CN103540653A - Applications of homeobox A1 (HOXA1) gene and expression product thereof - Google Patents

Applications of homeobox A1 (HOXA1) gene and expression product thereof Download PDF

Info

Publication number
CN103540653A
CN103540653A CN201210246001.5A CN201210246001A CN103540653A CN 103540653 A CN103540653 A CN 103540653A CN 201210246001 A CN201210246001 A CN 201210246001A CN 103540653 A CN103540653 A CN 103540653A
Authority
CN
China
Prior art keywords
hoxa1
sequence
gene
liver cancer
product
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201210246001.5A
Other languages
Chinese (zh)
Inventor
邓庆
韩泽广
王群
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chinese National Human Genome Center at Shanghai
Shanghai Human Genome Research Center
Original Assignee
Shanghai Human Genome Research Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Human Genome Research Center filed Critical Shanghai Human Genome Research Center
Priority to CN201210246001.5A priority Critical patent/CN103540653A/en
Publication of CN103540653A publication Critical patent/CN103540653A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses applications of a homeobox A1 (HOXA1) gene and an expression product thereof. The homeobox A1 (HOXA1) gene and the expression product thereof are used for preparing products for diagnosing and treating liver cancer. The HOXA1 gene and the expression product thereof can be used as one of genes for diagnosing the liver cancer, and as a result, the liver cancer can be accurately and quickly diagnosed; the HOXA1 gene and the expression product thereof can be served as target genes for preparing medicines for treating the liver cancer, so that a new liver cancer treatment method is provided.

Description

The application of HOXA1 gene and expression product thereof
Technical field
The present invention relates to a kind of application of gene, particularly relate to the application of a kind of HOXA1 gene and expression product thereof.
Background technology
China people's life and health in liver cancer serious threat.The diagnosis of liver cancer, especially early diagnosis is the key of clinic diagnosis and prognosis.The treatment of liver cancer has obtained very large progress in the past over 20 years, surgical resection and liver transplantation belong to " radical-ability " treatment, are still the primary selection of liver cancer treatment.Along with the raising of hepatocarcinoma early diagnosis level and the change of oncotherapy biological concept, improve day by day the status of tumor by local non-operative treatment in liver cancer treatment.Transcatheter arterial chemoembolization (TACE) has become the prefered method that can not excise liver cancer treatment, is the important means of mid and late liver cancer treatment.The method can make more than 90% liver cancer patient be benefited, but general curative effect has much room for improvement.In addition, in percutaneous transhepatic puncture knurl, ethanol treatment (PEI) is also the local chemotherapy method of commonly using, and the liver cancer of cancer diameter <3cm and the treatment of TTPV are had to certain values.But the chemotherapeutics of liver cancer is continued to use the medicine of other tumours substantially at present, and specific aim is poor, unsatisfactory curative effect, therefore, and in the urgent need to finding new action target spot, the special novel drugs of research and development liver cancer, specificity and the validity of raising chemotherapy.In recent years along with going deep into liver cancer fundamental research, biotherapy has obtained greater advance in the complex therapy of liver cancer, become the fourth-largest therapy of oncotherapy after operation, radiotherapy, chemotherapy, as immunotherapy, gene therapy, comprise angiogenesis inhibitor, suicide gene therapy, tumor vaccine therapy, siRNA technology etc.But the clinical efficacy of many biotherapies is still very dissatisfied, and the overwhelming majority is also in the experimental study stage, and relevant key theory and experimental technique still need further research and development.
HOXA1 gene, in vertebrates, has one group of transcription factor of a class homologous genes encoding, and a class transcription factor is divided into A, B, and C, D family, this genoid is distributed on four different karyomit(e)s.Expression time and the space of these albumen change along with fetal development.HOXA1 gene is positioned at a member of No. 7 A families on karyomit(e), the transcription factor of being combined with DNA of having encoded, thereby regulate gene expression, and form forms also has differentiation.The Research Literature report of relevant HOXA1 gene is less, and particularly the relation research of HOXA1 gene and liver cancer yet there are no bibliographical information.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of HOXA1 gene and the application of expression product in preparing the product of diagnosing liver cancer thereof.
Two of the technical problem to be solved in the present invention is to provide a kind of HOXA1 gene and the application of expression product in preparing the medicine of Hepatoma therapy thereof.
Three of the technical problem to be solved in the present invention is to provide the primer of a pair of specific amplified HOXA1 gene, and this primer can be used for the product of real-time quantitative PCR diagnosing liver cancer for preparation.
Four of the technical problem to be solved in the present invention is to provide the sequencing primer of HOXA1 gene specific coding DNA fragmentation, and this sequencing primer can be used for the product of DNA sequencing diagnosing liver cancer for preparation.
Five of the technical problem to be solved in the present invention is to provide the siRNAs of HOXA1 gene, and this siRNAs can be used for preparing the medicine of Hepatoma therapy.
The order-checking of exon group is for the protein coding region in genome, and the order-checking of target enrichment exon region, to find the technology of disease-related heritable variation.This technology is in recent years applied to more and more find the variation of human genome low frequency, identifies the complex disease tumor susceptibility gene researchs such as single gene inheritance disease Disease-causing gene and tumour, becomes the important tool of human diseases covariation research.In order to identify the gene that somatic mutation occurs in onset of liver cancer process, the present invention has adopted exon group sequencing technologies to analyze hepatocarcinoma patient carcinoma in situ tissue, TTPV tissue and the corresponding cancer beside organism of 10 examples with TTPV in liver.By high-throughput data are carried out to rigorous analysis, filter sieve is selected 475 reliable point mutation.In order to identify important liver cancer related gene, by the gene design specific siRNA s that is there is sudden change by the checking of Sanger sequence measurement for 91, in 8 strain hepatoma cell strains, screen the candidate gene of remarkably influenced cells survival.Quantitative PCR detection HOXA1 gene is up-regulated in part hepatocarcinoma patient cancerous tissue.In vertebrates, there is a class to be referred to as " homebox " gene, their encoding transcription factors, cluster is distributed on four different karyomit(e)s.During fetal development, the expression of these albumen is according to time and spatial variations and regulated and controled.HOXA1 genes encoding DNA is in conjunction with transcription factor, and regulatory gene is expressed, form occurs and differentiation.
In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:
In one aspect of the invention, a kind of HOXA1 gene and the application of expression product in preparing the product of diagnosing liver cancer thereof are provided.
The product of described diagnosing liver cancer comprises: the product of the product of use real-time quantitative PCR diagnosing liver cancer, use DNA sequencing diagnosing liver cancer.
The described product with real-time quantitative PCR diagnosing liver cancer at least comprises the primer of a pair of specific amplified HOXA1 gene.
The described product with DNA sequencing diagnosing liver cancer comprises: for the sequencing primer of HOXA1 gene specific coding sequence.
In another aspect of this invention, a kind of primer for the preparation of a pair of specific amplified HOXA1 gene in the product with real-time quantitative PCR diagnosing liver cancer is provided, the upstream primer sequence of described primer has sequence or its complementary sequence as shown in SEQ ID NO:9, and the downstream primer sequence of described primer pair has sequence or its complementary sequence as shown in SEQ ID NO:10.
In another aspect of this invention, a kind of sequencing primer for the preparation of the HOXA1 gene specific coding sequence in the product with DNA sequencing diagnosing liver cancer is provided, the upstream primer sequence of described primer has sequence or its complementary sequence as shown in SEQ ID NO:1, and the downstream primer sequence of described primer pair has sequence or its complementary sequence as shown in SEQ ID NO:2.
In another aspect of this invention, a kind of HOXA1 gene and the application of expression product in preparing the medicine of Hepatoma therapy thereof are provided.
Medicine and the mode of described Hepatoma therapy comprise: by RNA, disturb double stranded RNA, DNA vector, adenovirus or the gland relevant viral vector that suppresses HOXA1 genetic expression, can suppress compound, polypeptide, the monoclonal antibody of HOXA1 protein product activity.
Wherein, the medicine of described Hepatoma therapy comprises: by RNA disturb specificity to suppress the double stranded RNA of HOXAl genetic expression and different modifying state thereof, difference is sent mode.
The medicine of described Hepatoma therapy comprises: carry specificity and for HOXAl gene, disturb DNA vector, the virus vector of its expression.
In another aspect of this invention, be provided for preparing two couples of siRNAs of the HOXAl gene of Hepatoma therapy medicine, be respectively HOXAl-si1 and HOXAl-si2.Wherein, the positive-sense strand of HOXAl-si1 has sequence as shown in SEQ ID NO:3, and the antisense strand of HOXAl-si1 has sequence as shown in SEQ ID NO:4.The positive-sense strand of HOXAl-si2 has sequence as shown in SEQ ID NO:5, and the antisense strand of HOXAl-si2 has sequence as shown in SEQ ID NO:6.
The medicament administration mode of Hepatoma therapy of the present invention can be oral, systemic administration (for example, see through skin, snuffing enters or with suppository) or parenteral administration (for example, intramuscular, intravenously or subcutaneous).
Medicine of the present invention also can be made into injection form, for example, with physiological saline or the aqueous solution that contains glucose and other assistant agents, by ordinary method, be prepared.Medicine such as Tablet and Capsula, can be prepared by ordinary method.Injection, solution, Tablet and Capsula should be manufactured under aseptic condition.
In the present invention, can prepare for the special antibody of HOXA1 albumen by a series of methods known in the art.For example, the people HOXA1 gene product of purification or its antigen fragment are injected in animal body to produce polyclonal antibody.Equally, the cell of expression people's HOXA1 albumen or its antigen also can be used for animal to cause immunity and produce antibody.Antibody prepared in accordance with the present invention can be monoclonal antibody, and these monoclonal antibodies can be prepared in time with hybridoma.Antibody of the present invention comprises the antibody that can prevent HOXA1 function, can be also the antibody that does not affect people HOXA1 function.Each antibody-like can produce by the fragment of people HOXA1 gene product or functional domain are caused to immunity, and people HOXA1 gene product and fragment thereof can produce or synthesize with Peptide synthesizer with recombination method.With the antibody that the HOXA1 of non-modified form gene product is combined, can utilize the gene product for example producing in E.coli at prokaryotic cell prokaryocyte carry out immune animal and obtain.With the antibody that posttranslational modification form is combined as glycosylation or phosphorylation HOXA1 albumen or polypeptide, can utilize the gene product producing in as yeast or insect cell at eukaryotic cell carry out immune animal and obtain.
In the present invention, in order to realize the application in preparing the product of diagnosing liver cancer of HOXA1 gene and expression product thereof, HOXA1 gene and expression product thereof are as the object of diagnosing cancer of liver mark application, and the present invention can be achieved through the following technical solutions:
(1) detect the nucleotide sequence of HOXA1 gene opening code-reading frame (ORF) in liver cancer tissue, wherein, in the present invention, find that the nucleotide sequence of HOXA1 gene opening code-reading frame (ORF) in a routine hepatocarcinoma patient tissue exists sudden change.
(2) real-time quantitative PCR detects the differential expression of HOXA1 gene mRNA in hepatocarcinoma patient cancerous tissue and corresponding cancer beside organism.
And the application in preparing the medicine of Hepatoma therapy for HOXA1 gene and expression product thereof, HOXA1 gene and expression product thereof are as the target spot of preparing cancer treatment drug, and the present invention can be achieved through the following technical solutions:
(1) chemosynthesis double stranded ribonucleic acid molecule, its sequence-specific is for HOXA1 gene order, utilize liposome to be delivered in liver cancer cell, disturb the expression of HOXA1 gene, CCK-8 method is measured liver cancer cell Huh-7, PLC/PRF/5, Focus and MHCC-97L growth activity, in the present invention, the results show specificity can suppress the external growth of liver cancer cell for the small ribonucleic acid molecules of HOXA1 gene, illustrates that HOXA1 gene can be used as preparing the target gene of cancer treatment drug;
(2) utilize various carriers, comprise that DNA vector, adenovirus, gland relevant viral vector disturb the expression of HOXA1 gene, reach the effect of body internal interference HOXA1 gene, thereby realize the object that suppresses liver cancer cell proliferation in vivo;
(3) obtain polypeptide, the monoclonal antibody that can specificity suppresses HOXA1 gene proteins, reach the object that suppresses HOXA1 protein-active, thereby realize the object that suppresses liver cancer cell proliferation in vivo;
In the present invention, for specificity, disturb the micro ribonucleic acid sequences Design principle of HOXA1 gene as follows:
1) .GC content 30%-52%;
2) in the 15-19 base of .sense chain, at least contain 3 A/U;
3). do not contain inverted repeats;
4) the 19th base of .sense chain is A;
5) the 3rd base of .sense chain is A;
6) the 10th base of .sense chain is U;
7) the 19th base of .sense chain is not G/C;
8) the 13rd base of .sense chain is not G.
The present invention discloses the application of HOXA1 gene and expression product thereof first, and by experiment of the present invention, confirm that first HOXA1 gene is in hepatocarcinoma patient generation missense mutation (as shown in Figure 1), and by HOXA1 gene order specific siRNA, disturb the growth that can significantly suppress liver cancer cell, therefore, HOXA1 gene and expression product thereof can be used as the mark of diagnosing liver cancer and for the drug target of liver cancer treatment, make diagnosing cancer of liver more accurately, fast, and the gene target spot of new liver cancer treatment is provided.In a word, the control that HOXA1 gene of the present invention and expression product thereof are liver cancer provides new treatment target spot and effective new drug.
Accompanying drawing explanation
Below in conjunction with accompanying drawing and embodiment, the present invention is further detailed explanation:
Fig. 1 is the order-checking peak figure undergoing mutation in HOXA1 gene Yi Li hepatocarcinoma patient cancer beside organism, cancerous tissue and TTPV sample in embodiment 2, and result shows that this sudden change causes the change of HOXA1 albumen the 287th amino acids.
Fig. 2 is RNAi triage techniques system schematic diagram in embodiment 3.
Fig. 3 is the RNAi screening general status schematic diagram of embodiment 3 Plays.
Fig. 4 is the statistical significance schematic diagram of the impact of the every strain cytoactive of Z value and p value assessment siRNA in embodiment 3.
Fig. 5 is that in embodiment 5, real-time quantitative PCR is evaluated HOXA1-si1, the interference effect schematic diagram of HOXA1-si2 in Huh-7, PLC/PRF/5, Focus, MHCC-97L cell.
Embodiment
Following examples are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in embodiment, conventionally according to normal condition, such as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The exon group of embodiment 110 routine hepatocarcinoma patients is caught order-checking
1. totally 30 tissue samples (experiment with tissue-derived in primary hepatocarcinoma and with operation patients cancer beside organism, cancerous tissue, the TTPV tissue of portal vein transfer) carry out tissue DNA extracting.The tissue DNA extraction agent box that adopts German QIAGEN company, experimental procedure is carried out according to product description.It is standby after qualified that extracting gained DNA takes into account 0.8% agarose gel electrophoresis quality inspection through ND-1000 spectrophotometric.Wherein routine patient's TTPV tissue DNA degraded, all the other 29 tissue samples DNA quality meet the requirements.
2.Nimblegen exon trapping, first genomic dna is broken into the fragment of 500bp left and right at random, connects respectively top connection subsequently at DNA fragmentation two ends.DNA fragmentation and NimbleGen2.1M Human Exome Array chip after the inspection of PCR storehouse is qualified are hybridized.Remove not after the background dna with chips incorporate, the DNA fragmentation of the exon region through enrichment is eluted.These DNA fragmentations connect into again after length dna fragment at random, are again interrupted at random and add sequence measuring joints at its two ends, through the linear amplification of LM-PCR, in the order-checking that is available on the machine after qPCR quality examination is qualified.
3. adopt Illumina Genome Analyzer II sequencing system to check order.Sort sequencer technology is by being attached to optically transparent surface by the random segment of genomic dna, these DNA segments increase by prolongation and bridge, formed the Flowcell with hundreds of millions of cluster, each cluster has the same DNA template of approximately 1000 copies, and the fluorescently-labeled base of difference being then closed with 4 kinds of ends is carried out the order-checking while synthesizing.This novel method has guaranteed that pinpoint accuracy and a real base connect the order-checking of a base, have got rid of the specific fault of sequence aspect, the homopolymer that can check order and tumor-necrosis factor glycoproteins.
4.ABI SOLiD order-checking.Order-checking agents useful for same adopts SOLiD Fragment Library Core Kit(Applied Biosystems, 4464412).According to G3360-90001_SureSelect_SOLiD, genomic dna is carried out to fragmentation, end reparation, 100-250bp Piece Selection, 3 ' end and add the steps such as wash-out after adenylic acid (AMP), jointing, front amplification, hybridization, hybridization, rear amplification, complete order-checking sample library construction.Institute is used in the library of building
Figure BDA00001892795900061
2.0Fluorometer instrument detectable level, FlashGel Dock system Lonza gel electrophoresis or Agilent 2100 Bioanalyzer detect size and the purity in library.Quality control standard: build library concentration and be not less than 1ng/ μ L; Library size～260bp that electrophoresis observation builds.According to SOLiD tMeZ Bead tMemulsifier (4441486B, AB), SOLiD tMeZ Bead tMamplifier (4443494B, AB), SOLiD tMeZ Bead tMenricher (4443496B, AB) corresponding program completes Emulsion PCR in automatization EZ system.According to Applied Biosystems 5500 Series Genetic Analyzers User Guide(4456991E) prepare sequencing reagent, by the upper machine of the Flowchip that completes beads, select Fragment program, carry out unidirectional 1 * 75bp order-checking.The Instrument Control Software that order-checking process is provided by ABI controls, and can each ligation of real-time monitored.
5. master data analysis, comprising: data output statistics: sequencing result is carried out to pattern recognition (Base calling), remove and pollute and joint sequence; Statistics comprises: the sequence of mensuration (Reads) length, Reads quantity, data throughput.
6. high-level data analysis, comprising: (1) Clean reads sequence with reference to genome sequence, compare; (2) target exon region order-checking depth analysis; (3) target exon region concensus sequence assembling; (4) target exon region SNP detects and the annotation in CCDS database; (5) variable shearing, gene fusion, exon convergence analysis.
Embodiment 2 checks order to HOXA1 gene specific coding sequence in hepatocarcinoma patient tissue
1, the extracting of liver cancer tissue DNA
Adopt the DNA of QIAGEN company extraction agent box (QIAamp DNA Mini Kit, the Cat.no.:51306) extraction procedure of being correlated with, specifically see this product description, operation steps is summarized as follows:
(1) tissue is positioned over and grinds in alms bowl, add appropriate liquid nitrogen to be fully milled to Powdered, by organizing powder, transfer to (about 25mg) in the centrifuge tube of 1.5ml, in centrifuge tube, add 100 μ l lysates and 10 μ LRNaseA/ Proteinase Ks storage liquid, fully vibration mixes rapidly, be placed in 55 ℃ of temperature and bathe 15 minutes, put upside down back and forth centrifuge tube therebetween for several times.
(2) add 10 μ L3MNaAc(pH4.8), then add 250 μ L DNA Binding Solution, fully vibration mixes, and makes solution be water-soluble aqueous, is transferred in centrifugal adsorbing column subsequently.After mixing, supernatant is directly joined in centrifugal adsorbing column and (is sure not precipitated impurities to get), place one minute, 12000rpm centrifugal 30 seconds.
(3) outwell the waste liquid in collection tube, then add 600 μ L Wash Buffer, centrifugal 30 seconds of 12,000rpm.
(4) repeating step 3 once to twice.In this step, last cleaning should be in 12,000rpm centrifugal 3 minutes, fully to remove Wash Buffer.
(5) carefully take out adsorption column (not being stained with Wash Buffer, because ethanol can affect follow-up reaction), put it in a clean 1.5ml centrifuge tube, and add 50 μ L DP elutriants or water (DP elutriant must be added in the center of adsorption column).Place after 2 minutes in 12,000rpm centrifugal 1 minute.It in centrifuge tube, is extracted genomic dna.Get 3-5 μ L electrophoresis.If any remaining RNA, can suitably add a small amount of RNaseA.
2, DNA sequencing
Determined dna sequence divides manual order-checking and automatic sequencing, and manual order-checking comprises Sanger dideoxy chain termination and Maxam-Gilbert chemical degradation method.Automatization order-checking has become the main flow of current DNA sequence analysis in fact.This Experiment Introduction be order-checking principle and the working specification of ABI PRISM310 type DNA sequencer.ABI PRISM310 type genetic analysis instrument (being DNA sequencer), adopt capillary electrophoresis technique to replace traditional polyacrylamide disk electrophoresis, the ddNTP(mark of four look fluorochrome labels of application the said firm patent stops thing method), therefore by single primer PCR sequencing reaction, the PCR product generating is that the 3' end that differs 1 base is the single stranded DNA mixture of 4 kinds of different fluorescence dyes, make the order-checking PCR product of four kinds of fluorescence dyes can be in a capillary electrophoresis, thereby avoided the impact of mobility difference between swimming lane, greatly improved the tolerance range of order-checking.Because molecular size is different, mobility in capillary electrophoresis is also different, when it passes through kapillary reading hatch section, CCD(charge-coupled device in laser detector window) Kamera detector just can detect one by one to fluorescence molecule, the fluorescence exciting is through grating beam splitting, to distinguish the fluorescence of the different colours that represents different base information, and in CCD camera synchronous imaging, analysis software can change different fluorescence into DNA sequence dna automatically, thereby reaches the object of DNA sequencing.Analytical results can be exported with various ways such as gel electrophoresis spectrum, fluorescent absorption peak figure or base put in order.Because this instrument has DNA sequencing, the functions such as the analysis of PCR clip size and quantitative analysis, therefore can carry out DNA sequencing, heterozygote analysis, single-strand conformation polymorphism analysis (SSCP), microsatellite sequence analysis, LA-PCR, RT-PCR(quantitative PCR) etc. analysis, clinically can be except carrying out conventional DNA sequencing, also can carry out single nucleotide polymorphism (SNP) analysis, detection in Gene Mutation, HLA and join parent-offspring on type, medical jurisprudence and Individual identification, microorganism and viral somatotype and evaluation etc.
Use forward direction primer: GAAGAGCTGGACTTCTCTGAGG (SEQ ID NO:1), reverse primer:
CACCAACTTCACTACCAAGCAG (SEQ ID NO:2) amplifies DNA fragmentation respectively from liver cancer tissue to be detected and corresponding adjacent tissues DNA, adopt hi-fi archaeal dna polymerase Hotstar (QIAGEN, HotStar HiFidelity Polymerase Kit, Cat.no.:202605).
50 μ L PCR reaction systems are as follows: DNA profiling 1 μ L, forward direction primer (F) 0.5 μ L, reverse primer (F) 0.5 μ L, Hotstar archaeal dna polymerase 0.1 μ L, dNTP (10mM) 0.5 μ L, Mgcl 2(2.5mM) 1 μ L, supplies ddH 2o to 50 μ L volume.
PCR reaction conditions is as follows: 95 ℃ of warm starts 5 minutes, and 95 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ are extended 30 seconds, 35～40 circulations.Result as shown in Figure 1, is found mutational site (G → A) therein in the cancerous tissue of a routine hepatocarcinoma patient, result shows that this sudden change causes the change of HOXA1 albumen the 287th amino acids.
The essential mutator gene of embodiment 3 RNAi screening liver cancer cell growth
RNAi, as a kind of simple and quick, special, efficient, economy, the predictable technology of effect, has obvious advantage, and it is more superior than antisense technology, simpler than gene knockout, has good application prospect.Specifically can be used for the following aspects: gene function analysis; The new way of research signal transduction pathway; The research and development of novel drugs; Gene therapy.RNAi only suppresses Disease-causing gene, and does not affect the function of normal allele, has higher selectivity and specificity, can reduce the side effect that non-specific effect causes.Tumour is the result of the interactional idiotype network regulation and control of polygene, the blocking-up of the single oncogene that conventional art brings out can not suppress or the growth of reversing tumor completely, and RNAi can utilize a plurality of genes of same gene family to have one section of this characteristic of conserved sequence that homology is very high, design is for the dsRNA molecule of this sector sequence, only inject a kind of dsRNA and can produce a plurality of genes reticent effects simultaneously, also can inject multiple dsRNA and the incoherent gene of a plurality of sequences is simultaneously reticent simultaneously.
CCK-8 measures cytoactive: CCK-8 reagent can be used for easy and cell proliferation accurately and oxicity analysis.Its ultimate principle is: in this reagent, containing its chemical name of WST – 8[, be: 2-(2-methoxyl group-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazolium list sodium salt], it is reduced to the yellow formazan dye (Formazan dye) with high water soluble by the desaturase in cell under the effect of electron carrier 1-methoxyl group-5-toluphenazine methyl-sulfate (1-Methoxy PMS).Cell proliferation is more much faster, and color is darker; Cytotoxicity is larger, and color is more shallow.For same cell, the depth and the cell number of color are linear.Spectrophotometer reading, produces initiating cell activity data, and experiment flow as shown in Figure 2.8 hepatoma cell strain Huh-7, PLC/PRF/5, Focus, WRL68, MHCC-97L, MHCC-97H, HCC-LM3and HCC-LM6 is used to carry out cytoactive analysis.Raw data is through stdn, the steps such as Data correction, the assessment of Z value, the active situation of the overall growth of every strain clone after RNAi is as shown in Figure 3: in WRL68, PLC/PRF/5, HCC-LM3, HCCLM6 tetra-strain clones most genes disturbed after to cytoactive (the single sample T check that do not make significant difference, WRL68, P=0.0801; PLC/PRF/5, P=0.3028; HCC-LM3, P=0.1617; HCC-LM6, P=0.5181).Yet the afunction of these genes has remarkably influenced (single sample T check, Focus, P=0.0111 to cytoactive in Focus, Huh-7, MHCC-97L, MHCC-97H tetra-strain cells; Huh-7, P=0.0001; MHCC-97L, P=0.0013; MHCC97H, P=0.0436).Next in order to identify effective siRNAs from these garbled datas, every siRNA is assessed by corresponding statistics parameter Z value and P value the phenotype of cytoactive impact.Result as shown in Figure 4, Z<-5, siRNAs within the scope of P<0.01 promotes cytoactive, Z>5, the siRNAs within the scope of P<0.01 suppresses cytoactive.Experimental result shows that the small interference ribonucleic acid (siRNA) of specificity interference HOXA1 genetic expression can suppress the growth of liver cancer cell Huh-7, PLC/PRF/5, Focus and MHCC-97L, the survival rate of liver cancer cell is starkly lower than the cell of control group, illustrates that the down-regulated expression of HOXA1 gene can suppress liver cancer cell growth to a certain extent.
The small interference ribonucleic acid (siRNA) of embodiment 4 HOXA1 genes
The features such as external chemosynthesis small interference ribonucleic acid (siRNA) has fast, simple and high specificity, have wide practical use at aspects such as antineoplastons.For the corresponding target sequence of the synthetic 2 couples of bar siRNAs of HOXA1 gene mRNA design, these 2 pairs of siRNA sequences are as follows respectively:
HOXA1-si1 positive-sense strand: GACCAUAGGAUUACAACUUdTdC(SEQ ID NO:3);
HOXA1-si1 antisense strand: AAGUUGUAAUCCUAUGGUCdCdG(SEQ ID NO:4);
HOXA1-si2 positive-sense strand: GCUAUGGCUCACAGAACUUdCdA(SEQ ID NO:5);
HOXA1-si2 antisense strand: AAGUUCUGUGAGCCAUAGCdTdT(SEQ ID NO:6);
The irrelevant sequence of design is as negative control siRNA in addition:
Positive-sense strand, 5 '-UUCUCCGAACGUGUCACGUdTdT-3 ' (SEQ ID NO:7)
Antisense strand, 5 '-ACGUGACACGUUCGGAGAAdTdT-3 ' (SEQ IDNO:8)
Every hole inoculation 3 * 10 in 96 orifice plates 3individual Huh-7, Focus, MHCC-97H and HCC-LM3 cell (serum-free medium) (being all derived from Chinese Academy of Sciences's cell bank), when cell density reaches 40% left and right, utilize liposome (Lipofectamine2000) transfection reagent respectively above-mentioned 2 kinds of siRNA to be entered in Huh-7, PLC/PRF/5, Focus and MHCC-97L cell by final concentration 50nmol/L transfection, after 4h, change the DMEM containing 10% foetal calf serum into.The 24h of take cultivates 7d as 1 detection unit, detects this cell density every day 1 time.In the enchylema to be measured of every hole, add 10 μ L CCK-8, hatch 1h for 37 ℃.Utilize microplate reader under 450nm wavelength, to detect its absorbancy to represent cell survival ability, draw growth curve.
Embodiment 5 real-time quantitative PCRs are evaluated HOXA1 gene RNAi interference effect in liver cancer cell
Adopt relative quantification method to detect differential expression (Thermal Cycler DiceTM Real Time System TP800, the Takara of ELL gene in liver cancer sample;
Figure BDA00001892795900091
premix Ex TaqTM, Takara).Quantitative fluorescent PCR (real-time PCR) reaction system is as follows: cumulative volume 20 μ L, SYBR Premix Ex Taq10 μ L, each 0.4 μ L of upstream and downstream primer (10 μ mol/L), cDNA1 μ L, ddH2O8.2 μ L, mixes reagent, and putting into PCR instrument after centrifugal carries out amplified reaction.Reaction conditions is 95 ℃ of sex change 5 seconds, and 68 ℃ of annealing are extended 30 seconds, 40 circulations.Instrument uses the description operation by producer.House-keeping gene β-actin is as internal reference.
HOXA1-F:5’-TCTTCTCCAGCGCAGACTTT-3’(SEQ?ID?NO:9),
HOXA1-R:5’-CGTGAGCTGCTTGGTAGTGA-3’(SEQ?ID?NO:10);
β-actin-F：5’-AATCGTGCGTGACATTAAGGAG-3’(SEQ?ID?NO:11)，
β-actin-R：5’-ACTGTGTTGGCGTACAGGTCTT-3’(SEQ?ID?NO:12)。
Real-time quantitative PCR detects and shows, HOXA1 gene is by HOXA1-si1 in Huh-7, PLC/PRF/5, Focus and MHCC-97L cell, and HOXA1-si2 effectively disturbs and down-regulated expression (experimental result is shown in Fig. 5).
Figure IDA00001892796500011
Figure IDA00001892796500021
Figure IDA00001892796500031
Figure IDA00001892796500041
Figure IDA00001892796500051

Claims (12)

1. an application for HOXA1 gene and expression product thereof, is characterized in that: described HOXA1 gene and the application of expression product in preparing the product of diagnosing liver cancer thereof.
2. application as claimed in claim 1, is characterized in that: the product of described diagnosing liver cancer comprises: the product of the product of use real-time quantitative PCR diagnosing liver cancer, use DNA sequencing diagnosing liver cancer.
3. application as claimed in claim 2, is characterized in that: the described product with real-time quantitative PCR diagnosing liver cancer at least comprises the primer of a pair of specific amplified HOXA1 gene.
4. application as claimed in claim 2, is characterized in that: the described product with DNA sequencing diagnosing liver cancer comprises: for the sequencing primer of HOXA1 gene.
5. an application for HOXA1 gene and expression product thereof, is characterized in that: described HOXA1 gene and the application of expression product in preparing the medicine of Hepatoma therapy thereof.
6. application as claimed in claim 5, it is characterized in that: the medicine of described Hepatoma therapy comprises: by RNA, disturb double stranded RNA, DNA vector, adenovirus or the gland relevant viral vector that suppresses HOXA1 genetic expression, can suppress compound, polypeptide, the monoclonal antibody of HOXA1 protein kinase activity.
7. application as claimed in claim 5, is characterized in that: the medicine of described Hepatoma therapy comprises: by RNA disturb specificity to suppress the double stranded RNA of HOXA1 genetic expression and different modifying state thereof, difference is sent mode.
8. application as claimed in claim 5, is characterized in that: the medicine of described Hepatoma therapy comprises: carry specificity and for HOXA1 gene, disturb DNA vector, the virus vector of its expression.
9. for the preparation of the primer of a pair of specific amplified HOXA1 gene in the product with real-time quantitative PCR diagnosing liver cancer, it is characterized in that: the upstream primer sequence of described primer has sequence or its complementary sequence as shown in SEQ ID NO:9, the downstream primer sequence of described primer pair has sequence or its complementary sequence as shown in SEQ ID NO:10.
10. for the preparation of the sequencing primer of the HOXA1 gene in the product with DNA sequencing diagnosing liver cancer, it is characterized in that: the upstream primer sequence of described sequencing primer has sequence or its complementary sequence as shown in SEQ ID NO:1; The downstream primer sequence of described sequencing primer has sequence or its complementary sequence as shown in SEQ ID NO:2.
The siRNA of the 11. a pair of HOXA1 genes for the preparation of Hepatoma therapy medicine, is characterized in that: the positive-sense strand of described siRNA has sequence as shown in SEQ ID NO:3, and the antisense strand of described siRNA has sequence as shown in SEQ ID NO:4.
The siRNA of the 12. a pair of HOXA1 genes for the preparation of Hepatoma therapy medicine, is characterized in that: the positive-sense strand of described siRNA has sequence as shown in SEQ ID NO:5, and the antisense strand of described siRNA has sequence as shown in SEQ ID NO:6.
CN201210246001.5A 2012-07-16 2012-07-16 Applications of homeobox A1 (HOXA1) gene and expression product thereof Pending CN103540653A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210246001.5A CN103540653A (en) 2012-07-16 2012-07-16 Applications of homeobox A1 (HOXA1) gene and expression product thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210246001.5A CN103540653A (en) 2012-07-16 2012-07-16 Applications of homeobox A1 (HOXA1) gene and expression product thereof

Publications (1)

Publication Number Publication Date
CN103540653A true CN103540653A (en) 2014-01-29

Family

ID=49964502

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210246001.5A Pending CN103540653A (en) 2012-07-16 2012-07-16 Applications of homeobox A1 (HOXA1) gene and expression product thereof

Country Status (1)

Country Link
CN (1) CN103540653A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108853479A (en) * 2018-07-11 2018-11-23 广东龙帆生物科技有限公司 A kind of homologous frame albumin A 10 of people treats or prevents the application in hepatitis B virus infective medicament in preparation
CN116350784A (en) * 2023-02-20 2023-06-30 南通大学 Application of HOXA1 inhibitor in preparation of medicine for promoting schwann cell growth

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108853479A (en) * 2018-07-11 2018-11-23 广东龙帆生物科技有限公司 A kind of homologous frame albumin A 10 of people treats or prevents the application in hepatitis B virus infective medicament in preparation
CN108853479B (en) * 2018-07-11 2020-07-10 广东龙帆生物科技有限公司 Application of human homeobox protein A10 in preparation of medicine for treating or preventing hepatitis B virus infection
CN116350784A (en) * 2023-02-20 2023-06-30 南通大学 Application of HOXA1 inhibitor in preparation of medicine for promoting schwann cell growth

Similar Documents

Publication Publication Date Title
Scatena et al. Cutaneous melanoma classification: the importance of high-throughput genomic technologies
Jardin et al. Diffuse large B-cell lymphomas with CDKN2A deletion have a distinct gene expression signature and a poor prognosis under R-CHOP treatment: a GELA study
Brouwer et al. Evaluation and consequences of heterogeneity in the circulating tumor cell compartment
EP3090068B1 (en) Method and kit for non-invasively detecting egfr gene mutations
Martin-Guerrero et al. Recurrent loss of heterozygosity in 1p36 associated with TNFRSF14 mutations in IRF4 translocation negative pediatric follicular lymphomas
CN107075730A (en) The identification of circle nucleic acid and purposes
Buhl et al. Identification of a gene on chromosome 12q22 uniquely overexpressed in chronic lymphocytic leukemia
Minervini et al. Mutational analysis in BCR-ABL1 positive leukemia by deep sequencing based on nanopore MinION technology
US9663826B2 (en) System and method of genomic profiling
KR20190025814A (en) Detection of chromosome interactions associated with breast cancer
JP2023054163A (en) Probe and method for detecting transcript resulting from fusion gene and/or exon skipping
CN101921831A (en) Rapid detection of BRCA (Breast Cancer) genic mutation
Peluso et al. Lymph node fine-needle cytology: beyond flow cytometry
KR101838394B1 (en) Prediction method for using tissue origin of gliblastoma detecting genitic mutation and animal model for gliblastoma
CN107586842A (en) A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment
CN110093423A (en) Purposes of the gene marker in adenocarcinoma of lung diagnosis and treatment
KR20230146139A (en) Next generation sequencing (ngs)-based hybrid diagnostic panel for analyzing variation of cancer gene and anticancer drug-related gene
CN103540653A (en) Applications of homeobox A1 (HOXA1) gene and expression product thereof
CN103540654A (en) Applications of 11-19 lysine-rich leukemia (ELL) gene and expression product thereof
US20180113133A1 (en) Gene relevant to papillary thyroid tumors
Martinez-Climent et al. Genomic abnormalities acquired in the blastic transformation of splenic marginal zone B-cell lymphoma
CN109628598A (en) Application of the long-chain non-coding RNA in tumour
CN111518905B (en) Application of lncRNA in diagnosis and treatment of lung adenocarcinoma
CN102199658B (en) Gene detection chip of common mutations of diphosphate glucuronyl transferase 1A and use method thereof
Adão Characterization of Chronic Lymphocytic Leukemia by ACGH/MLPA

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20140129