CN103525759B - Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles - Google Patents
Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles Download PDFInfo
- Publication number
- CN103525759B CN103525759B CN201310471237.3A CN201310471237A CN103525759B CN 103525759 B CN103525759 B CN 103525759B CN 201310471237 A CN201310471237 A CN 201310471237A CN 103525759 B CN103525759 B CN 103525759B
- Authority
- CN
- China
- Prior art keywords
- maturation
- little
- oocytes
- oocyte
- vitro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles, which belongs to the field of auxology of animals. Degrees of polyadenylation of the maternal genes consisting of cyclinB1, C-mos, GDF9, BMP15 and Cdc2 in oocytes determine expression levels of the genes, which has certain promotion effects on the recruitment process where small follicles become dominant follicles and on maturation of oocytes. The expression levels of the genes consisting of C-mos, GDF9 and BMP15 play a leading role in maturation of the oocytes of small follicles. Addition of a 3'-dA inhibitor can improve the expression levels of the genes consisting of C-mos, GDF9 and BMP15, so the maturation rate of the small follicles is increased. The technology of in-vitro maturation culture of oocytes is expected to be popularized and applied in research fields like transgenic technology, nuclear transplantation technology and embryonic stem cell technology.
Description
Technical field
The invention belongs to animal development field, relate to Cordyceps militaris (L.) Link. element to the application in the little ovarian follicle In vitro maturation of pig, specifically Cordyceps militaris (L.) Link. element is to ripe in vitro GVBD, the M I of the little follicular oocyte of pig, M II period, to the restraining effect that the polyadenylation of source of parents gene carries out in various degree, thus cause the difference of part source of parents gene expression difference and the little Oocytes in Vitro Maturation rate of pig.
Background technology
That studies along with transgenic technology, nuclear transfer technology, embryonic stem cell technologies gos deep into, and has promoted developing rapidly of technology in vitro fertilization further.But ovocyte quantity is limited, only has a small amount of ovocyte to be applied to embryo transfer technology research, significantly limit the application of breeding new technology.The maturation in vitro technology of ovocyte not only can reproduce internal fertilization process, and is conducive to the research of mechanism of fertilization.The maturation in vitro technology of ovocyte can provide a large amount of cheap embryo for embryo in vitro implantation technique, is conducive to the development promoting the technology such as nuclear transplantation, transgenosis.
The maturation in vitro relation of the size of ovarian follicle, the diameter of ovocyte and ovocyte (Liuet al.2002 very closely in ovary; Lucas et al.2002; Griffin et al.2006).Many results of study show, in non-blocked ovarian follicle, along with the increase of ovarian follicle volume, the maturing rate of its ovocyte, rate of fertilization and blastocyst rate improve all thereupon.MelanieA. wait the result of study display of (2007), the ovocyte blastocyst rate from 5-8mm ovarian follicle is almost three times (55% to 17%) of the little follicular oocyte of <3mm.Little follicular oocyte is as the concern that huge resource follicular oocyte can be provided more and more to be subject to Chinese scholars in recent years.After entering the nineties, the Vitro Culture Techniques of little follicular oocyte has had further development.Numerous scholar both domestic and external, by research, establishes the Vitro Culture Techniques of a lot of little follicular oocyte, but these technology are set up mostly on the basis of follicular oocyte extracorporeal culturing method.More late to the foundation of pig little follicular oocyte culture technique, until Tsafriri A in 1975 etc. get follicle size first at the ovocyte of 1-2mm and cultivate, the maturing rate of cultivation only has 15% ~ 25%.
Cordyceps militaris (L.) Link. element (cordycepin), also known as cordycepin, 3'-Deoxyadenosine (3 '-dA), is (especially ucleosides) main active ingredient in Cordyceps militaris (L.) Link., is also first nucleoside antibiotics separated from fungi.In normal Oocyte Maturation Process, genetic expression controls mainly post-transcriptional level; mainly be subject to the impact of cytoplasmic Polyadenylation; this process is not degraded for protection mRNA and is excited them to carry out translation and to be played an important role (Bettegowda and Smith, 2007; Zhang et al., 2009).3 '-dA can cause the degraded (reviewed in Bettegowda and Smith, 2007) of mRNA by deadenylation.Thus affect stability and the translation efficiency of mRNA in the process of oocyte maturation, the sex change of mRNA can be affected in early days during fetal development before or after genome activation.Krischek and Meinecke (2002) research shows, bovine oocyte in vitro maturation needs the Polyadenylation of source of parents gene.Therefore in large follicle ovocyte culturing process, the restraining effect of Polyadenylation can cause the decline of maturing rate and ripe quality.
Summary of the invention
The invention provides the application of Cordyceps militaris (L.) Link. element in the little ovarian follicle In vitro maturation of pig.
The technical scheme that the present invention takes is: the application of Cordyceps militaris (L.) Link. element in the little ovarian follicle In vitro maturation of pig.
The collection method of the little follicular oocyte of pig of the present invention is: ovary adopts the ovary in just butchering sow, puts into 37 DEG C of physiological saline containing 75mg/ml penicillin and 50mg/ml Streptomycin sulphate, and with physiological saline cleaning 2 ~ 3 times within 2 hours; The female cumulus complex of ovum of the little ovarian follicle of diameter <3mm is extracted at the indoor syringe with No. 18 syringe needles of aseptic technique, picking has 3 ~ 5 layers of granulosa cell parcel under the microscope, tenuigenin is even, cumulus oocyte (COCs) complex body that zona pellucida is complete.
The method of one boar ovule bubble In vitro maturation, comprises the following steps:
(1) collection of the female cumulus complex of the little ovarian follicle ovum of pig
Ovary adopts the ovary in just butchering sow, puts into 37 DEG C of physiological saline containing 75mg/ml penicillin and 50mg/ml Streptomycin sulphate, and with physiological saline cleaning 2 ~ 3 times within 2 hours; Extract at the indoor syringe with No. 18 syringe needles of aseptic technique the female cumulus complex of ovum that diameter is <3mm ovarian follicle, picking has 3 ~ 5 layers of granulosa cell parcel under the microscope, and tenuigenin is even, the cumulus oocyte complex that zona pellucida is complete;
(2) preparation of the little ovarian follicle oocyte in vitro maturation culture solution of pig and cultivation
Preparation nutrient solution, basic medium is TCM-199, adds 0.1%PVA (w/v), 3.05mM D-Glucose before balance, 1mM Sodium.alpha.-ketopropionate, 0.57mM halfcystine, 10ng/ml EGF, 10IU/ml PMSG, 10IU/mlhCG, 75mg/ml penicillin, 50mg/ml Streptomycin sulphate, finally adding Cordyceps militaris (L.) Link. element final concentration is 2 μ g/ml;
First wash after 2 times with Hepes-TL-PVA, with the nutrient solution 2 times of balance more than 2h, culture condition is 5%CO
2, temperature 39 DEG C and maximal phase are to saturated humidity; Cultivate 44 little when M II, ovocyte is discharged first polar body and is maturation; Collect the female cumulus complex of ovum, with the hyaluronic acid ferment treatment 2min of 0.1% concentration.
The present invention specify that the effect of part source of parents gene in oocyte maturation, for the little ovarian follicle oocyte maturation quality improving diameter <3mm provides theoretical foundation.The present invention is by studying Polyadenylation to the impact of the maturation in vitro of little ovarian follicle, the mechanism of action of illustrating source of parents gene pairs oocyte maturation that can be more deep; Can excavate the breeding potential of jenny to a greater extent, the research for animal cloning, transgenic technology provides high-quality ovum source.
The invention has the advantages that: source of parents gene cyclinB1, C-mos, GDF9, BMP15, Cdc2 Polyadenylation degree in ovocyte determines the expression amount of these genes, the maturation of ovule being steeped to the process of raising and ovocyte that become dominant follicle has certain pushing effect.Wherein the maturation of expression amount to little follicular oocyte of C-mos, GDF9 and BMP15 gene plays a major role.Add the expression amount that 3 '-dA inhibitor can improve C-mos, GDF9 and BMP15 gene, thus increase the maturing rate of little ovarian follicle.To being widely applied in research fields such as transgenic technology, nuclear transfer technology, embryonic stem cell technologies.
Accompanying drawing explanation
Fig. 1 is the maturation in vitro rate comparison diagram for the treatment of group and the little follicular oocyte of untreated fish group pig;
Fig. 2 is the expression amount variation diagram that Real time PCR detects in-vitro maturity of porcine oocytes process medium and small follicular oocyte different times CyclinB1 gene;
Fig. 3 is the expression amount variation diagram that Real time PCR detects in-vitro maturity of porcine oocytes process medium and small follicular oocyte different times C-mos gene;
Fig. 4 is the expression amount variation diagram that Real time PCR detects in-vitro maturity of porcine oocytes process medium and small follicular oocyte different times GDF9 gene;
Fig. 5 is the expression amount variation diagram that Real time PCR detects in-vitro maturity of porcine oocytes process medium and small follicular oocyte different times BMP15 gene;
Fig. 6 is the expression amount variation diagram that Real time PCR detects in-vitro maturity of porcine oocytes process medium and small follicular oocyte different times Cdc2 gene;
Fig. 7 is that PAT method detects cyclinB1, c-MOS, GDF9, BMP-15, Cdc2 gene at pig little follicular oocyte different times GVBD, M I and M II poly(A in period) depth map of tail.
Embodiment
TCM-199 is purchased from GIBCO company; Hepes, PVA, PMSG, EGF, hCG, D-Glucose, ketone acid sodium, the medicines such as halfcystine are purchased from sigma company.
The method of pig of the present invention little ovarian follicle In vitro maturation is as follows:
(1) collection of the female cumulus complex of the little ovarian follicle ovum of pig
Ovary adopts the ovary in just butchering sow, puts into 37 DEG C of physiological saline containing 75mg/ml penicillin and 50mg/ml Streptomycin sulphate, and with physiological saline cleaning 2 ~ 3 times within 2 hours; The female cumulus complex of ovum that diameter is <3mm ovarian follicle is extracted at the indoor syringe with No. 18 syringe needles of aseptic technique, picking has 3 ~ 5 layers of granulosa cell parcel under the microscope, tenuigenin is even, cumulus oocyte (COCs) complex body that zona pellucida is complete;
(2) preparation of the little ovarian follicle oocyte in vitro maturation culture solution of pig and cultivation
Preparation nutrient solution, basic medium is TCM-199, adds 0.1%PVA (w/v), 3.05mM D-Glucose before balance, 1mM Sodium.alpha.-ketopropionate, 0.57mM halfcystine, 10ng/ml EGF, 10IU/ml PMSG, 10IU/mlhCG, 75mg/ml penicillin, 50mg/ml Streptomycin sulphate, finally adding Cordyceps militaris (L.) Link. element final concentration is 2 μ g/ml; Be little follicular oocyte nutrient solution;
First wash after 2 times with Hepes-TL-PVA, with the nutrient solution 2 times of balance more than 2h, culture condition is 5%CO
2, temperature 39 DEG C and maximal phase are to saturated humidity; Cultivate 44 little when M II, ovocyte is discharged first polar body and is maturation, collects the female cumulus complex of ovum, with the hyaluronic acid ferment treatment 2min of 0.1% concentration, filters out ripe ovocyte under the microscope and record maturing rate.
Below by add Cordyceps militaris (L.) Link. element or do not add Cordyceps militaris (L.) Link. element contrast experiment to further illustrate effect of the present invention.
One, the maturation in vitro of the little follicular oocyte of pig
1. the collection of the female cumulus complex of the little ovarian follicle ovum of pig
Ovary adopts the ovary in just butchering sow, puts into 37 DEG C of physiological saline containing 75mg/ml penicillin and 50mg/ml Streptomycin sulphate, and with physiological saline cleaning 2 ~ 3 times within 2 hours; The female cumulus complex of ovum that diameter is <3mm ovarian follicle is extracted at the indoor syringe with No. 18 syringe needles of aseptic technique, picking has 3 ~ 5 layers of granulosa cell parcel under the microscope, tenuigenin is even, cumulus oocyte (COCs) complex body that zona pellucida is complete, washes 2 times with Hepes-TL-PVA.
2. the maturation in vitro controlled trial of the little follicular oocyte of pig
Preparation nutrient solution, basic medium is TCM-199, adds 0.1%PVA (w/v) before balance, 3.05mM D-Glucose, 1mM Sodium.alpha.-ketopropionate, 0.57mM halfcystine, 10ng/ml EGF, 10IU/ml PMSG, 10IU/mlhCG, 75mg/ml penicillin, 50mg/ml Streptomycin sulphate, be untreated fish group nutrient solution, it is 2 μ g/ml that treatment group adds Cordyceps militaris (L.) Link. element final concentration again.
First wash after 2 times respectively with Hepes-TL-PVA, untreated fish group, treatment group wash 2 times with the respective nutrient solution of balance more than 2h respectively, and culture condition is 5%CO
2, temperature 39 DEG C and maximal phase are to saturated humidity; The female cumulus complex of ovum is collected respectively, with the hyaluronic acid ferment treatment 2min of 0.1% concentration when GVBD, M I, M II.And the oocyte maturation rate of the different group of record.Exposed ovocyte is collected and is stored in liquid nitrogen, and in order to further gene expression analysis, every 40 of ovocyte is divided into one group.
Two, the expression amount of source of parents gene different times detects
After extracting RNA from the porcine oocytes in GVBD, M I, II 3 periods of M, dilution RNA control of the concentration is 10ng/uL, and carry out reverse transcription, Reverse Transcription box is from TOYOBO company.The primer of fluorescent quantitation carries out design of primers (table 1) with primer5.0, what fluorescence dye was selected is TOYOBO company Green fluorescent dye, fluorescent quantitation step is as follows: 95 DEG C of denaturations 3 minutes, 40 circulations comprise 30 seconds 95 DEG C of times, 60 DEG C of 30 seconds times, 72 DEG C of 30 seconds times, last 4 DEG C of preservations.Sample carries out in triplicate technology repetition.Each group all arranges the internal reference of contemporaneity, and internal reference uses β-actin.The method of fluorescent quantitation data acquisition 2-Δ Δ CT is analyzed.
Table 1 source of parents gene cyclin B1, cdc2, C-mos, GDF9, BMP15 fluorescent quantitation primer
| Genes | Primer sequence(5’–3’) |
| cyclin B1-F | TTGACTGGCTAGTGCAGGTTC |
| cyclin B1-R | CTGGAGGGTACATTTCTTCATA |
| cdc2-F | AAGACTCCACGCTTCCATT |
| cdc2-R | GTCCACCTACTTCCAGAACAACCT |
| C-mos-F | TGGGAAGAAACTGGAGGACA |
| C-mos-R | TTCGGGTCAGCCCAGTTCA |
| GDF9-F | GAGCTCAGGACACTGTAAGCT |
| GDF9-R | CTTCTCGTGGATGATGTTCTG |
| BMP15-F | CCCTCGGGTACTACACTATG |
| BMP15-R | GGCTGGGCAATCATATCCT |
| β-Action-F | CACGCCATCCTGCGTCTGGA |
| β-Action-R | AGCACCGTGTTGGCGTAGAG |
Three, poly(A) mensuration of length of tail
Use PCR method to determine ploy(A) length of tail carries out according to following method: Article 1 reverse transcription primer be Oligo (dT) (5 '-GCGAGCTCCGCGGCC-GCGT12-3 ' Salles and Strickland, 1999). ensuing PCR with Oligo (dT) for downstream primer, upstream primer is shown in (table 2). in reaction tubes, add Taq enzyme 1.25 μ l, DEPC water 9.5 μ l, cDNA template 1 μ l, 1 μ l concentration is 10nM reverse primer, 1 μ l concentration is the anchor primer of 10nM, adds in each reaction tubes after mixing with all mixing.Then sample is carried out following PCR program: first carry out 5min under 93 DEG C of conditions, then be the process of 35 circulations, 30S is run at 93 DEG C, 1min is carried out at 60 DEG C, 35 circulations are stopped after running 3min under 72 DEG C of conditions, run 7min under 72 DEG C of conditions, then remain on 4 DEG C (Eppendorf company, Germany).Then sample is carried out the agarose gel electrophoresis of 1%, observe under gel image analyser and retain result.
Table 2 source of parents gene cyclin B1, cdc2, C-mos, GDF9, BMP15PAT length amplimer
| Genes | GenBank accession number | Primer sequence(5’–3’) |
| C-mos | NM_001113219 | GCTGAACTGGGCTGACCCGAAAC |
| Cyclin B1 | L48205 | TCTTGATAATGGTGAATGGACACCA |
| GDF9 | AY626786 | CTGCGTACCTGCCAAGTACAGCC |
| BMP15 | NM_001005155 | CCCTCGGGTACTACACTATG |
| Cdc2 | AB045783 | CTGTTAACTCTGCTTTTGTCTTGTGT |
Conclusion:
1. Polyadenylation is on the impact of little ovarian follicle oocyte maturation rate
The maturing rate of little follicular oocyte treatment group after interpolation 3 '-dA is 61.7%, and the maturing rate of the little follicular oocyte of untreated fish group is 48.4%.Two groups of maturing rate comparing differences significantly (p<0.05).Little follicular oocyte process and untreated after compare remarkable (p>0.05) (Fig. 1) of mortality ratio and prematurity rate difference.
2. Polyadenylation is on the impact of ovarian follicle source of parents genetic expression
In untreated fish group group, CyclinB1 has higher expression amount at M I period, and the expression amount interim when ovocyte GVBD and M II is lower, and CyclinB1 reaches the maximum in these 3 periods at the expression amount in M I period of ovocyte.Comparatively speaking, in treatment group, the expression amount of CyclinB1 in little follicular oocyte all declined than untreated fish group group to some extent three periods, and interim expression amount slightly improves (Fig. 2) than the expression amount in untreated fish group little follicular oocyte M II period when little follicular oocyte M II.
The stepped downward trend of expression amount in C-mos GVBD, M I and M II period in the little follicular oocyte of untreated fish group.But in treatment group, C-mos at middle GVBD, M I and the expression amount in M II period apparently higher than untreated fish group.C-mos expression amount in the little follicular oocyte in treatment group M II period is these three periods the highest (Fig. 3).
GDF9 expression amount in M II period in the little follicular oocyte of untreated fish group is much lower for period compared with GVBD and M I, and the expression amount in GVBD, M I and M II period presents downward trend gradually.The expression amount of GDF9 in treatment group M II ovocyte in period is high compared with the expression amount in M I and GVBD period.And exceed more than 3 times than the expression amount in untreated fish group group M II large follicle in period ovocyte.Expression amount in treatment group M I period little follicular oocyte slightly declines compared with the expression amount in GVBD period.(Fig. 4)
The expression amount in BMP15 GVBD, M I and M II period in the little follicular oocyte of untreated fish group presents downward trend gradually.But the expression amount in BMP15 GVBD, M I and M II period in the little follicular oocyte for the treatment of group presents the trend risen gradually after interpolation inhibitor.(Fig. 5).
The expression amount in Cdc2 GVBD, M I and M II period in the little follicular oocyte of untreated fish group presents downward trend gradually.After suppression, the expression amount of experimental group Cdc2 in GVBD, M I and M II size in period follicular oocyte is too in having gone out downward trend gradually.(Fig. 6)
3.poly(A) the mensuration of the length of tail
PAT method is adopted to detect the poly(A of normal pig ovocyte GVBD, M I and M II source of parents in period gene cyclinB1, C-mos, GDF9, BMP15, Cdc2) tail length.Wherein, cyclinB1 differs not obvious after adding 3 '-dA inhibitor compared with control group.C-mos gene after adding 3 '-dA inhibitor, the M I in the little follicular oocyte of pig and M II period then poly(A) length of tail diminishes.M I and M II poly(A in period in the untreated fish group of GDF9) length of tail diminishes.After adding 3 '-dA inhibitor, M I and M II poly(A in period in the little follicular oocyte of pig) length of tail increases.BMP15 after adding 3 '-dA inhibitor, M II poly(A in period) length of tail obviously diminishes.The untreated fish group of Cdc2 is at GVBD, M I and M II poly(A in period) length of tail do not change, and after 3 '-dA inhibitor, M I band in period diminishes (Fig. 7).
Result of study shows, source of parents gene cyclinB1, C-mos, GDF9, BMP15, Cdc2 Polyadenylation degree in ovocyte determines the expression amount of these these genes, and ovule bubble is become raising in process of dominant follicle and played a role, and key pushing effect is played to oocyte maturation.Wherein the expression amount of C-mos, GDF9, BMP15 just plays Main Function for the maturation of little follicular oocyte.Poly(A) length of tail shows, the interpolation of 3 '-dA does not make the polyadenylation effect of GDF9 be affected, stability and the translation efficiency of its mRNA can also be maintained, as can be seen here, the expression amount of C-mos, GDF9, BMP15 gene can increase the possibility that ovule bubble becomes dominant follicle, thus increases the maturing rate of little ovarian follicle.To being widely applied in research fields such as transgenic technology, nuclear transfer technology, embryonic stem cell technologies.
Claims (1)
1. the method for a boar ovule bubble In vitro maturation, comprises the following steps:
(1) collection of the female cumulus complex of the little ovarian follicle ovum of pig
Ovary adopts the ovary in just butchering sow, puts into 37 DEG C of physiological saline containing 75mg/ml penicillin and 50mg/ml Streptomycin sulphate, and with physiological saline cleaning 2 ~ 3 times within 2 hours; Extract at the indoor syringe with No. 18 syringe needles of aseptic technique the female cumulus complex of ovum that diameter is <3mm ovarian follicle, picking has 3 ~ 5 layers of granulosa cell parcel under the microscope, and tenuigenin is even, the cumulus oocyte complex that zona pellucida is complete;
(2) preparation of the little ovarian follicle oocyte in vitro maturation culture solution of pig and cultivation
Preparation nutrient solution, basic medium is TCM-199, adds 0.1%PVA (w/v), 3.05mM D-Glucose before balance, 1mM Sodium.alpha.-ketopropionate, 0.57mM halfcystine, 10ng/ml EGF, 10IU/ml PMSG, 10IU/ml hCG, 75mg/ml penicillin, 50mg/ml Streptomycin sulphate, finally adding Cordyceps militaris (L.) Link. element final concentration is 2 μ g/ml;
First wash after 2 times with Hepes-TL-PVA, wash 2 times with the nutrient solution of balance more than 2h, culture condition is 5%CO
2, temperature 39 DEG C and maximal phase are to saturated humidity; Cultivate 44 little when M II, ovocyte is discharged first polar body and is maturation; Collect the female cumulus complex of ovum, with the hyaluronic acid ferment treatment 2min of 0.1% concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310471237.3A CN103525759B (en) | 2013-10-06 | 2013-10-06 | Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310471237.3A CN103525759B (en) | 2013-10-06 | 2013-10-06 | Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103525759A CN103525759A (en) | 2014-01-22 |
| CN103525759B true CN103525759B (en) | 2015-04-01 |
Family
ID=49928111
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310471237.3A Active CN103525759B (en) | 2013-10-06 | 2013-10-06 | Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103525759B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104140952B (en) * | 2014-08-08 | 2018-03-16 | 山东威高新生医疗器械有限公司 | hyaluronidase and preparation method thereof |
| CN109112100A (en) * | 2018-09-04 | 2019-01-01 | 安徽农业大学 | The collection method of the small cumulus oocyte complex for having chamber of one boar |
| CN109554484A (en) * | 2018-12-19 | 2019-04-02 | 安徽农业大学 | A kind of method of quick detection Pig embryos full-length genome transcriptional activity |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102363766A (en) * | 2011-11-02 | 2012-02-29 | 青岛农业大学 | Method for promoting in vitro maturation of immature oocytes by using activin A (ActA) |
-
2013
- 2013-10-06 CN CN201310471237.3A patent/CN103525759B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103525759A (en) | 2014-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102899286B (en) | Application of C-type natriuretic peptide to promotion on in vitro maturation of bovine oocyte | |
| Kim et al. | Improved in vitro development of porcine embryos with different energy substrates and serum | |
| CN111778204B (en) | Oocyte in-vitro maturation culture solution additive and application thereof | |
| CN103525759B (en) | Application of cordycepin in in-vitro maturation culture of oocytes of small pig follicles | |
| CN104130973A (en) | In-vitro maturating method for sheep oocyte, pretreatment solution and kit | |
| CN110760473B (en) | Porcine oocyte in-vitro maturation culture solution and preparation method and application thereof | |
| CN113122539B (en) | RNA interference fragment of donkey Zfy gene, expression vector and application thereof | |
| CN102618496B (en) | Method for enhancing ectogenesis of sheep oocyte | |
| CN104342400A (en) | Method for improving in-vitro developmental capacity of ovine oocytes | |
| CN110684723B (en) | Porcine oocyte in-vitro maturation culture solution and preparation method and application thereof | |
| KR101970411B1 (en) | Culture media for in vitro maturation of oocyte containing hesperetin and method using there of | |
| CN106399308A (en) | RNA interference fragment of zfy gene, expression vector and applications of RNA interference fragment and expression vector | |
| AU2020100222A4 (en) | Method of introducing double-stranded dna into the body of kerria chinensis | |
| CN113151159A (en) | Oocyte in-vitro maturation culture solution additive and application thereof | |
| CN110184233B (en) | Oocyte in-vitro maturation culture solution additive and application thereof | |
| Koçyiğit et al. | The effect of macromolecule and growth factor combinations on in vitrodevelopment of bovine embryos | |
| CN107034176A (en) | A kind of nutrient solution and its cultural method for improving in vitro culture porcine oocytes developmental potentiality | |
| CN106047799B (en) | Application of octanoylated Ghrelin in promoting bovine oocyte in-vitro maturation | |
| CN111606989A (en) | Application of reproductive development related gene UCP and dsRNA thereof in prevention and control of bactrocera dorsalis | |
| CN115806986B (en) | Milk goat Zfy gene interference fragment, expression vector and application thereof | |
| CN106139147A (en) | Mir-27a application in regulation and control follicular development | |
| CN109456972A (en) | It is a kind of promote bovine oocyte maturation miRNA and its application | |
| CN104212813A (en) | Freshwater shrimp gonad inhibiting hormone gene and kit and method for accelerating development of ovary | |
| WO2019173615A1 (en) | Sphingolipid-metabolizing proteins enhance the efficiency of gene editing in cells | |
| CUI et al. | Relationship between differential expression of Bax and Bcl-2 genes and developmental differences of porcine parthenotes cultured in PZM-3 and NCSU-23 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |