CN103540644B - Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament - Google Patents
Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament Download PDFInfo
- Publication number
- CN103540644B CN103540644B CN201210239795.2A CN201210239795A CN103540644B CN 103540644 B CN103540644 B CN 103540644B CN 201210239795 A CN201210239795 A CN 201210239795A CN 103540644 B CN103540644 B CN 103540644B
- Authority
- CN
- China
- Prior art keywords
- plasmid
- cell
- prb
- obtains
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for screening an anti-HIV-1 (human immunodeficiency virus-1) medicament. The method comprises the following steps: connecting an amino terminal of BST-2 bioluminescence resonance energy transfer donor protein and connecting a carboxyl terminal of Vpu to bioluminescence resonance energy transfer receptor protein to generate a bioluminescence resonance energy transfer (BRET) signal, co-expressing the two fusion proteins in a cell, and establishing a cell line capable of stably expressing the two fusion proteins; adding a sample to be detected in the cell, and detecting the change of the BRET signal of the cell; determining the sample to be detected to be an anti-HIV-1 positive medicament if the BRET value is reduced. By utilizing the method, the anti-HIV-1 medicament can be conveniently and quickly screened, and a new way is provided for screening of the anti-HIV-1 medicament.
Description
Technical field
The present invention relates to biomedicine field, be specifically related to a kind of screening method of anti-HIV-1 medicines.
Background technology
Acquired immune deficiency syndrome (AIDS) (acquired immunodeficiency syndrome, AIDS) be one of current serious infectious diseases popular in the world, by human immunodeficiency virus (humanimmunodeficiency virus, HIV) infection causes human immunologic function's defect, and is easy to the clinical syndrome of generator opportunistic infections and tumour.Cause more than 2,000 ten thousand people dead in the past more than 20 year, current whole world patients infected hiv has reached about 4,000 ten thousand, and acquired immune deficiency syndrome (AIDS) is to human health, and social stability causes serious threat.In the present stage that AIDS vaccine is not yet succeeded in developing, pharmacological agent is the Main Means of AIDS preventing and controlling.4 class, 24 kinds of antiretroviral drugs have been had to be applied to the antiviral therapy of acquired immune deficiency syndrome (AIDS) at present, comprise 11 kinds of efabirenzs (NRTI), 3 kinds of non-nucleoside reverse transcriptase inhibitors (NNRTI), 9 kinds of proteinase inhibitor (PI) and a kind of fusion inhibitor (FI).But the evolution of virus makes resistance constantly produce, this just needs constantly to seek the novel Anti-AIDS Drugs for novel targets.
Cause the pathogenic agent mainly human immunodeficiency virus I (Human immunodeficiency virus type1, HIV-1) of the acquired immune deficiency syndrome (AIDS) of worldwide epidemics, the pathogenesis of HIV-1 and very complicated with the interaction of host factor.Host cell factor Tsg101, APOBEC3G etc. of antagonism virus more and more receive publicity.Therefore, relation and the interaction mechanism thereof of understanding virus and host are the new ways finding effective antiviral and therapeutic strategy.Virus needs the restriction constantly overcoming host cell just can survive in host during evolution, wherein the accessory protein Vpu of HIV-1 self can overcome host limiting factor BST-2(bone marrow stromal cell antigen2, also known as CD317, thus promote that virus is from the release of host cell HM1.24).
BST-2 causes scientific circles because finding recently to suppress the release of HIV-1 and pays close attention to greatly, and the virus particle of new life can be adhered to virus infected cell surface name Tetherin again by it.BST-2 is the comparatively unique membranin of a kind of topological framework, containing two hydrophobic regions.The aminoterminal of this protein is arranged in kytoplasm, is the outer coiled coil motif of one about 19 amino acid whose transmembrane protein territories (TM) and born of the same parents subsequently, and its carboxyl terminal is about 17 amino acid whose glycosyl-phosphatidyl inositol anchors fixed point (GPI anchor).Be positioned at the BST-2 of cell surface, its GPI anchor point is arranged in the virus position-fat that sprouts and cuts down, and cross-film district is positioned at outside fat cuts down, by the cysteine residues formation dimer outside born of the same parents or polymeric form, the virus of sprouting is connected with host cell, make virus particle be bound by cell surface, thus suppress the release of virus.
