CN103525928B - Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof - Google Patents
Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof Download PDFInfo
- Publication number
- CN103525928B CN103525928B CN201310477580.9A CN201310477580A CN103525928B CN 103525928 B CN103525928 B CN 103525928B CN 201310477580 A CN201310477580 A CN 201310477580A CN 103525928 B CN103525928 B CN 103525928B
- Authority
- CN
- China
- Prior art keywords
- primer
- seed
- seconds
- pcr
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention mainly relates to a method for identifying the authenticity of Gaodan grass seeds and a special primer thereof, and particularly relates to a kit for detecting genes of the Gaodan grass and sorghum and a detection method thereof. The kit is mainly characterized in that a PCR detection system of the Gaodan grass is 50mul in total volume and comprises TaKaRa Taq, 10 multiplied by PCR Buffer (Mg2+Plus), dNTP Mixture, primer GL-R3-F(5'-3'):CCCAATATTTATCATGAGACTTGCA, primer GL-R3-R(5'-3'):TAACTGCTACACAATGGCCCTTT and ddH2O. Proved by a detection method, the technology has the characteristics of strong sensitivity, high accuracy, strong repeatability, fastness and convenience and the like, has a wide application prospect in the industrialized promotion of the Gaodan, can ensure that the Gaodan grass serves for the animal husbandry well and lays a solid foundation for guaranteeing the safety of the grain.
Description
Technical field
The present invention relates generally to method and the primer special thereof of the high red grass seed true and false of qualification.Be specifically related to Gao Dancao and jowar gene detecting kit and detection method thereof.
Background technology
Along with the development of livestock industry, the demand of herbage is increasing, and safety requirements is also more and more higher.Gao Dancao as good new forage crop variety by researcher extensive concern.The high red careless sown area of China has reached 6.7 ten thousand mu, and (in Zhuo, 2006), has effectively supplemented forage feed deficiency.High red grass seed demand raises year by year, and the seed production of China Gao Dancao is lower, mainly concentrates on Inner Mongol and northeast.High-quality seed is the guarantee of safe and high quality herbage, thereby accurately identifies rapidly the content of jowar seed in high red grass seed, is of great significance for the quality tool that improves the high red grass seed of China.
Gao Dancao (Sorghum hybrid sudangrass) has high-quality, high yield, feeding value high (crude protein content 15%), good palatability, the feature such as of many uses.Jowar (Sorgum bicolor), its nutritive value is not only lower than Gao Dancao (crude protein content 11%).And containing prussic acid, palatability is poor.And the seed of these two kinds of herbages, seedling and blade on mode of appearance extremely similar (Fig. 1), thousand seed weight difference is remarkable (Fig. 6) not, differentiate very difficult, once two kinds of grass seeds mix, plantation to Gao Dancao and utilization are produced to irremediable loss, and now go back both at home and abroad, neither one is unified, effective authentication method.Can only rely on visual inspection or claim thousand seed weight, so result is inaccurate.
Summary of the invention
The object of the invention is to avoid the deficiency of existing detection technique, propose a kind of primer of identifying the high red grass seed true and false.
Another object of the present invention is to provide a kind of test kit of identifying the high red grass seed true and false.
Object three of the present invention is to provide a kind of method of identifying the high red grass seed true and false.
To efficiently and accurately identify fast, the true and false of high red grass seed.This method is time saving and energy saving, easy and simple to handle, under laboratory condition, in the short period, can be good at.This research has very strong promotional value, contributes to the differentiation of Seed Inspection personnel to the red grass seed of height and jowar seed, makes Gao Dancao better for service is produced in livestock industry, for the grain security that ensures China is laid a solid foundation.
For achieving the above object, the technical scheme that the present invention takes is: a kind of primer of identifying the high red grass seed true and false, and its principal feature is to include:
First pair of careless primer of high pellet: GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA,
GL-R3-R(5′-3′):TAACTGCTACACAATGGCCCTTT;
Second pair of jowar primer: GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA,
GLC-R1-R(5′-3′):TGAACTTCAAGATGCCGACTCC。
Identify a test kit for the high red grass seed true and false, its principal feature is to include:
First group: high red careless PCR detection system, comprising TaKaRa Taq0.25 μ l, 10 × PCRBuffer(Mg
2+plus), dNTP Mixture, primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT, ddH
2o;
Second group: jowar PCR detection system, comprising TaKaRa Taq, 10 × PCR Buffer(Mg
2+plus), dNTP Mixture, primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC, ddH
2o.
Identify a method for the high red grass seed true and false, its principal feature comprises the steps:
A. collect seed, adopt double-deck filter paper to sprout method, sprout 72 hours for 25 DEG C, extract germinating seed genomic dna for subsequent use;
B. utilize first pair of careless primer special of high pellet, to seed cdna group, DNA carries out PCR detection; PCR detection system cumulative volume is 50 μ l, comprising TaKaRa Taq0.25 μ l, 10 × PCR Buffer, Mg
2+plus, 5 μ l, dNTP Mixture4 μ l, DNA profiling, concentration is 5000ng/ μ l, 1 μ l, and primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA, concentration is 10nM, 1 μ l, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT, concentration is 10nM, 1 μ l, ddH
2o37.75 μ l; Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 56 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes;
C. utilize second pair of jowar primer special, to seed cdna group, DNA carries out PCR detection; The cumulative volume of PCR detection system is 50 μ l, comprising TaKaRa Taq0.25 μ l, 10 × PCR Buffer, Mg
2+plus, 5 μ l, dNTP Mixture4 μ l, DNA profiling, concentration is 5000ng/ μ l, 1 μ l, and primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA, concentration is 10nM, 1 μ l, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC, concentration is 10nM, 1 μ l, ddH
2o37.75 μ l; Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 55.5 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes
The invention has the beneficial effects as follows, can effectively identify the true and false of high red grass seed, can also be in 1% level, detect the micro-jowar seed being mixed with in high red grass seed.This method has that susceptibility is strong, accuracy rate is high, repeatability is strong and the feature such as rapid and convenient, can carry out the detection of the high red grass seed true and false in enormous quantities, for ensureing that high red grass seed Purity provides feasible foundation.
Brief description of the drawings
The high red grass of Fig. 1 and jowar are in morphologic similarity;
In figure: the fresh blade of Gao Dancao and jowar (A and B), the plant (C and D) that grows up, individual plants (E and F) and seed (G and H) contrast figure;
The PCR qualification result of the high red grass seed of Fig. 2 and sorghum seeds;
In the high red grass of Fig. 3, mix and have the PCR of different ratios jowar qualification result;
Fig. 4 Chinese sorghum and Gao Dan grass thousand seed weight.
Embodiment
Below in conjunction with embodiment, principle of the present invention and feature are described, example, only for explaining the present invention, is not intended to limit scope of the present invention.
Embodiment 1: a kind of primer of identifying the high red grass seed true and false, includes:
First pair of careless primer of high pellet: GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA,
GL-R3-R(5′-3′):TAACTGCTACACAATGGCCCTTT;
Second pair of jowar primer: GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA,
GLC-R1-R(5′-3′):TGAACTTCAAGATGCCGACTCC。
Embodiment 2: a kind of test kit of identifying the high red grass seed true and false, its principal feature is to include:
First group: high red careless PCR detection system, comprising TaKaRa Taq2.5 μ l, approximately 10 times, 10 × PCR Buffer(Mg
2+plus) 50 μ l, dNTP Mixture40 μ l, primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA10 μ l, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT1 μ l, ddH
2o400 μ l;
Second group: jowar PCR detection system, comprising TaKaRa Taq2.5 μ l, 10 × PCR Buffer(Mg
2+plus) 50 μ l, dNTP Mixture40 μ l, primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA10 μ l, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC10 μ l, ddH
2o400 μ l.
Embodiment 3: a kind of test kit of identifying the high red grass seed true and false, its principal feature is to include:
First group: high red careless PCR detection system, comprising TaKaRa Taq1.25 μ l(approximately 5 times), 10 × PCR Buffer(Mg
2+plus) 25 μ l, dNTP Mixture20 μ l, primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA5 μ l, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT5 μ l, ddH
2o200 μ l;
Second group: jowar PCR detection system, comprising TaKaRa Taq1.25 μ l(approximately 5 times), 10 × PCR Buffer(Mg
2+plus) 25 μ l, dNTP Mixture20 μ l, primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA5 μ l, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC5 μ l, ddH
2o200 μ l.
Embodiment 4: a kind of test kit of identifying the high red grass seed true and false, its principal feature is to include:
First group: high red careless PCR detection system, comprising TaKaRa Taq5 μ l(approximately 20 times), 10 × PCR Buffer(Mg
2+plus) 100 μ l, dNTP Mixture80 μ l, primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA20 μ l, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT20 μ l, ddH
2o800 μ l;
Second group: jowar PCR detection system, comprising TaKaRa Taq5 μ l, 10 × PCR Buffer(Mg
2+plus) 100 μ l, dNTP Mixture80 μ l, primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA20 μ l, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC20 μ l, ddH
2o800 μ l.
Embodiment 5: a kind of method of identifying the high red grass seed true and false, its principal feature is to comprise the steps:
A. gather seed, adopt double-deck filter paper to sprout method, sprout 72 hours for 25 DEG C, extract germinating seed genomic dna (extraction of DNA adopts the plant genome DNA of Tian Gen biochemical technology company limited to extract test kit, catalog number: DP305) for subsequent use;
B. utilize first pair of careless primer special of high pellet to carry out PCR detection to seed cdna group DNA.The cumulative volume of PCR detection system is 50 μ l, comprising TaKaRa Taq0.25 μ l, 10 × PCRBuffer(Mg
2+plus) 5 μ l, dNTP Mixture4 μ l, (concentration is l) 1 μ l of 5000ng/ μ to DNA profiling, primer GL-R3-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA(concentration is 10nM) 1 μ l, primer GL-R3-R(5 '-3 '): TAACTGCTACACAATGGCCCTTT(concentration is 10nM) 1 μ l, ddH
2o37.75 μ l; Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 56 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes;
C. utilize second pair of jowar primer special to carry out PCR detection to seed cdna group DNA.The cumulative volume of PCR detection system is 50 μ l, comprising TaKaRa Taq0.25 μ l, 10 × PCR Buffer(Mg
2+plus) 5 μ l, dNTP Mixture4 μ l, (concentration is l) 1 μ l of 5000ng/ μ to DNA profiling, primer GLC-R1-F(5 '-3 '): CCCAATATTTATCATGAGACTTGCA(concentration is 10nM) 1 μ l, primer GLC-R1-R(5 '-3 '): TGAACTTCAAGATGCCGACTCC(concentration is 10nM) 1 μ l, ddH
2o37.75 μ l.Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 55.5 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 6~8 step cycle 35 times; (6) 72 DEG C are extended 7 minutes.
Embodiment 6: the method for the high red grass seed of checking qualification, comprises the steps:
Extracting the genomic dna of high red grass seed, is 200ng/ μ l by its concentration dilution, as template, and with 1 part of 200ng/ μ l jowar seed cdna group DNA and ddH
2o is that template compares, and adopts GL-R3-F and GL-R3-R primer to carry out pcr amplification.
PCR system is: TaKaRa Taq0.25 μ l, 10 × PCR Buffer(Mg
2+plus) 5 μ l, dNTP Mixture4 μ l, DNA profiling 1 μ l, primer GL-R3-F1 μ l, GL-R3-R1 μ l, ddH
2o37.75 μ l.PCR method is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 30 seconds for (3) 56 DEG C; (4) 72 DEG C are extended 30 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes.
PCR product detects its effect through 2% agarose gel electrophoresis:
Fig. 2 shows taking GL-R3 as primer, and the electrophoretic band that high red grass seed genomic dna is template is clear bright, and taking jowar seed cdna group DNA in the control group of template without electrophoretic band, with ddH
2o is that the negative control group of template does not have electrophoretic band yet.
Embodiment 7: the method for checking qualification jowar seed comprises the steps:
The genomic dna that extracts jowar seed, is 200ng/ μ l by its concentration dilution, as template, and with the high red grass seed genomic dna of 1 part of 200ng/ μ l and ddH
2o is that template compares, and adopts GLC-R1-F and GLC-R1-R primer to carry out pcr amplification.
PCR system is: TaKaRa Taq0.25 μ l, 10 × PCR Buffer(Mg
2+plus) 5 μ l, dNTP Mixture4 μ l, DNA profiling 1 μ l, GLC-R1-F1 μ l, GLC-R1-R1 μ l, ddH
2o37.75 μ l.PCR method is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 55.5 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes.
PCR product detects its effect through 2% agarose gel electrophoresis:
Fig. 2 shows that electrophoretic band that jowar seed cdna group DNA is template is clear bright, and taking the red grass seed genomic dna of height in the control group of template without electrophoretic band, with ddH
2o is that the negative control group of template does not have electrophoretic band yet.
Embodiment 8: the method for the high red grass seed true and false of checking qualification comprises the steps:
The seed of jowar and Gao Dancao mixes with the ratio of 1:100,1:50,1:10,1:5,1:2,1:1 and 0:1 respectively, extracts the genomic dna of seed after mixing also as template, with ddH
2o is that template compares, and adopts GLC-R1-F and GLC-R1-R primer special to carry out pcr amplification.PCR system and method are with embodiment 5.
PCR product detects its effect through 2% agarose gel electrophoresis:
Fig. 3 shows in hybrid template, and jowar seed cdna group DNA concentration is higher, and electrophoretic band is more clear bright, and taking the red grass seed genomic dna of height in the control group of template without electrophoretic band, with ddH
2o is that the negative control group of template does not have electrophoretic band yet.
Embodiment 9: the method for the high red grass seed true and false of checking qualification comprises the steps:
For further verifying the specificity of designed primer, we check order to high red grass and jowar special DNA sequence.Result shows, in high red careless special DNA sequence, comprises dedicated forward primer GL-R3-F and dedicated reverse primer GL-R3-R; In jowar special DNA sequence, comprise dedicated forward primer GLC-R1-F and dedicated reverse primer GLC-R1-R.
Taking the high red careless genomic dna of 200ng/ μ l as template, adopt GL-R3-F and GL-R3-R primer special to carry out pcr amplification.PCR system and method are with embodiment 3.PCR product detects through 1% agarose gel electrophoresis, reclaims the DNA fragmentation of the about 1350bp of length, after connection pGEM-T carrier, transforms bacillus coli DH 5 alpha competent cell.To be applied on the LB substratum containing Amp, IPTG and X-Gal containing the intestinal bacteria of pGEM-T-GL-R3 plasmid, 37 DEG C of incubated overnight, 5 positive colony bacterial plaques of picking, containing in the LB liquid nutrient medium of Amp 37 DEG C spend the night and shake bacterium and cultivate.After bacterium liquid detects, conform to expectation stripe size, serve Hai Shenggong biotechnology company limited and check order, send the high red careless fragment sequences of 2 positive colonies of survey consistent.Result shows that high red careless primer special can amplify the special-purpose gene fragment of high red careless 1346bp well.
Embodiment 10: the method for the high red grass seed true and false of checking qualification comprises the steps:
Taking 200ng/ μ jowar genomic dna as template, adopt GLC-R1-F and GLC-R1-R primer special to carry out pcr amplification, PCR system and method are with embodiment 6.
PCR product detects through 1% agarose gel electrophoresis, reclaims the DNA fragmentation of the about 630bp of length, after connection pGEM-T carrier, transforms bacillus coli DH 5 alpha competent cell.To be applied on the LB substratum containing Amp, IPTG and X-Gal containing the intestinal bacteria of pGEM-T-GLC-R1 plasmid, 37 DEG C of incubated overnight, 2 positive colony bacterial plaques of picking, containing in the LB liquid nutrient medium of Amp 37 DEG C spend the night and shake bacterium and cultivate.After bacterium liquid detects, conform to expectation stripe size, serve Hai Shenggong biotechnology company limited and check order, send 2 positive colony jowar fragment sequences of survey consistent.Result shows that jowar primer special can amplify the special-purpose gene fragment of jowar 626bp well.
The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any amendment of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Claims (3)
1. qualification mixes a primer for the true and false that has the red grass seed of the height of sorghum seeds, it is characterized in that including:
High red careless primer: GL-R3-F (5 '-3 '): CCCAATATTTATCATGAGACTTGCA,
GL-R3-R(5′-3′):TAACTGCTACACAATGGCCCTTT。
2. qualification mixes a test kit for the true and false that has the red grass seed of the height of sorghum seeds, it is characterized in that including:
First group: high red careless PCR detection system, comprising TaKaRa Taq, 10 × PCR damping fluid Mg
2+add dNTP mixture, primer GL-R3-F (5 '-3 '): CCCAATATTTATCATGAGACTTGCA, primer GL-R3-R (5 '-3 '): TAACTGCTACACAATGGCCCTTT, ddH
2o;
Second group: jowar PCR detection system, comprising TaKaRa Taq, 10 × PCR damping fluid Mg
2+add dNTP mixture, primer GLC-R1-F (5 '-3 '): CCCAATATTTATCATGAGACTTGCA, primer GLC-R1-R (5 '-3 '): TGAACTTCAAGATGCCGACTCC, ddH
2o.
3. qualification mixes a method for the true and false that has the red grass seed of the height of sorghum seeds, it is characterized in that comprising the steps:
A. collect seed, adopt double-deck filter paper to sprout method, sprout 72 hours for 25 DEG C, extract germinating seed genomic dna for subsequent use;
B. utilize high red careless primer, to seed cdna group, DNA carries out PCR detection; PCR detection system cumulative volume is 50 μ l, comprising TaKaRa Taq 0.25 μ l, 10 × PCR damping fluid, Mg
2+add 5 μ l, dNTP mixture 4 μ l, DNA profiling, concentration is 5000ng/ μ l, 1 μ l, primer GL-R3-F (5 '-3 '): CCCAATATTTATCATGAGACTTGCA, concentration is 10nM, 1 μ l, primer GL-R3-R (5 '-3 '): TAACTGCTACACAATGGCCCTTT, concentration is 10nM, 1 μ l, ddH
2o 37.75 μ l; Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 56 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes;
C. utilize jowar primer, to seed cdna group, DNA carries out PCR detection; The cumulative volume of PCR detection system is 50 μ l, comprising TaKaRa Taq 0.25 μ l, 10 × PCR damping fluid, Mg
2+add 5 μ l, dNTP mixture 4 μ l, DNA profiling, concentration is 5000ng/ μ l, 1 μ l, primer GLC-R1-F (5 '-3 '): CCCAATATTTATCATGAGACTTGCA, concentration is 10nM, 1 μ l, primer GLC-R1-R (5 '-3 '): TGAACTTCAAGATGCCGACTCC, concentration is 10nM, 1 μ l, ddH
2o 37.75 μ l; Amplification condition is: (1) 95 DEG C of denaturation 3 minutes; (2) 95 DEG C of sex change 35 seconds; Anneal 35 seconds for (3) 55.5 DEG C; (4) 72 DEG C are extended 35 seconds; (5) 2~4 step cycle 35 times; (6) 72 DEG C are extended 7 minutes.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310477580.9A CN103525928B (en) | 2013-10-13 | 2013-10-13 | Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310477580.9A CN103525928B (en) | 2013-10-13 | 2013-10-13 | Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103525928A CN103525928A (en) | 2014-01-22 |
CN103525928B true CN103525928B (en) | 2014-10-08 |
Family
ID=49928274
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310477580.9A Expired - Fee Related CN103525928B (en) | 2013-10-13 | 2013-10-13 | Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103525928B (en) |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101748191A (en) * | 2008-12-12 | 2010-06-23 | 福建出入境检验检疫局检验检疫技术中心 | PCR identification method for sorghum halepense and similar species and kit |
CN103146832B (en) * | 2013-03-20 | 2014-07-16 | 全国畜牧总站 | Method for detecting or performing aided detection on sorghum sudanense nationally checked variety |
-
2013
- 2013-10-13 CN CN201310477580.9A patent/CN103525928B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN103525928A (en) | 2014-01-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101649350B (en) | Molecular detection method for rapidly distinguishing mating types of Chinese caterpillar fungus | |
CN102643896B (en) | Kit for identifying authenticity of medicago sativa seed and detection method thereof | |
Soto et al. | Changes in ruminal microbiota due to rumen content processing and incubation in single-flow continuous-culture fermenters | |
CN104278084A (en) | Specific molecular marker kit for identifying M.albus and M.officinalis and detection method thereof | |
CN103525928B (en) | Kit for identifying the authenticity of Gaodan grass seeds and detection method thereof | |
CN101086015B (en) | Mushroom 45 bacteria molecular specific mark and its obtaining method and uses | |
CN105018637B (en) | Application and method of the tetA genes in detecting soil antibiotic resistance level of pollution | |
CN103898236B (en) | Primer pair, kit and method for detecting verticillium lecanii ferment powder added in cordyceps sinensis ultra-fine powder | |
CN102220320B (en) | Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof | |
CN103667511A (en) | Kit for PCR (Polymerase Chain Reaction) detection of haemophilus paragallinarum | |
CN101591710B (en) | Method for counting archenteric flora of aquatic animals and special primer thereof | |
CN104293935B (en) | TrnH-psbA sequence as DNA bar code qualification Mineral elements in application and authentication method | |
CN103789423B (en) | The specific molecular marker test kit of the qualification Laomangmai seed true and false and detection method thereof | |
CN116121415A (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting three bifidobacteria, application and detection method | |
CN105063187A (en) | Method and primer composition for rapid detection of resistance of botrytis cinerea to SDH1 fungicides | |
CN108676904A (en) | Primer pair, reagent and kit and its application and identification alfalfa product in whether the method containing peanut | |
CN101712988B (en) | Method for quickly, qualitatively and quantitatively measuring Bifidobacteria in probiotic dairy products | |
CN108441577A (en) | Primer pair, kit and purposes and detection alfalfa product in whether the method containing soybean | |
CN101691605B (en) | Nested PCR detection method of oak wilt | |
CN103773868B (en) | The specific molecular marker test kit of the qualification Perennial Ryegrass Seed true and false and method thereof | |
CN105039516A (en) | Fluorescent PCR detection method for clostridium difficile toxin genes, as well as primer and kit of fluorescent PCR detection method | |
Alam et al. | Isolation and characterization of strictly anaerobic cellulolytic rumen bacterial species from Sahiwal cattle | |
CN104450949B (en) | A kind of specificity molecular marker DNA sequence of Lactobacillus plantarum and application thereof | |
CN108018370A (en) | Detection primer group, detection kit and the detection method of Paecilomyces hepiali chen in cordyceps sinensis bacteria culture fluid | |
CN102168134A (en) | Primer sequence and detection method for detecting purity of Jin superior NO.36 cucumber hybridized seeds |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20181013 |