the centrifugal several seconds of 8,000rpm, put into instrument sample cell.3) program editing: by correspondence, negative quality control product and key sample (containing positive quality control product) not are sequentially set, and sample title is set in sample parameter.After setting program, move.
Key problem in technology of the present invention relates to the design of primer and probe, synthetic and the configuration of purifying and cell extract and the preparation of standard substance.
Advantage of the present invention is to adopt the method for pcr gene amplification to detect gene type, and method design and flow process are fairly simple; The input ratio of hospital is less, and the equipment of general hospital just can detect; Easy to use, without specific apparatus and enzyme, cut step; Detect consuming time shorter; Detection efficiency is high, and reliable results, effective, can be used for examination and the clinical diagnosis of HPV, has sizable market potential.
Gene amplification is flexible and the sensitiveest means in all DNA analysis technology, the present invention take PCR as basic detection method be the best method of carrying out HPV DNA detection and somatotype.Test kit of the present invention and method thereof can be applied to detect, viral load quantitatively, DNA sequencing and mutation analysis, also can carry out multiplex amplification, analyze a plurality of DNA sequence dnas simultaneously.
Accompanying drawing explanation
Relevant above-mentioned briefly introducing and following detailed description of the present invention, can be better understood by reference to the accompanying drawings.
Fig. 1 describes and with test kit, extracts b, c, the genome of tri-clinical samples of d.In figure: a represents HPV18 positive controls, b, c, d is respectively three clinical sample genomes that infect HPV patient, and e represents negative control group.Adopt HPV18 primer 18F1,18R1 and probe 18P1 carry out PCR, and FAM fluorescent signal detects; As shown in Figure 1, a is shown as standard S type curve, b to result, c, and d sample curve is also S curve, e is shown as straight line.Therefore determine b, c, d patient infection HPV is 18 hypotypes.
Embodiment
Before the invention will be further described, be to be understood that the present invention is not limited to the embodiment of following relevant invention.Also should be appreciated that term as used herein is just for being described for specific embodiment, rather than be used for limiting simultaneously.
DNA synthesizer used is German polygen, and the preparation method of primer adopts solid phase phosphoramidite triester method, and phosphoramidite triester method synthetic DNA fragment has efficiently, coupling fast and the more stable feature of initial reactant.Phosphoramidite triester method is that DNA is fixed on solid phase carrier and completes the synthetic of DNA chain, and synthetic direction is synthetic to 5' end by the 3' end of primer to be synthesized, and adjacent Nucleotide connects by 3' → 5' phosphodiester bond.
In detection, needed plant and instrument mainly contains: DNA synthesizer, fluorescent PCR instrument etc.
This test kit detects the principle of analyzing: according to HPV virus, be embedded in human genome, and do not have in normal people, therefore, when take two kinds of people's genome when template is carried out the amplification of polymerase chain reaction, patient occurs that viral object band is S curve, and normal people does not occur that band is without S curve.By this kind of method, detect Patients with Cervical Cancer.
The preparation of embodiment 1. primers
In this example, the preparation of primer comprises the following steps:
With German polygenDNA synthesizer synthetic primer and probe
1) open instrument and software
2) calibrating reagent is selected the slide block of slide block and 10 pillars of calibration
3) open automatic flushing function liquid is full of to each pipe.
4) with CPG, fill the hole in pillar slide block
Before synthetic, should will in pillar slide block, fill correct CPG, the Nucleotide that in pillar, populated CPG contains 3 ' corresponding end, because the order of instrument synthetic oligonucleotide has been held to 5 ' from 3 ' end.
Attention: add the filter membrane of striking suddenly in CPG process, leak out now otherwise may have.
5) slide block is installed on instrument.
6) before synthetic beginning, input needed sequence as master routine, press beginning key and bring into operation.
7) after having moved, will in slide block slave unit, unload down, with the thin head end of stamp, the material in pillar and filter membrane are got rid of.Operator are attached to pillar slide block on model stand, and install firm.With little collection tube, CPG is collected, be for further processing.
8) oligonucleotide is separated with CPG, by ammoniacal liquor pyroprocessing, be connected to that primer on CPG is cut to be come, by PAGE method, purify primer, after dilute with water is complete, by micro-ultraviolet spectrophotometer, measure its content.
On NCBI, find HPV18 sequence, with primer express software, according to sequences Design, go out primer and probe, by NCBI, go up BLAST again and compare, find the specific sequence that this primer probe sequence is HPV18, therefore using it as the primer and the probe that detect HPV18.
Design synthetic (18F1 and 18R1) and probe (18P1) sequence see the following form.
| Title | Sequence |
| 18F1 | GCCCTCGCAAACGTTCTG |
| 18R1 | CACACGCTTGGCAGGTTTAG |
| 18P1 | VIC-TCCATCTGCCACTACGT-MGB?NFQ |
The establishment of embodiment 2. test kits
DNA extraction liquid (500 μ l/ pipe) 2 pipes, HPV18PCR reaction solution (19 μ l/ pipe) 20 pipes, HPV18 strong positive quality control product (200 μ l/ pipe) 1 pipe, negative quality control product (150 μ l/ pipe) 1 pipe.Wherein, above-mentioned HPV18PCR reaction solution comprises, for example, and ultrapure water 14.3 μ l, 10 * buffer2 μ l, dNTP0.4 μ l, primer 1,8F1 0.4 μ l, 1,8R1 0.4 μ l, probe 1,8P1 0.4 μ l.
Operation and the detected result of embodiment 3. test kits
In the PCR of 0.2mL pipe the inside, add patient's template (50ng/ μ l), after instantaneous centrifugal mixing, put into PCR instrument, wherein PCR reaction system and reaction conditions are as follows:
1) PCR reaction system (20 μ l)
The wherein configuration of PCR reaction solution: ultrapure water 14.3 μ l, 10 * buffer2 μ l, d NTP0.4 μ l, primer 1,8F1 0.4 μ l, 1,8R1 0.4 μ l, probe 1,8P1 0.4 μ l.
2) amplification program
° C15s → 60, ° C2min → 95,60 ° of C30s → 95 ° C1min(totally 40 circulations).
By embodiment of the present invention, obtain the results of comparison (see figure 1) for Normal group and infection HPV18 gene amplification.
All technology used herein and scientific terminology, unless otherwise defined, have the implication that those skilled in the art can understand conventionally.Although can be used to enforcement of the present invention or detection to any method, device and material similar or that be equal to described herein, described herein is preferred method, device and material.
In above-mentioned specification sheets, for some preferred implementations, be described, and for the object of explanation provides many details, yet those skilled in the art should be understood that the present invention, can have various variations and how different embodiments, and details described herein can there is suitable variation and can not depart from the spirit and scope of the present invention.
Claims (8)
1. for human papillomavirus 18(HPV18) test kit of gene test, it comprises DNA extraction liquid, HPV18PCR reaction solution, HPV18 strong positive quality control product and negative quality control product, wherein:
Described HPV18PCR reaction solution comprises ultrapure water, damping fluid, dNTP, primer 18F1 and 18R1, and probe 18P1;
The sequence of described primer 18F1 is GCCCTCGCAAACGTTCTG, and the sequence of described primer 18R1 is CACACGCTTGGCAGGTTTAG, and the sequence of described probe 18P1 is VIC-TCCATCTGCCACTACGT-MGB NFQ.
2. test kit according to claim 1, wherein said test kit comprises: DNA extraction liquid 2 pipes; HPV18PCR reaction solution 20 pipes; HPV18 strong positive quality control product 1 pipe; Negative quality control product 1 pipe.
3. test kit according to claim 2, wherein said test kit comprises: DNA extraction liquid 2 pipes, 500 μ l/ pipes; HPV18PCR reaction solution 20 pipes, 19 μ l/ pipes; HPV18 strong positive quality control product 1 pipe, 200 μ l/ pipes; Negative quality control product 1 pipe, 150 μ l/ pipes; Wherein, described HPV18PCR reaction solution comprises ultrapure water 14.3 μ l, 10 * buffer damping fluid, 2 μ l, d NTP0.4 μ l, primer 18F10.4 μ l, 18R10.4 μ l, probe 18P10.4 μ l.
4. test kit according to claim 1, wherein said primer is synthetic by the raw material that comprises CPG, tetrazole, diacetyl oxide and 1-Methylimidazole, iodine, dNTP, and designs according to the different somatotypes of HPV.
5. for the preparation of the method for test kit claimed in claim 1, it comprises the steps:
1) determine testing gene fragment: according to the preliminary selected candidate gene segment of the directivity report of scientific and technical literature, then in R&D process with the comparison of sample Correlation with Pathology to be checked, the final testing gene segment of confirming with the tool dependency of clinical disease;
2) according to described testing gene fragment, design and produce primer and probe, adopt polynucleotide synthesizer to produce described primer;
3) extract cell genomic dna: with DNA extraction liquid, extract patient's genome and control group genomic dna;
4) determine pcr amplification condition, it comprises the amplification condition of enzyme, probe, primer, genomic dna consumption and PCR: the primer segment of various combination, according to the specificity of experimental result, the technical characterictics such as susceptibility, repetition test is carried out the detection reaction of many described testing gene segments simultaneously, finally determines the optimum reaction condition that comprises described primer, probe optimum concn and enzyme, wherein, the result of pcr gene amplification is detected by fluorescent PCR instrument;
5) carry out repeatability and detect further determine reaction conditions: by great many of experiments, comparative experiments result repeatedly comprises the factor of sharpness and susceptibility, finally determines reaction conditions;
6) according to the final described reaction conditions of determining, prepare test kit, its component comprises: primer, probe, dNTP, 10 * buffer damping fluid, Taq polysaccharase, touchstone product, negative quality control product and ultrapure water.
6. the method that adopts test kit claimed in claim 1 to carry out HPV18 gene test, it comprises:
Take with the cell genomic dna that genome extracts the patient that test kit extracts is template, the components such as the primer providing with test kit, probe, dNTP, enzyme, reagent standard, and 20 μ L reaction systems, add respectively according to specific ratio;
Adopt pcr gene amplification technique, carry out PCR reaction;
After PCR finishes, adopt the special-purpose electrophoresis apparatus of agarose carry out electrophoresis, EB dyeing, imaging and carry out gene type, thereby realize the gene test to HPV18.
7. detection method according to claim 6, wherein said PCR reaction further comprises:
In the PCR of 0.2mL pipe the inside, add patient's template (50ng/ μ l), after instantaneous centrifugal mixing, put into PCR instrument, under the PCR reaction system of setting and amplification program condition, obtain for Normal group and the results of comparison that infects HPV18 gene amplification.
8. detection method according to claim 7, wherein said PCR reaction system and reaction conditions comprise:
PCR reaction system (20 μ l), comprising: HPV18PCR reaction solution 18 μ l, template 2 μ l; The wherein configuration of PCR reaction solution: ultrapure water 14.3 μ l, 10 * buffer2 μ l, d NTP0.4 μ l, primer 18F10.4 μ l, 18R10.4 μ l, probe 18P10.4 μ l;
Amplification program, comprising: ° C15s → 60, ° C2min → 95,60 ° of C30s → 95 ° C1min(totally 40 circulations).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310294174.9A CN103540683A (en) | 2012-07-13 | 2013-07-12 | Biological kit for genetic detection of human papilloma virus 18 (HPV18) |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210244357.5 | 2012-07-13 | ||
| CN201210244357 | 2012-07-13 | ||
| CN201310294174.9A CN103540683A (en) | 2012-07-13 | 2013-07-12 | Biological kit for genetic detection of human papilloma virus 18 (HPV18) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103540683A true CN103540683A (en) | 2014-01-29 |
Family
ID=49964529
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310294133.XA Pending CN103540682A (en) | 2012-07-13 | 2013-07-12 | Biological kit for genetic detection of human papilloma virus 16 (HPV16) |
| CN201310294174.9A Pending CN103540683A (en) | 2012-07-13 | 2013-07-12 | Biological kit for genetic detection of human papilloma virus 18 (HPV18) |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310294133.XA Pending CN103540682A (en) | 2012-07-13 | 2013-07-12 | Biological kit for genetic detection of human papilloma virus 16 (HPV16) |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN103540682A (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018580A (en) * | 2014-04-28 | 2015-11-04 | 天津安必森生物技术有限公司 | Biological reagent used for detecting BRAF gene mutation |
| CN105018584A (en) * | 2014-04-30 | 2015-11-04 | 天津安必森生物技术有限公司 | Biological reagent used for detecting K-ras gene mutation |
| CN106282413B (en) * | 2016-09-30 | 2019-11-22 | 广州易活生物科技有限公司 | Probe combinations, kit and the method for the high-risk strain Genotyping detection of HPV |
| CN112981004A (en) * | 2019-12-17 | 2021-06-18 | 广东菲鹏生物有限公司 | Reagent for detecting HPV (human papillomavirus), kit and application thereof |
| CN116286982B (en) * | 2022-09-09 | 2024-01-30 | 广州凯普医药科技有限公司 | HPV genotyping detection positive reference, preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003076667A1 (en) * | 2002-03-14 | 2003-09-18 | Genoid Kft | Amplification-hybridisation method for detecting and typing human papillomavirus |
| CN1948503A (en) * | 2005-10-10 | 2007-04-18 | 上海透景生命科技有限公司 | Detection and parting method of human papillomavirus and reagent box |
| CN101503741A (en) * | 2009-03-04 | 2009-08-12 | 上海之江生物科技有限公司 | Reagent kit for detecting high-risk human mammilla papillomavirus, as well as preparation and application thereof |
| CN101624632A (en) * | 2008-07-08 | 2010-01-13 | 天津生物芯片技术有限责任公司 | Human papillomavirus gene chip, preparation and application thereof, assay kit and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101017141A (en) * | 2006-02-09 | 2007-08-15 | 港龙生物技术（深圳）有限公司 | Polymerase chain reaction (PCR) method for diagnosing human papillomavirus (HPV) and reagent kit thereof |
| CN101613764B (en) * | 2009-08-03 | 2012-05-23 | 广州锐达生物科技有限公司 | High-risk type HPV fluorescence PCR screening method and primer, probe and kit thereof |
| CN102251056B (en) * | 2011-06-02 | 2013-03-27 | 江阴泰康生物科技有限公司 | Assay kit for amplifying and genotyping nucleic acid genes of human papilloma virus |
-
2013
- 2013-07-12 CN CN201310294133.XA patent/CN103540682A/en active Pending
- 2013-07-12 CN CN201310294174.9A patent/CN103540683A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003076667A1 (en) * | 2002-03-14 | 2003-09-18 | Genoid Kft | Amplification-hybridisation method for detecting and typing human papillomavirus |
| CN1948503A (en) * | 2005-10-10 | 2007-04-18 | 上海透景生命科技有限公司 | Detection and parting method of human papillomavirus and reagent box |
| CN101624632A (en) * | 2008-07-08 | 2010-01-13 | 天津生物芯片技术有限责任公司 | Human papillomavirus gene chip, preparation and application thereof, assay kit and application thereof |
| CN101503741A (en) * | 2009-03-04 | 2009-08-12 | 上海之江生物科技有限公司 | Reagent kit for detecting high-risk human mammilla papillomavirus, as well as preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103540682A (en) | 2014-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101487063B (en) | Human papilloma virus infection gene amplification fluorescent detection kit | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN103540683A (en) | Biological kit for genetic detection of human papilloma virus 18 (HPV18) | |
| CN107177699A (en) | A kind of human papilloma virus（HPV）Parting quick determination method | |
| CN105755169B (en) | Detection and typing kit for high-risk human papilloma virus and application thereof | |
| CN110157839A (en) | Quadruple fluorescence quantitative detection kit that is a kind of while detecting four kinds of human corona virus | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN103409555B (en) | Macrobrachium rosenbergii Nodavirus RT-LAMP-LFD detection method and detection kit thereof | |
| US20180305745A1 (en) | Systemic lupus erythematosus biomarker and diagnostic kit thereof | |
| CN104017907B (en) | A kind of HPV high-risk-type fluorescence PCR detection reagent kit | |
| CN101613764B (en) | High-risk type HPV fluorescence PCR screening method and primer, probe and kit thereof | |
| CN105296674A (en) | Detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and preparation method of detecting kit | |
| CN104017906B (en) | A kind of HPV high-risk-type parting fluorescence PCR detection kit | |
| CN102703606B (en) | Solid phase chip, probe and detection kit of HR-HPV E6/E7 gene single nucleotide polymorphism (SNP) detection | |
| CN104560962B (en) | Fluorescent PCR kit and its primer special group for detecting HPV | |
| CN102994647B (en) | Typing and quantitative detection method and kit for human papilloma virus (HPV) | |
| CN105018647A (en) | HPV (human papilloma virus) 16/18 detection kit based on digital PCR (polymerase chain reaction) accurate quantitative typing and detection method thereof | |
| CN101861523A (en) | Automatic detection of infectious diseases | |
| CN103184294A (en) | Multi-channel fluorescence PCR detection method and kit for human papillomavirus (HPV) types 16 and 18 | |
| CN104031997B (en) | A kind of LAMP primer group for rapid detection ustilago scitaminea bacteria, test kit and detection method thereof | |
| CN104561375A (en) | Isothermal amplification detection kit and detection method of new bunyavirus | |
| CN105950788B (en) | Detect the primer, probe and kit of 18 kinds of high-risk HPV nucleic acid | |
| CN116555427A (en) | Methylation gene combination, primer, probe and kit for early detection of cervical cancer | |
| CN113584225B (en) | Primer and probe combination for detecting HPV (human papillomavirus) virus, typing detection reagent and application thereof | |
| CN108950085A (en) | It is a kind of for detecting the primer sets and kit of 3 type of pig circular ring virus and porcine pseudorabies virus street strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| ASS | Succession or assignment of patent right |
Owner name: TIANJIN ANBISEN BIOTECHNOLOGY CO., LTD. Free format text: FORMER OWNER: ZHONG JIAN Effective date: 20140821 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; TO: 300384 NANKAI, TIANJIN |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20140821 Address after: Huayuan Science Park, Binhai hi tech Industrial Development Zone of Tianjin City Road 300384 yuan C No. 5 room 228 Applicant after: TIANJIN ANBISEN BIOSCIENCE Co.,Ltd. Address before: Massachusetts, USA Applicant before: Zhong Jian |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: Huayuan Science Park, Binhai hi tech Industrial Development Zone, Tianjin City Road 300384 yuan B No. 5 room 522 Applicant after: TIANJIN ANBISEN BIOSCIENCE Co.,Ltd. Address before: Huayuan Science Park, Binhai hi tech Industrial Development Zone of Tianjin City Road 300384 yuan C No. 5 room 228 Applicant before: TIANJIN ANBISEN BIOSCIENCE Co.,Ltd. Inventor after: Zhong Jian Inventor after: Fang Pingke Inventor after: Tian Hua Inventor before: Zhong Jian Inventor before: Fang Pingke |
|
| CB03 | Change of inventor or designer information | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140129 |