As previously mentioned, this effect suppressing virus to discharge of BST-2 can by the accessory protein Vpu antagonism of HIV-1.Vpu is also transmembrane protein, has two main structural domains: N-terminal hydrophobic transmembrane and carboxyl terminal have two can the cytoplasm domain of phosphorylate serine residue.Vpu can locate altogether with BST-2, two kinds of albumen are produced by respective cross-film district and interact, and then by the β-TrCP binding site of cytoplasmic region, BST-2 is connected with intracellular ubiquitination path, with endosome-lysosomal pathway or proteasome pathway degraded BST-2, its content at cell surface is reduced, thus promotes the release of HIV-1 virus particle.Therefore, can using the interaction in BST-2 and Vpu cross-film district as new drug targets, the contact each other of both destruction, suppression Vpu degraded BST-2, thus recover BST-2 reaches object from virus release minimizing to the transport of cell surface.
BRET(Bioluninescence resonance energy transfer Bioluminescence Resonance Energy shifts) be a kind of method of Real-Time Monitoring two kinds of protein interactions in viable cell.This method by two kinds of target proteins separately with Bioluminescence Resonance Energy transfer donator albumen (as the luciferase of Renilla, and receptor protein (as EYFP) amalgamation and expression Rluc), when two kinds of target proteins produce interaction, distance can be less than 10nm, at this moment add xenobiotic substrates (as Coelenterazine h) and make Rluc produce exciting light, this exciting light can be mediated by a pair dipole and shift to receptor protein EYFP, thus excite EYFP to produce utilizing emitted light, by instrument can detect protein have an effect before and after signal intensity, it is interactional good method between a kind of Study on Protein.
The domestic method about AIDS-treating medicine screening emerges in an endless stream at present, but method is easy not, or mechanism of action is unclear, therefore, urgently releases new simple efficient, can realize high-throughput and the clear and definite drug screening method of mechanism.
Summary of the invention
For above-mentioned deficiency, the invention provides a kind of screening method of anti-HIV-1 medicines.
The screening method of anti-HIV-1 medicines provided by the invention, comprises step: add measuring samples in the cell of the clone of energy stably express RB and VE, detect the change of cell BRET signal, if BRET signal declines, then measuring samples is anti-HIV-1 positive drug; The aminoterminal of BST-2 and Bioluminescence Resonance Energy transfer donator albumen are formed by connecting by described RB, and the carboxyl terminal of Vpu and Bioluminescence Resonance Energy transfer receptor albumen are formed by connecting by described VE, make to produce BRET signal between BST-2 and Vpu.
Wherein, described Bioluminescence Resonance Energy transfer donator albumen is selected from: renilla luciferase Rluc.
Wherein, described Bioluminescence Resonance Energy transfer receptor albumen is selected from: enhancement type yellow fluorescence protein EYFP.
Wherein, described cell is 293 clones.
The invention provides a kind of method of screening the clone of stably express RB and VE, by after the plasmid-transfected cells of double expression(DE) RB and VE, add the microbiotic G418 that final concentration is 1mg/ml, primary dcreening operation 10-14 days, cell is carried out mono-clonal operation, after enlarged culturing, through observing and detector detection, the clone that two kinds of protein expressions are all good is defined as the clone of stably express RB, VE.
In an embodiment of the present invention, fluorescence microscope and luciferase detector is used to detect.
Wherein, the plasmid of described double expression(DE) RB and VE is pRB-VE, can express RB and VE two kinds of albumen in cell simultaneously.
Present invention also offers the clone that aforesaid method screens stably express RB and VE obtained.
The invention provides the clone of a kind of stably express RB and VE for screening anti-HIV-1 medicines.
Preferably, be 293 clones for screening the cell of stably express RB and VE of anti-HIV-1 medicines.
The invention provides a kind of eukaryotic dual antigen expression plasmid, it is pRB-VE, and its nucleotide sequence is as shown in SEQ ID NO.11.
The invention provides a kind of method building above-mentioned eukaryotic dual antigen expression plasmid, comprise the following steps:
1) plasmid pRB builds:
A) take phBST-2 as template, with primer
F:AAATATGCGGCCGCCCATGGCTTCCAAGGTGTAC；
R:CTAGTCTAGATTACTGCTCGTTCTTCAG carries out pcr amplification, obtains hBST-2 fragment;
B) take pRluc-N2 as template, with primer
F:CCCAAGCTTCCACCATGGCTTCCAAGGTGTAC，
R:CCGGAATTCCTGCTCGTTCTTCAGCAC carries out pcr amplification, obtains Rluc fragment;
C) by Rluc gene clone to carrier for expression of eukaryon pcDNA
tMin 3.1/V5-His A, restriction enzyme site is HindIII, EcoRI, then clones in this carrier into hBST-2 gene, and restriction enzyme site is NotI, XbaI, builds and obtains plasmid pRB;
2) structure of plasmid pVE:
A) take pVpu as template, with primer
F:CTAGCTAGCCACCATGGTGCCCATTATTGT，
R:CCCAAGCTTCAGGTCGTCAATGTCCCA carries out pcr amplification, obtains Vpu fragment;
B) Vpu gene clone is entered in carrier pEYFP-N1, restriction enzyme site NheI, HindIII, build plasmid pVE;
3) structure of plasmid pRB-VE:
A) with plasmid pRB for template, with primer
F:CGCGGATCCCCACCATGGCTTCCaAGGTGTAC，
R:AGCTTTGTTTAAACTCACTGCAGCAGAGCGCT carries out pcr amplification and obtains RB fragment,
B) with plasmid pVE for template, with primer
F:CGGGGTACCCCACCATGGTGCCCATTATTGTC，
R:CCCAAGCTTTTACTTGTACAGCTCGTC carries out pcr amplification and obtains VE fragment;
C) by RB, VE clones in carrier pYr-adshuttle-3 respectively, and RB cloning site is MCSI:BamHI, PmeI, VE cloning site is MCSII:KpnI, HindIII, builds plasmid pRB-VE.
The invention provides the application of aforesaid method in screening anti-HIV-1 medicines.
The invention provides the application of eukaryon expression plasmid pRB and pVE or eukaryon expression plasmid pRB-VE in screening anti-HIV-1 medicines.
The invention provides the application of 293 clones in screening anti-HIV-1 medicines.
The present invention uses Bioluminescence Resonance Energy to shift (Bioluminescence resonanceenergy transfer1, BRET) technology, with the interaction between human host cell factor B ST-2 and HIV-1 viral accessory proteins Vpu for drug target, application BRET method, for the stable expression cell line of double expression(DE) BST-2 and Vpu, filter out the micromolecular compound of destruction two kinds of protein interactions, establish the anti-HIV-1 medicines screening model of cell levels.And then provide a kind of method of screening anti-HIV-1 medicines.In this method, directly joined by testing compound in the cell of this stably express albumen, whether observation BRET signal comparatively control group (a solubilizing agent DMSO) reduces, if reduce, illustrate that the interaction between two kinds of albumen receives the suppression of compound, can be used as primary dcreening operation positive findings.Drug screening method in the present invention is simple to operate, avoids the complicated procedures of transfectional cell before each experiment, only needs dosing-cultivate-measure several simple step again, effectively realizes fast, high-throughput.Utilize the method can screen anti-HIV-1 medicines easily and quickly, for the screening of the medicine of HIV-1 provides new way.
Accompanying drawing explanation
Fig. 1 is the collection of illustrative plates of plasmid pRB.
Fig. 2 is the collection of illustrative plates of plasmid pVE.
Fig. 3 is plasmid pRB-VE collection of illustrative plates.
Fig. 4 is RB and VE protein expression western detection figure in stable expression cell strain.
Embodiment
Following examples further illustrate content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to scope of the present invention.
If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.
Embodiment 1
1, construction of expression vector
With phBST-2(purchased from NIH AIDS Reagent Program) for template, with primers F: AAATATGCGGCCGCCCATGGCTTCCAAGGTGTAC, R:CTAGTCTAGATTACTGCTCGTTCTTCAG increase, and obtain hBST-2 fragment.
With pRluc-N2(purchased from PerkinElmer company) be template, with primers F: CCCAAGCTTCCACCATGGCTTCCAAGGTGTAC, R:CCGGAATTCCTGCTCGTTCTTCAGCAC increase, and obtain Rluc fragment,
With pVpu(purchased from NIH AIDS Reagent Program) for template, with primers F: CTAGCTAGCCACCATGGTGCCCATTATTGT, R:CCCAAGCTTCAGGTCGTCAATGTCCCA increase, and obtain Vpu fragment.
Rluc gene (restriction enzyme site is HindIII, EcoRI) is cloned into carrier for expression of eukaryon pcDNA
tMin 3.1/V5-His A (purchased from Invitrogen company), in this carrier, then clone the BST-2 gene (restriction enzyme site is NotI, XbaI) into people source, build plasmid pRB; The accessory protein Vpu of HIV-1 is cloned into carrier pEYFP-N1(purchased from Clontech company) in, restriction enzyme site is NheI, HindIII, builds plasmid pVE.
PCR reaction system:
Add deionized water to 20 μ l.PCR parameter: after 94 DEG C of denaturation 5min, then carry out 30 circulations with 94 DEG C of sex change 30sec, 54 DEG C of annealing 30sec, 72 DEG C of conditions extending 30sec, last 72 DEG C extend 10min, and 4 DEG C continue.
2, cell cultures
Get 293 cells to cultivate, treat that cell grows up to fine and close individual layer in T75 culturing bottle, substantially, after saturated, absorb old nutrient solution in culturing bottle, 5 milliliters of PBS wash one time, to remove remaining serum, 3 milliliters, 0.25% trypsinase is added in bottle, at the bottom of bottle, room temperature digests 90 seconds, when discovery tenuigenin retraction, after intercellular substance increases, absorb trypsinase, perfect medium is injected (containing 10% foetal calf serum in bottle, 100U/ml penicillin, the DMEM of 100 μ g/ml Streptomycin sulphates), repeatedly blow and beat gently, make it to depart from from bottle wall to form cell suspension, and cell mass is dispersed as unicellular, part is used for reaching in new T75 and continues at 37 DEG C, 5%CO
2cultivate in incubator, part is for spreading six orifice plates (every hole 3 × 10
5individual cell) plasmid to be transfected.
3, cell transfecting
16-20h after paving cell, changes the 1 fresh × DMEM of serum-free antibiotic-free, puts 37 DEG C, 5%CO by cell
21-2h cultivated by incubator.Plasmid pRB and pVE (or independent pRB) each 2 μ g are mixed in 300 μ l1 × DMEM, and be mixed into plasmid mixed solution gently, room temperature places 5min; Get PEI2 μ l, add in 300 μ l1 × DMEM, be mixed into PEI mixed solution gently, room temperature places 5min.Above-mentioned plasmid mixed solution and PEI mixed solution are mixed into transfection cocktail gently, and room temperature places 20-25min; By nutrient solution sucking-off in six orifice plates, above-mentioned transfection cocktail is added gently, gently shakes, put 37 DEG C, 5%CO
2incubator is cultivated.Sucking-off transfection liquid after 4-6h, changes perfect medium (containing 10% foetal calf serum, 100U/ml penicillin, the DMEM of 100 μ g/ml Streptomycin sulphates) into, continues to cultivate 24-48h.
4, Bioluminescence Resonance Energy transfer (BRET) measures:
Cell PBS after transfection cleans one time, dispels with PBS, and adjustment cell count is 1 × 10
6individual/ml, divide in bottom and all lighttight 96 hole blanks (Costar) of surrounding, every hole 90 μ l, renilla luciferase substrate Coelenterazine h (50 μm of ol/L, Promega company) 10 μ l, (final concentration 5 μm of ol/L), go up machine (Pekin Elmer reader) immediately and measure 475nm and 530nm two place emitted luminescence intensity.
530nm emitted luminescence intensity/475nm emitted luminescence intensity (simultaneously expressing RB and VE)-530nm emitted luminescence intensity/475nm emitted luminescence intensity (only expressing RB) calculates BRET ratio with the formula.Result shows, stronger BRET signal is created in the cell of transfection, illustrate the plasmid pVE co-transfecting host cells of the plasmid pRB of single expression RB and single expression VE, can realize expressing RB and VE simultaneously, and between RB and VE, create Bioluminescence Resonance Energy transfer.
Embodiment 2
1, dual-expression vector is built
With plasmid pRB for template, be primer amplification RB fragment with F:CGCGGATCCCCACCATGGCTTCCaAGGTGTAC, R:AGCTTTGTTTAAACTCACTGCAGCAGAGCGCT,
With plasmid pVE for template,
With F:CGGGGTACCCCACCATGGTGCCCATTATTGTC, R:CCCAAGCTTTTACTTGTACAGCTCGTC is primer amplification VE fragment, by RB, VE clones in carrier pYr-adshuttle-3 (purchased from Hunan Ying Run biotech firm) respectively, cloning site is respectively RB (MCSI:BamHI, PmeI), VE (MCSII:KpnI, HindIII), plasmid pRB-VE is built.
PCR reaction system:
Add deionized water to 20 μ l.PCR parameter: after 94 DEG C of denaturation 5min, then carry out 30 circulations with 94 DEG C of sex change 30sec, 54 DEG C of annealing 30sec, 72 DEG C of conditions extending 1min, last 72 DEG C extend 10min, and 4 DEG C continue.
2, cell cultures
Get 293 cells to cultivate, treat that cell grows up to fine and close individual layer in T75 culturing bottle, substantially, after saturated, absorb old nutrient solution in culturing bottle, 5 milliliters of PBS wash one time, to remove remaining serum, 3 milliliters, 0.25% trypsinase is added in bottle, at the bottom of bottle, room temperature digests 90 seconds, when discovery tenuigenin retraction, after intercellular substance increases, absorb trypsinase, perfect medium is injected (containing 10% foetal calf serum in bottle, 100U/ml penicillin, the DMEM of 100 μ g/ml Streptomycin sulphates), repeatedly blow and beat gently, make it to depart from from bottle wall to form cell suspension, and cell mass is dispersed as unicellular, part is used for reaching in new T75 and continues at 37 DEG C, 5%CO
2cultivate in incubator, part is for spreading six orifice plates (every hole 3 × 10
5individual cell) plasmid to be transfected.
3, cell transfecting
16-20h after paving cell, changes the 1 fresh × DMEM of serum-free antibiotic-free, puts 37 DEG C, 5%CO by cell
21-2h cultivated by incubator.Plasmid pRB-VE (or pRB) 2 μ g, is mixed in 300 μ l1 × DMEM, is mixed into plasmid mixed solution gently, and room temperature places 5min; Get PEI2 μ l, add in 300 μ l1 × DMEM, be mixed into PEI mixed solution gently, room temperature places 5min.Above-mentioned plasmid mixed solution and PEI mixed solution are mixed into transfection cocktail gently, and room temperature places 20-25min; By nutrient solution sucking-off in six orifice plates, above-mentioned transfection cocktail is added gently, gently shakes, put 37 DEG C, 5%CO
2incubator is cultivated.Sucking-off transfection liquid after 4-6h, changes perfect medium (containing 10% foetal calf serum, 100U/ml penicillin, the DMEM of 100 μ g/ml Streptomycin sulphates) into, continues to cultivate 24-48h.
4, stable expression cell line is screened
24 orifice plates being covered with 293 cells are added the G418(of different concns purchased from Merke company), determine that best screening concentration is 1mg/ml.By double expression plasmid pRB-VE rotaring redyeing 293 cell in six orifice plates, cell was reached in T75 culturing bottle in after transfection 24 hours, adding G418(concentration is 1mg/ml) screen the clone of stably express RB-VE, about primary dcreening operation 10-14 days, cell is divided to 96 orifice plates (every hole 1-2 cell) and carry out mono-clonal operation, to the hole of cell mass be grown up at fluorescence microscopy Microscopic observation, if there is fluorescence, continue enlarged culturing, and detected the expression of RB by luciferase detector, and verify the expression (Fig. 4) of two kinds of albumen further by WesternBlotting.What two kinds of protein expressions were all good is defined as the clone being filtered into merit.
5, sample preparation
Compound sample: DMSO dilutes sterling compound to 2mmol/L, gets 1 μ l and acts on 100 μ l cell systems, make its final concentration be 20 μm of ol/L.
Positive control small peptide BST-2-TM sample:
Dry powder BST-2 cross-film district mimic short peptide (BST-2-TM) (purchased from Inst. of Medicinal Biological Technology, Chinese Academy of Medical Sciences) is dissolved to 500 μm of ol/L with distilled water, gets 10 μ l and adds to 100 μ l cell systems, makes its final concentration be 50 μm of ol/L.The synthesis of this small peptide simulation BST-2 transmembrane region, the same with BST-2, also can interact with the cross-film district of Vpu, thus compete with RB and the effect of VE, decrease the energy trasfer between RB to VE, thus reduction BRET signal.
6, dosing screening and Bioluminescence Resonance Energy shift (BRET) and measure
By build in step 4 be successful cell expansion cultivate after, adjustment cell count be 5 × 10
5individual/ml, tropical revolution encloses White-opalescent, bottom is that in 96 porocyte culture plates (Costar) of flat bottom clear, every hole 100 μ l, joins in enchylema by compound sample simultaneously, every hole 1 μ l, make its final concentration be 20 μm of ol/L, negative control group solubilizing agent DMSO contrasts, and positive controls adds BST-2-TM and contrasts, put 37 DEG C, 5%CO
2cultivation is continued 24 hours in incubator.Then suck the substratum in 96 orifice plates, every hole adds 100 μ L PBS and washes 1 time, add PBS90 μ l again, renilla luciferase substrate Coelenterazine h (50 μm of ol/L, Promega company) 10 μ l are that 5 μm of ol/L go up machine (Pekin Elmerreader) immediately and measure 475nm and 530nm two place emitted luminescence intensity to final concentration.
530nm emitted luminescence intensity/475nm emitted luminescence intensity (simultaneously expressing RB and VE)-530nm emitted luminescence intensity/475nm emitted luminescence intensity (only expressing RB) calculates BRET ratio with the formula.
Result: positive controls BRET ratio is starkly lower than negative solvent control group, shows that BST-2-TM obviously inhibits the interaction between BST-2 and Vpu.From combinatorial chemical library, screen 12000 samples altogether, wherein primary dcreening operation positive compound 27, positive rate is 0.225%.The primary dcreening operation positive findings BRET ratio display filtered out through native system reduces greatly, illustrates that the screening method of anti-HIV-1 medicines provided by the invention possesses feasibility.
Claims (8)
1. an authentication method for anti-HIV-1 medicines, is characterized in that, add measuring samples in the cell of the clone of energy stably express RB and VE, detect the change of cell BRET signal, if BRET signal declines, then measuring samples is anti-HIV-1 positive drug;
The aminoterminal of BST-2 and Bioluminescence Resonance Energy transfer donator albumen are formed by connecting by described RB, and the carboxyl terminal of Vpu and Bioluminescence Resonance Energy transfer receptor albumen are formed by connecting by described VE, make to produce BRET signal between BST-2 and Vpu;
The clone of described stably express RB and VE prepares by the following method: after the plasmid pRB-VE transfectional cell of double expression(DE) RB and VE, add the microbiotic G418 that final concentration is 1mg/ml, primary dcreening operation 10-14 days, cell is carried out mono-clonal operation, after enlarged culturing, through observing and detector detection, the clone that two kinds of protein expressions are all good is defined as the clone of stably express RB, VE; The nucleotide sequence of plasmid pRB-VE is as shown in SEQ IDNO.11, and it builds by the following method and obtains:
Comprise the following steps:
1) plasmid pRB builds:
A) take phBST-2 as template, with primer
F:AAATATGCGGCCGCCCATGGCTTCCAAGGTGTAC；
R:CTAGTCTAGATTACTGCTCGTTCTTCAG carries out pcr amplification, obtains hBST-2 fragment;
B) take pRluc-N2 as template, with primer
F:CCCAAGCTTCCACCATGGCTTCCAAGGTGTAC，
R:CCGGAATTCCTGCTCGTTCTTCAGCAC carries out pcr amplification, obtains Rluc fragment;
C) by Rluc gene clone to carrier for expression of eukaryon pcDNA
tMin 3.1/V5-His A, restriction enzyme site is HindIII, EcoRI, then clones in this carrier into hBST-2 gene, and restriction enzyme site is NotI, XbaI, builds and obtains plasmid pRB;
2) structure of plasmid pVE:
A) take pVpu as template, with primer
F:CTAGCTAGCCACCATGGTGCCCATTATTGT，
R:CCCAAGCTTCAGGTCGTCAATGTCCCA carries out pcr amplification, obtains Vpu fragment;
B) Vpu gene clone is entered in carrier pEYFP-N1, restriction enzyme site NheI, HindIII, build plasmid pVE;
3) structure of plasmid pRB-VE:
A) with plasmid pRB for template, with primer
F:CGCGGATCCCCACCATGGCTTCCaAGGTGTAC，
R:AGCTTTGTTTAAACTCACTGCAGCAGAGCGCT carries out pcr amplification and obtains RB fragment,
B) with plasmid pVE for template, with primer
F:CGGGGTACCCCACCATGGTGCCCATTATTGTC，
R:CCCAAGCTTTTACTTGTACAGCTCGTC is that primer carries out pcr amplification and obtains VE fragment;
C) by RB, VE clones in carrier pYr-adshuttle-3 respectively, and RB cloning site is MCSI:BamHI, PmeI, VE cloning site is MCSII:KpnI, HindIII, builds plasmid pRB-VE.
2. the method for claim 1, is characterized in that, described Bioluminescence Resonance Energy transfer donator albumen is selected from: renilla luciferase Rluc.
3. the method for claim 1, is characterized in that, described Bioluminescence Resonance Energy transfer receptor albumen is selected from: enhancement type yellow fluorescence protein EYFP.
4. the method for claim 1, is characterized in that, described cell is 293 clones.
5. one kind is screened the method for the clone of stably express RB and VE, it is characterized in that, after the plasmid-transfected cells of double expression(DE) RB and VE, add the microbiotic G418 that final concentration is 1mg/ml, primary dcreening operation 10-14 days, carries out mono-clonal operation, after enlarged culturing by cell, through observing and detector detection, the clone that two kinds of protein expressions are all good is defined as the clone of stably express RB, VE; The plasmid of described double expression(DE) RB and VE is pRB-VE, can express RB and VE two kinds of albumen in cell simultaneously.
6. an eukaryotic dual antigen expression plasmid, it is pRB-VE, and its nucleotide sequence is as shown in SEQ IDNO.11.
7. build a method for eukaryotic dual antigen expression plasmid described in claim 6, it is characterized in that, comprise the following steps:
1) plasmid pRB builds:
A) take phBST-2 as template, with primer
F:AAATATGCGGCCGCCCATGGCTTCCAAGGTGTAC；
R:CTAGTCTAGATTACTGCTCGTTCTTCAG carries out pcr amplification, obtains hBST-2 fragment;
B) take pRluc-N2 as template, with primer
F:CCCAAGCTTCCACCATGGCTTCCAAGGTGTAC，
R:CCGGAATTCCTGCTCGTTCTTCAGCAC carries out pcr amplification, obtains Rluc fragment;
C) by Rluc gene clone to carrier for expression of eukaryon pcDNA
tMin 3.1/V5-His A, restriction enzyme site is HindIII, EcoRI, then clones in this carrier into hBST-2 gene, and restriction enzyme site is NotI, XbaI, builds and obtains plasmid pRB;
2) structure of plasmid pVE:
A) take pVpu as template, with primer
F:CTAGCTAGCCACCATGGTGCCCATTATTGT，
R:CCCAAGCTTCAGGTCGTCAATGTCCCA carries out pcr amplification, obtains Vpu fragment;
B) Vpu gene clone is entered in carrier pEYFP-N1, restriction enzyme site NheI, HindIII, build plasmid pVE;
3) structure of plasmid pRB-VE:
A) with plasmid pRB for template, with primer
F:CGCGGATCCCCACCATGGCTTCCaAGGTGTAC，
R:AGCTTTGTTTAAACTCACTGCAGCAGAGCGCT carries out pcr amplification and obtains RB fragment,
B) with plasmid pVE for template, with primer
F:CGGGGTACCCCACCATGGTGCCCATTATTGTC，
R:CCCAAGCTTTTACTTGTACAGCTCGTC is that primer carries out pcr amplification and obtains VE fragment;
C) by RB, VE clones in carrier pYr-adshuttle-3 respectively, and RB cloning site is MCSI:BamHI, PmeI, VE cloning site is MCSII:KpnI, HindIII, builds plasmid pRB-VE.
8. the application of plasmid pRB-VE in screening anti-HIV-1 medicines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210239795.2A CN103540644B (en) | 2012-07-10 | 2012-07-10 | Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210239795.2A CN103540644B (en) | 2012-07-10 | 2012-07-10 | Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103540644A CN103540644A (en) | 2014-01-29 |
| CN103540644B true CN103540644B (en) | 2015-04-01 |
Family
ID=49964493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210239795.2A Active CN103540644B (en) | 2012-07-10 | 2012-07-10 | Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103540644B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2468326A1 (en) * | 2001-11-26 | 2003-06-05 | Pierre Legrain | Protein-protein interactions in human immunodeficiency virus |
| WO2010028264A1 (en) * | 2008-09-04 | 2010-03-11 | Childrens Hospital Los Angeles | Methods and compositions for identifying modulators of anti-tetherin activity to inhibit propagation of viruses |
-
2012
- 2012-07-10 CN CN201210239795.2A patent/CN103540644B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2468326A1 (en) * | 2001-11-26 | 2003-06-05 | Pierre Legrain | Protein-protein interactions in human immunodeficiency virus |
| WO2010028264A1 (en) * | 2008-09-04 | 2010-03-11 | Childrens Hospital Los Angeles | Methods and compositions for identifying modulators of anti-tetherin activity to inhibit propagation of viruses |
Non-Patent Citations (5)
| Title |
|---|
| 《High-throughput assay to identify inhibitors of Vpu-mediated down-regulation of cell surface BST-2》;Quan Zhang,et al.;《Antiviral Research》;20110331;321-329 * |
| 乔新华,等.《以HIV-1Vif与人APOBEC3G为靶点的抗HIV-1药物的研究方法》.《中国中药杂志》.2011,806-809. * |
| 张全,等.《HIV-1前体蛋白早成熟化激活剂筛选模型的建立及应用》.《药学学报》.2010,247-252. * |
| 李雅林,等.《生物发光共振能量转移技术及其应用》.《中国生物化学与分子生物学学报》.2009,1077-1082. * |
| 范丽霞,等.《靶向IRE1/XBP1信号通路的细胞水平高通量筛选模型建立》.《中国生物工程杂志》.2012,73-80. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103540644A (en) | 2014-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ploss et al. | Persistent hepatitis C virus infection in microscale primary human hepatocyte cultures | |
| Fassati et al. | Nuclear import of HIV-1 intracellular reverse transcription complexes is mediated by importin 7 | |
| EP1187928B1 (en) | Virus like particles, preparation and use in screening and functional genomics | |
| Rivas-Aravena et al. | The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites | |
| Ma et al. | Real-time imaging of single HIV-1 disassembly with multicolor viral particles | |
| Meng et al. | SARS-CoV-2 Omicron spike mediated immune escape and tropism shift | |
| Zhang et al. | Slit2/Robo4 signaling modulates HIV-1 gp120-induced lymphatic hyperpermeability | |
| Tang et al. | Endogenous retroviral envelope syncytin induces HIV-1 spreading and establishes HIV reservoirs in placenta | |
| Geng et al. | The putative protein 6 of the severe acute respiratory syndrome-associated coronavirus: expression and functional characterization | |
| Lee et al. | HIV activates the tyrosine kinase Hck to secrete ADAM protease-containing extracellular vesicles | |
| Jain et al. | Large-scale arrayed analysis of protein degradation reveals cellular targets for HIV-1 Vpu | |
| Wang et al. | M2BP inhibits HIV-1 virion production in a vimentin filaments-dependent manner | |
| Yao et al. | Hepatitis B virus X protein upregulates intracellular calcium signaling by binding C-terminal of orail protein | |
| El-Shennawy et al. | Circulating ACE2-expressing exosomes block SARS-CoV-2 infection as an innate antiviral mechanism | |
| Caccuri et al. | Cellular aspartyl proteases promote the unconventional secretion of biologically active HIV-1 matrix protein p17 | |
| Matsunaga et al. | Engineering cellular biosensors with customizable antiviral responses targeting hepatitis B virus | |
| US20060094030A1 (en) | Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics | |
| Han et al. | Mechanisms of HIV-1 cell-to-cell transfer to myeloid cells | |
| Mascarau et al. | Productive HIV-1 infection of tissue macrophages by fusion with infected CD4+ T cells | |
| Feng et al. | Hepatitis C virus core protein promotes the migration and invasion of hepatocyte via activating transcription of extracellular matrix metalloproteinase inducer | |
| CN103540644B (en) | Method for screening anti-HIV-1 (human immunodeficiency virus-1) medicament | |
| Branttie et al. | Parainfluenza virus 5 fusion protein maintains pre-fusion stability but not fusogenic activity following mutation of a transmembrane leucine/isoleucine domain | |
| Wei et al. | SARS-CoV-2 manipulates the SR-B1-mediated HDL uptake pathway for its entry | |
| Yang et al. | Phosphatidylserine-specific phospholipase A1 is the critical bridge for hepatitis C virus assembly | |
| De Feo et al. | Resistance to N-peptide fusion inhibitors correlates with thermodynamic stability of the gp41 six-helix bundle but not HIV entry kinetics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |