CN103525834A

CN103525834A - Crylac gene and application thereof

Info

Publication number: CN103525834A
Application number: CN201310145046.8A
Authority: CN
Inventors: 王峰; 陈金湘; 周仲华; 刘海荷; 张秋平
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2013-04-25
Filing date: 2013-04-25
Publication date: 2014-01-22

Abstract

The invention discloses a CrylAc gene and an application thereof to cultivation of pink bollworm and/or cotton bollworm resistant cotton varieties. The corrected mortality of a transgenic strain of the gene to a target pest is remarkably higher than that of a transgenic insect-resistant cotton variety GK19.

Description

CrylAc gene and application thereof

Technical field

The invention belongs to biology field, specifically relate to Cry1Ac gene and the application in preparing insect-resistant transgenic cotton thereof.

Background technology

China is maximum in the world Cotton Production state, and since plantation transgenic Bt cotton in 1997, existing national Annual planting area has reached 5,500,000 hm2, in the whole world, occupies second, is only second to India ^[1].According to CCRI, national high quality cotton science service project team, the cotton investigation results of economizing (urban district) were produced in 16, the whole nation in 2007,471 of national cotton sowing kinds, wherein transgenic cotton against pests is 157, accounts for 33.3% of whole kinds, and its sown area accounts for 66.1% of total sown area ^[2].But it should be noted that in these transgenic cotton flower varieties, except minority kind, for turning outside CryIA+CpTI divalent insect-resistant cotton, most kinds are all cotton for turning unit price Bt gene.And in 157 Transgenic Cotton Varieties, except 4 Ge Wei U.S. introduced varieties wherein, the gene source high concentration of other nearly all kinds, is nearly all CryIA gene.According to current generally acknowledged Bt toxoprotein gene sorting technique, according to the homology of the aminoacid sequence of its toxalbumin, antigenicity and desinsection scope, its Bt gene can be divided CryI, CryII, CryIII, CryIV, CryV and CryVI several large classes, wherein its CryI can be divided into again in CryIA (a), CryIA (b), CryIA (c), CryIB, CryIC etc. more than 10, but CryI and CryIII are most widely used ^[3,4].According to scientific law, unit price Insect Resistant Cotton generally can only Secure Application on Production of Large Fields 8～10 years [ ^5,6], and transgenic cotton against pests has reached more than 10 year at Chinese implantation time, and bollworm increases year by year to Bt gene tolerance, and resistance risk is increasing now.Therefore, current Cotton in China is produced and is badly in need of turning novel anti insect gene, turning multivalent genetic and transgenic pest-resistant and the pest-resistant pest-resistant new cotton variety combining of conventional form.The bivalent gene CryVA (a) of this project build and CryVA (b) gene all belong to CryV type Bt gene, are the novel anti insect gene of Cotton Production application, and the type gene has the pest-resistant and pest-resistant characteristic of Coleoptera of the anti-lepidopteran of holding concurrently ^[4], this,, by expanding the pest-resistant spectrum of Insect Resistant Cotton, reduces the generation of the resistance risk of bollworm.

By building novel divalent insect-resistant gene, utilize existing fine germplasm resources, in conjunction with conventional breeding method, breeding high-yield, high-quality, many anti-novel transgene cotton new variety (being), realize the pest-resistant spectrum of expansion, strengthen insect-resistance, change anti insect gene unicity target, the generation that endangers, delays or prevent resistant bollworm alleviating bollworm, reduces environmental pollution, improve output of cotton and quality, increase the aspect tools such as cotton grower's income and be of great significance.

Summary of the invention

One aspect of the present invention relates to a kind of Cry1Ac gene, and the nucleotide sequence that it has with the nucleotide sequence shown in SEQ ID NO.1 or its complementary sequence at least 99% homology, is preferably and has 100% homology.

The present invention also relates to the application of above-mentioned Cry1Ac gene in cultivating anti-pink bollworm and/or bollworm cotton variety on the other hand.

Embodiment:

Cry1Ac gene order:

Preference according to cotton to genetic codon, simultaneously according to the aminoacid sequence of Cry1Ac, designs the Cry1Ac gene shown in SEQ ID NO.1, at NCBI, carries out Blast comparison, does not find height homologous sequence.

ATGGACAACAACCCAAACATCAACGAATGCATTCCATACAACTGCTTGAGTAACCCAGAAGTTGAAGTACTTGGTGGAGAACGCATTGAAACCGGTTACACTCCCATCGACATCTCCTTGTCCTTGACACAGTTTCTGCTCAGCGAGTTCGTGCCAGGTGCTGGGTTCGTTCTCGGACTAGTTGACATCATCTGGGGTATCTTTGGTCCATCTCAATGGGATGCATTCCTGGTGCAAATTGAGCAGTTGATCAACCAGAGGATCGAAGAGTTCGCCAGGAACCAGGCCATCTCTAGGTTGGAAGGATTGAGCAATCTCTACCAAATCTATGCAGAGAGCTTCAGAGAGTGGGAAGCCGATCCTACTAACCCAGCTCTCCGCGAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAACTACCAAGTTCCTCTCTTGTCCGTGTACGTTCAAGCAGCTAATCTTCACCTCAGCGTGCTTCGAGACGTTAGCGTGTTTGGGCAAAGGTGGGGATTCGATGCTGCAACCATCAATAGCCGTTACAACGACCTTACTAGGCTGATTGGAAACTACACCGACCACGCTGTTCGTTGGTACAACACTGGCTTGGAGCGTGTCTGGGGTCCTGATTCTAGAGATTGGATTAGATACAACCAGTTCAGGAGAGAATTGACCCTCACAGTTTTGGACATTGTGTCTCTCTTCCCGAACTATGACTCCAGAACCTACCCTATCCGTACAGTGTCCCAACTTACCAGAGAAATCTATACTAACCCAGTTCTTGAGAACTTCGACGGTAGCTTCCGTGGTTCTGCCCAAGGTATCGAAGGCTCCATCAGGAGCCCACACTTGATGGACATCTTGAACAGCATAACTATCTACACCGATGCTCACAGAGGAGAGTATTACTGGTCTGGACACCAGATCATGGCCTCTCCAGTTGGATTCAGCGGGCCCGAGTTTACCTTTCCTCTCTATGGAACTATGGGAAACGCCGCTCCACAACAACGTATCGTTGCTCAACTAGGTCAGGGTGTCTACAGAACCTTGTCTTCCACCTTGTACAGAAGACCCTTCAATATCGGTATCAACAACCAGCAACTTTCCGTTCTTGACGGAACAGAGTTCGCCTATGGAACCTCTTCTAACTTGCCATCCGCTGTTTACAGAAAGAGCGGAACCGTTGATTCCTTGGACGAAATCCCACCACAGAACAACAATGTGCCACCCAGGCAAGGATTCTCCCACAGGTTGAGCCACGTGTCCATGTTCCGTTCCGGATTCAGCAACAGTTCCGTGAGCATCATCAGAGCTCCTATGTTCTCTTGGATACATCGTAGTGCTGAGTTCAACAACATCATCGCATCCGATAGTATTACTCAAATCCCTGCAGTGAAGGGAAACTTTCTCTTCAACGGTTCTGTCATTTCAGGACCAGGATTCACTGGTGGAGACCTCGTTAGACTCAACAGCAGTGGAAATAACATTCAGAATAGAGGGTATATTGAAGTTCCAATTCACTTCCCATCCACATCTACCAGATATAGAGTTCGTGTGAGGTATGCTTCTGTGACCCCTATTCACCTCAACGTTAATTGGGGTAATTCATCCATCTTCTCCAATACAGTTCCAGCTACAGCTACCTCCTTGGATAATCTCCAATCCAGCGATTTCGGTTACTTTGAAAGTGCCAATGCTTTTACATCTTCACTCGGTAACATCGTGGGTGTTAGAAACTTTAGTGGGACTGCAGGAGTGATTATCGACAGATTCGAGTTCATTCCAGTTACTGCAACACTCGAGGCTGAGTACAATCTTTAA

Use the PRI101-AN of takala company as expression vector, by enzyme, cut (restriction enzyme site adds at two ends while being synthetic, is respectively HindIII+SphI) combination HindIII+SphI Cry1Ac gene order is incorporated on expression vector.

The PCR of Cry5b gene detects

From turn Cry1Aa gene cotton strain, extract total DNA, utilize special primer to carry out pcr amplification, with the negative contrast of unconverted materials, to carry the positive contrast of plasmid of object fragment.Result shows, each sample has specific band, identical with the positive control stripe size of plasmid, be about 700bp, and negative control does not have amplified band, and amplification is consistent with expected result.The PCR result that turns Cry1Aa gene cotton plants detecting is positive, and can be incorporated in cotton gene group by preliminary proof Cry5 gene.

RT-PCR detects

RT-PCR result shows, Cry1Aa has obtained expression on rna level.

Western-blot analyzes

According to the synthetic Cry1Aa albumen specific antibody of special peptide section sequence CNPNQPCKDDLDRV, adopt TCA-acetone precipitation to extract and turn Cry1Aa gene cotton strain JX0010, JX0020 leaf protein, carries out Western blot analysis.Result confirms from protein level, and Cry1Aa gene, at transgenic strain JX0010, can be expressed toxic protein in JX0020.

The spatial and temporal expression of Cry1Aa gene

Utilize synthetic Cry1Aa genetic expression toxalbumin specific antibody, adopt ELISA method, the toxalbumin expression amount of transgenic strain JX0010 and each organ of JX0020, different times is measured.As can be seen from the table, the Cry1Aa toxalbumin of JX0010 is expressed compared with JX0020 and all wants high, and the time distributes the highest with the expression of flower bud phase, spatial distribution with blade for the highest.

Table 1 Cry1Aa toxalbumin Elisa detects

This gene expression product is Cry protein, target pest is mainly lepidopterous pink bollworm and bollworm, gene expression product has height toxicity for target pest, after by insect's food-taking, in the digestive tube of insect, under specificity protease hydrolysis cutting action, discharge endotoxin core peptide section, specific receptors above insect gut epithelial cell is combined, in conjunction with desinsection crystalline protein is all or part of afterwards, be embedded in cytolemma, make cytolemma produce some ducts, thereby cause cell to break because osmotic equilibrium is destroyed.Be accompanied by said process, insect larvae will stop feed, finally dead.

This gene is mainly used in cotton opposing pink bollworm and bollworm, can be used as the supplementary of the anti-series of CFM cryIA gene state by the Guo of biotechnology research institute of the Chinese Academy of Agricultural Sciences three heap synthesizeds that current big area used, can improve insect-resistance to a certain extent, according to detection, the transgenic strain of this gene is significantly higher than transgenic pest-resistant cotton variety GK19 for the rectification mortality ratio utmost point of target pest.

Turn the test of Cry1Aa gene strain insect-resistance

To turning Cry1Aa strain JX0010, carry out bollworm resistance test, result shows, two, three, four generations of cotton bollworm occurance peak, transgenic strain blade is respectively 85.42%, 75.35%, 62.79% to the corrected mortality of bollworm resistance, compare with contrasting GK19, to two, three, the corrected mortality of four generations of cotton bollworm resistance is high by 2.43%, high by 1.79%, low by 0.80% respectively.By variance analysis, show, the cotton leaf of JX0010 two, three, the four generations of cotton bollworm emergence period compares all without significant difference with contrast GK19 the corrected mortality of bollworm, result demonstration resistance is obvious.

JX0020 is carried out to bollworm resistance test, and result shows, two, three, four generations of cotton bollworm occurance peak, and T ₂for JX0020 blade, the corrected mortality of bollworm resistance is respectively to 81.37%, 72.58%, 69.19%, compares with contrasting GK19, to two, three, the corrected mortality of four generations of cotton bollworm resistance is low by 1.62%, low by 0.71%, high by 5.60% respectively.By variance analysis, show, the cotton leaf of JX0020 two, three, the four generations of cotton bollworm emergence period compares all without significant difference with contrast GK19 the corrected mortality of bollworm, result demonstration resistance is obvious.

The bollworm resistance measurement result of table 2. transgene cotton

Note: colleague compares, and capitalization and lowercase represent respectively 0.01 and 0.05 level, lower same.

The bollworm resistance measurement result of table 3.JX0020 transgene cotton

The above, be only the specific embodiment of the present invention, but protection scope of the present invention is not limited to this, and any variation of expecting without creative work or replacement, within all should being encompassed in protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain that claims were limited.

Sequence table

Claims

1.Cry1Ac gene, the nucleotide sequence that it has with the nucleotide sequence shown in SEQ ID NO.1 or its complementary sequence at least 99% homology, is preferably and has 100% homology.

2. the application of Cry1Ac gene claimed in claim 1 in cultivating anti-pink bollworm and/or bollworm cotton variety.