CN103497954A

CN103497954A - Protein for regulation and control of leaf color at low temperature and its gene and application

Info

Publication number: CN103497954A
Application number: CN201310387533.5A
Authority: CN
Inventors: 魏祥进; 胡培松; 唐绍清; 邵高能; 焦桂爱; 谢黎虹; 圣忠华; 宋建; 刘聪利
Original assignee: China National Rice Research Institute
Current assignee: China National Rice Research Institute
Priority date: 2013-08-31
Filing date: 2013-08-31
Publication date: 2014-01-08
Anticipated expiration: 2033-08-31
Also published as: CN103497954B

Abstract

The invention discloses a protein for regulation and control of leaf color at low temperature and its gene and application, and belongs to the technical field of gene engineering. The invention discloses a gene nucleotide sequence and an amino acid sequence of the protein for regulation and control of the leaf color at low temperature, and provides the application of the gene. According to the gene, rice seedling stage temperature sensitive mutant is used, and cloned to YWL1 gene by using a map-based cloning method, and the gene is localized on chloroplast pseudouridine synthase family proteins. Functions of the YWL1 gene are identified by genetically modified (gm) complementary experiments. The gene can adjust the rice chloroplast development to obtain seedling stage leaf change phenotype and lay a foundation for the further use of the gene.

Description

A kind of protein and gene and application that regulates and controls low temperature lower blade color

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of protein and gene and application that regulates and controls low temperature lower blade color.

Background technology

Blade is that plant carries out photosynthetic major organs, dry-matter in rice grain more than 2/3 is the (Wang Xujun obtained by photosynthesis after blooming, Xu Qingguo, the physiological progress of Yang Zhijian (2005) Senescence of Rice, China agronomy circular 21:187-190), whether photosynthetic efficiency and chloroplast structure and function be complete, the height of the stability of photosynthesis complex body, chlorophyll content has complicated relation.In recent years, the using value of leaf look receives much concern, leaf variegation can be used as mark property, in paddy rice cross breeding breeding and stock breeding, play a significant role, not only can be for rejecting seed and the pseudostationary that is subject to the external source pollen contamination seedling stage, can also be for measuring seed purity (Zhang Zhixing, the application of Chen Shanfu (2001) leaf marking technology in hybrid rice seeds is produced, seed science and technology 19:33-34).In addition, the research of leaf look mutant, to effectively utilizing genetically engineered to improve the photosynthetic capacity of paddy rice, is cultivated high light efficiency paddy rice, increases rice yield and has important theory significance and using value.

At present, utilize Rice Leaf look mutant, cloned the gene of a plurality of participations or controlling chlorophyll metabolism and Development of Chloroplasts, by analyzing gene function, expression pattern, Interaction among genes and core-matter signal conduction, tentatively understood the Rice Leaf look and formed and Regulation Mechanism.So far, key enzyme in the arabidopsis ' chlorophyll building-up process all identifies out (Nagata N(2005) Identification of a Vinyl Reductase Gene for Chlorophy11 Synthesis in Arabidopsis thabliana and Implications for the Evolution of Prochlorococcus Species. The Plant Cell Online 17:233-240), but in paddy rice, only have the minority gene out identified, other genes need further discovery.In addition, the regulatory mechanism of chlorophyll degradation is not yet bright and clear, and the mechanism that core-matter is done mutually is still unintelligible, remains deeply further to be studied.

Summary of the invention

The problem existed for prior art, the object of the invention is to design provides a kind of the regulate and control protein of low temperature lower blade color and the technical scheme of gene and application thereof.

The gene of described a kind of regulation and control low temperature lower blade color of encoding it is characterized in that one of following nucleotide sequences:

1) it is the described nucleotide sequence of SEQ ID No.1;

2) it is the protein that the aminoacid sequence shown in coding SEQ ID No.3 forms.

Described a kind of protein that regulates and controls low temperature lower blade color, is characterized in that this protein has the aminoacid sequence shown in SEQ ID No.3.

Described a kind of transgenic cell line, is characterized in that containing just like the nucleotide sequence shown in SEQ ID No.1.

Described a kind of transgenosis recombinant bacterium, is characterized in that containing just like the nucleotide sequence shown in SEQ ID No.1.

The application of gene in the transgenic plant of cultivating the Development of Chloroplasts changed condition of described coding regulation and control low temperature lower blade color.

The application of gene in the transfer-gen plant of cultivating the seedling leaf albefaction of described coding regulation and control low temperature lower blade color.

The specific embodiment of the invention step is as follows:

One, the separation of rice seedling temperature-sensitive mutant ywl1 and genetic analysis

The chlorophyll content analytical results shows that the ywl1 mutant is slow than wild-type at growth and development process Determination of Chlorophyll accumulating rate at 23 ℃ of condition lower blades, and along with the maturation of blade, chlorophyll content and wild-type reach unanimity; Mutant two leaves frontvane yellow-white wholeheartedly under 25 ℃ of conditions, chlorophyll content is significantly lower than wild-type, and chlorophyll fluorescence parameters difference is not remarkable; Mutant leaf morphology and physical signs and wild-type reach unanimity (Fig. 1) under 28 ℃ of conditions.Chloroplast Ultrastructure the analysis showed that, ywl1 mutant leaf striped leaf white portion most cells inside not yet differentiates Thylakoids structure and basal granule, only have indivedual cells can observe ripe chloroplast(id), whole chloroplast(id) performance dysplasia, but, along with the growth of blade, the folded number of grana lamella buttress increases (Fig. 4).

For the phenotype of determining the ywl1 mutant, whether by Dominant gene, the present invention has carried out corresponding genetic analysis to ywl1.In the strain F2 individual plant obtained in 02428 hybridization of ywl1 mutant and japonica rice, obtained respectively strain normal phenotype individual plant and strain ywl1 mutant phenotype individual plant, normal phenotype and mutant phenotype individual plant separate ratio meet separate than 3:1(in Table 1).In addition, ywl1 mutant and wild-type 93-11 hybridization, and the ywl1 mutant is hybridized with japonica rice 02428 the F1 plant obtained and is all shown as normal phenotype.The genetic analysis result shows that the phenotype of ywl1 mutant is caused by single recessive nuclear gene mutant.

The separation case of informal voucher line leaf plant and normal leaf look plant in table 1 F2 colony

Combination cross	ywl1/02428
		Wild-type Wild type	1902
Mutation type surface Mutant type	619
		Amount to Total	2521
Card square χ ²（3:1）	0.24
		P value P-Value	0.62

Two, the green content of ywl1 mutant blade and blade and light and specificity analysis under the differing temps environment

For clear and definite ywl1 leaf look dynamic changing process, we have measured respectively plant one leaf phase leaf phase to five chlorophyll content in leaf blades (Fig. 2).From measuring result, can find out, this mutant chlorophyll content increases gradually along with the growth of plant.Under 23 ℃ of conditions, wild-type Determination of Chlorophyll a, chlorophyll b and chlorophyll total amount are all the time higher than mutant; 25 ℃ of conditions are before lower tri-leaf period, and wild-type chlorophyll a, chlorophyll b and chlorophyll total amount are higher than mutant, and reach unanimity tri-leaf period with the latter two chlorophyll contents; Under 28 ℃ of conditions, the two chlorophyll a, chlorophyll b and chlorophyll total amount are basically identical, consistent with the phenotype result.

As seen from Figure 3, the ywl1 mutant under 23 ℃ of environment than the remarkable decline of wild-type, shows more serious light and ability decline feature at Net Photosynthetic Rate in seedling stage (Pn), stomatal conductance (Gs) and transpiration rate (Tr), recovers heading stage consistent with wild-type; Ywl1 mutant under 25 ℃ of environment, seedling stage, stomatal conductance (Gs) and transpiration rate (Tr) did not have significant difference with wild-type except Net Photosynthetic Rate (Pn) than the remarkable decline of wild-type, and during heading stage, three indexs are all consistent with wild-type; Ywl1 mutant under 28 ℃ of environment is seedling stage or heading stage no matter, and Net Photosynthetic Rate (Pn), stomatal conductance (Gs) and transpiration rate (Tr) are all consistent with wild-type.

Three, map based cloning YWL1 gene

1.YWL1 the molecule of gene location:

Genetic analysis shows, ywl1 mutant informal voucher line leaf phenotype is to be controlled by a pair of stealthy nuclear gene.Utilize 184 strain extremists of the derivative F2 colony of ywl1 mutant and japonica rice 02428 hybridization to carry out just location, by the ywl1 assignment of genes gene mapping on the 3rd the short arm of a chromosome between RM14327 and RM5474.By enlarging target group, according to the SSR announced and independently developed Indel mark, built ywl1 gene locus zone high-density linkage map subsequently, the mutator gene Fine Mapping is in the 37.1kb interval, as shown in Figure 5 the most at last.

2. the evaluation of YWL1 gene and functional analysis

Utilize genetic analysis and forecasting software to be predicted the 37.1kb zone of location, discovery has 5 open reading frame (ORFs), ORF5 coding (LOC_Os03g05806) Pseudouridine synthase family protein wherein, the pseudouracil synthase family protein sequence of the protein sequence of this genes encoding and Arabidopis thaliana SVR1 coding has 59% similarity, and sxemiquantitative RT-PCR result shows ORF5(LOC_Os03g05806 in the ywl1 mutant) expression amount significantly increase; Cause chloroplast protein translation and rRNA machining functions disappearance after Arabidopis thaliana svr1 sudden change, the inhibition of the variegated leaf phenotype that phenotype is the var2 mutant.Sequencing result finds that there is the disappearance of 18bp base in LOC_Os03g05806 ORF district, causes the amino acid whose disappearance in 6 of Asp214-Ser219 positions in this gene protein sequence.Therefore, determine the candidate gene that the YWL1 gene is the ywl1 mutator gene.The gene order of wild-type kind amplification is SEQ ID NO.1, called after YWL1 gene.

In order to observe the Subcellular Localization function of YWL1 albumen (SEQ ID NO.3), the CDS sequence of YWL1 gene (SEQ ID NO.2) is building up in the PAN580-GFP expression vector, obtain fusion expression vector, then with paddy rice proplastid transient expression system, observe YWL1 (protein expression of SEQ ID NO.2).At first, extract fusion expression vector and, without the plastid of gene fusion empty carrier PAN580-GFP, after wrapping up respectively with bronze, particle gun bombards to paddy rice proplastid cell.Cultivate after 16 hours under dark situation, observe under laser confocal microscope.Result shows, without the green fluorescence of the control vector of gene fusion, is expressed in equably whole paddy rice proplastid cell, and fusion rotein is distributed in chloroplast(id) (Fig. 6) specifically.

The present invention utilizes the rice seedling temperature-sensitive mutant, by the map based cloning method, has been cloned into the YWL1 gene, and this genes encoding is positioned the pseudouracil synthase family protein albumen of chloroplast(id).Identified the function of YWL1 gene by transgene complementation test.Thereby the present invention can regulate rice chloroplast growth acquisition seedling leaf change phenotype.For the further utilization of this gene lays the first stone.

The accompanying drawing explanation

Fig. 1 is japonica rice variety Asominori wild-type and temperature-sensitive mutant ywl1 in seedling stage phenotype at each temperature;

Fig. 2 is different development stage ywl1 mutant and wild-type chlorophyll content under condition of different temperatures;

Fig. 3 is light and the characteristic of ywl1 mutant and wild-type blade under condition of different temperatures;

The transmission electron microscope observing figure that Fig. 4 is wild-type and mutant, A, mesophyll cell and the chloroplast structure of D wild-type 93-11; B, the mesophyll cell core chloroplast structure of E ywl1 mutant informal voucher line Ye Baiye part; C, the mesophyll cell core chloroplast structure of F ywl1 mutant informal voucher line leaf greenery part;

Fig. 5 is the Fine Mapping of YWL1 gene on paddy rice the 3rd karyomit(e);

Fig. 6 is 35S::YWL1::GFP fusion rotein transient expression figure as a result in paddy rice proplastid cell; The positioning result of upper behavior 35S::GFP empty carrier, the positioning result of lower behavior 35S::YWL1::GFP fusion vector; The left side is white light figure, and centre is the GFP fluorogram, the fusion figure that the right is the former two.

Embodiment

In order to understand the present invention, below with embodiment, further illustrate the present invention, but do not limit the present invention.

The phenotype analytical of embodiment 1:ywl1 mutant

A) rice material

Paddy rice (Oryza sativa L) mutant ywl1, original wild-type material is rice variety 93-11.

B) mensuration of chlorophyll content and photosynthesis characteristics

Select full mutant and wild type seeds presoaking and germinating, the seed of the mutant germinateed and wild-type 93-11 is implanted in earthen bowl, sets day constant temperature and be respectively 23 ℃, 25 ℃ and 28 ℃, the long 12h of light in growth cabinet, dark place reason 12h, cultivate under the envrionment conditions that light intensity is 5Lax.Observe and record mutation type surface.Respectively at getting the measuring blade chlorophyll content five periods that turn green front and back (a leaf phase, two leaf stage, tri-leaf period, four leaf phases and five leaf phases).

The mensuration of chlorophyll content: get the ethanol that testing sample 0.1g-0.2g is soaked in 10ml95%, be positioned over lixiviate pigment 48h left and right in the refrigerator of 4 ℃.A little is poured in the cuvette of 1cm to get said extracted liquid, take 95% ethanol as reference liquid, under Beckman Du80 type spectrophotometer, reads respectively the optical density(OD) under 665nm, 649nm, the 470nm glistening light of waves.Utilize formula that the Lichtenthaler method revised to calculate the content of chlorophyll a (Chla), chlorophyll b (Chlb), carotenoid (Caro).

Chla content (mg/g)=(13.95O.D665-6.88O.D649) V/1000W

Chlb content (mg/g)=(24.96O.D649-7.32O.D665) V/1000W

Caro content (mg/g)=(1000O.D470+811.74O.D665-2851.32O.D649)/245

Annotate: O.D: measure the optical density value under wavelength.

V: chlorophyll extracting solution cumulative volume (mL).If what measure use is diluent, should be multiplied by extension rate.

W: material fresh weight (g).

The mensuration of photosynthesis characteristics: the portable photosynthetic determinator of Li-6400 type that adopts U.S. Li-COR company to produce, open system, used red blue-light source, photo flux density 1 200 μ mol m ^-2s ^-1, flow velocity 500 μ mol s ^-1, measure respectively the Net Photosynthetic Rate of each material under three envrionment conditionss during 9:00 on fine day～11:00.3 representative sword-like leaves are measured in every processing, every leaf replication 3 times (getting its mean value repeats as 1 time).Testing index comprises net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr) and intercellular CO2 concentration (Ci).

As seen from Figure 2, this mutant chlorophyll content increases gradually along with the growth of plant.Under 23 ℃ of conditions, wild-type Determination of Chlorophyll a, chlorophyll b and chlorophyll total amount are all the time higher than mutant; 25 ℃ of conditions are before lower tri-leaf period, and wild-type chlorophyll a, chlorophyll b and chlorophyll total amount are higher than mutant, and reach unanimity tri-leaf period with the latter two chlorophyll contents; Under 28 ℃ of conditions, the two chlorophyll a, chlorophyll b and chlorophyll total amount are basically identical, consistent with the phenotype result.

C) electron microscopic observation

Utilize transmission electron microscope (TEM) to observe the Chloroplast Ultrastructure of wild-type and the 3rd leaf of ywl1 under 23 ℃ of conditions, found that ywl1 mutant leaf striped leaf white portion most cells inside not yet differentiates Thylakoids structure and basal granule, only have indivedual cells can observe ripe chloroplast(id), whole chloroplast(id) performance dysplasia, but the growth along with blade, the folded number of grana lamella buttress increases, as Fig. 4.

The clone of embodiment 2:YWL1 gene

A) genetic analysis and target group

Utilize positive and negative hybridization to determine that ywl1 is for cryptic mutant, choose mutant and japonica rice 02428 is hybridized, F1 is for selfing, individual plant sowing plantation F2 colony, from separative colony, select 4391 recessive individual as target group.Get the tender leaf of 1 gram left and right in every strain in tri-leaf period, be used for extracting total DNA and carry out the assignment of genes gene mapping.

B) Primary Location of YWL1 gene and Fine Mapping

Adopt the rapid extracting method of paddy rice minim DNA to extract the genomic dna for the assignment of genes gene mapping from rice leaf, the method of this DNA extracting is SDS method (Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation:version II. Plant Mol Bio Rep 1:19-21).Get after about 100mg rice leaf shreds and put into the 2ml centrifuge tube, add steel ball after liquid nitrogen freezing, pulverize on sample grinding machine, then extract DNA, the DNA of acquisition is precipitated and dissolved in 400 μ L ultrapure waters, each PCR 1 μ LDNA sample for reaction.

In the Primary Location of YWL1 gene, use by 30 F2 (the strain F2 that ywl1 mutant and japonica rice 02428 hybridization obtain) individualities with mutant phenotype and carry out ssr analysis.At first according to the molecular genetic linkage map of the japonica rice of announcing and long-grained nonglutinous rice establishment, choose the approximate SSR primer be uniformly distributed on each karyomit(e) and carry out pcr amplification (reaction system is as follows).Polyacrylamide gel by 8% (the gel collocation method is as follows) electrophoretic separation, by the polymorphism of test strip, by the chromosomal galianconism of gene Primary Location to the 3, and between RM14327 and RM5474 two SSR marks.

The PCR reaction system:

DNA profiling	1μL
			10╳PCR Buffer	1μL
dNTP(10mM)	0.1μL
		Upstream primer (10 μ m)	0.5μL
Downstream primer (10 μ m)	0.5μL
		Taq enzyme (5U/ μ L)	0.2μL
ddH ₂O	6.7 μ L to 1ml

8% polyacrylamide gel formula:

5╳TBE	6ml
		40% Arc-Bis	6
10%AP(μL)	240
		TEMED(μL)	30
ddH ₂O	18 to 30ml

Polyacrylamide gel nitrite ion formula:

Na ₃(BO ₄) ₄	0.152
		NaOH	12g
Formaldehyde	3.2ml
		ddH ₂O	To 800ml

Annotate: formaldehyde is now to add before use, and other three prepare in advance by respective amount.

Then by the BAC sequence between RM14327 and RM5474 two marks, analyzed, developed new Indel mark, finally expand F2 target group to 4291 and carry out Fine Mapping, within YWL1 accurately being positioned to the scope of 37.1kb between mark RM6829 on BAC clone OSJNBa0016I15 and RM14400, as shown in Figure 5, infer candidate gene gene sequencing analysis by analyzing this section open reading frame (ORF), find mutational site.

Indel labeled primer sequence:

RM14327-F	GATGCAGTAGGAACACCAAACAGC	(SEQ ID NO.4)
			RM14327-R	ATCGAGTACCAAGTGCCTGTGC	(SEQ ID NO.5)
RM5474-F	GTGGGTTTGTGTTTGGAGAGACG	(SEQ ID NO.6)
			RM5474-R	GTGTTGGTGAGCATAGCAGTTGG	(SEQ ID NO.7)
RM6829-F	CGATGAAGAGCCAATCCTTCAGC	(SEQ ID NO.8)
			RM6829-R	TGCTCGTCCCTTCTACAAACAGG	(SEQ ID NO.9)
RM14400-F	GGCAGCGAGTAAGTGTAGATTGG	(SEQ ID NO.10)
			RM14400-R	TGTTGGTATAAGACAGGTGCATGG	(SEQ ID NO.11)

F) predictive genes and comparative analysis

Result according to Fine Mapping, in the 37.1kb scope according to RiceGAAS (Rice Automat ed Systrm, http://ricegaas.dna.affrc.go.jp/) and TIGR(http: //rice.plantbiology.msu.edu/) prediction, discovery has 5 candidate genes in this interval, it is carried out to sequence alignment analysis analysis, find the 1029-1046 position 18bp base deletion of ORF5, and then cause the amino acid whose disappearance in 6 of Asp214-Ser219 positions in this gene protein sequence.The gene order of wild-type kind amplification is SEQ ID NO.1, called after YWL1 gene, and the nucleotides sequence that the protein sequencing of its coding obtains is classified SEQ ID NO.2 as.

Embodiment 3:YWL1(SEQ ID NO.3) chloroplast(id) positioning experiment

Cut recognition site according to total length CDS sequence (the SEQ ID NO.2) design of YWL1 containing the enzyme of BamHI, design restructuring primer, its sequence is:

PGXhF: TTTCTCGAGATAAACCCCCTCCCACACTCTCCAC（SEQ ID NO.14）

PGSalR: TTTGTCGAGCCAAATTTGATATTGCACAATGGGA（SEQ ID NO.15）

Take wild-type cDNA as template, go out the CDS sequence (SEQ ID NO.2) of YWL1 gene with PrimeSTAR high-fidelity enzymatic amplification, amplified production, after the sequence verification sequence is correct, is connected with the PAN580-GFP carrier, obtains fusion expression vector 35S::YWL1::GFP.

Extraction build the plasmid of fusion expression vector 35S::YWL1::GFP and without the 35S::GFP control plasmid of gene fusion respectively with the bronze parcel, depress and bombard paddy rice proplastid cell at the helium of 1100psi with the PDS-1000/He type particle gun of Bio-rad company.Paddy rice proplastid cell after bombardment oozes dark the cultivation 16 hours in substratum as for height, then is placed in fluorescence microscope, and the YWL1::GFP fusion rotein is positioned in chloroplast(id), and empty carrier GFP is at whole cell expressing (Fig. 6).This result has proved the function of YWL1 (SEQ ID NO.2), and it is a chloroplast(id) positioning protein.

Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.

Sequence table

<110 > China Paddy Rice Inst

<120 > a kind of protein and gene and application that regulates and controls low temperature lower blade color

<130>

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 2402

<212> DNA

<213 > (paddy rice) Oryza sativa

<400> 1

atccccttct tatccgctct gctctctcca cctcgcctcc ccgaaacgaa atggcagtgg 60

cgttccactg aaccaggcca agccagacgg acaagacttc gccgcagccg cgtcctcctc 120

accgcgccgc cgtcgcaatg gctacggcca tcgcagcctc cgcgttcctc tcctccgcct 180

tcgccaggga caggccgctc ccccgccagc ggcgcgcggc gaggcccgcg acccgccgcg 240

ccgccgcggg gggcctgtcg gtgcggtgcg agcagagcga gaagcagaag aggcagccgc 300

tctccgcgct cgtcccccgc gagcagcgat tcatgttcga aggcgacgag ctctgcggcc 360

ccgtactaac cctcacctct ctttctctct cccgtataca ttcttctctt tctcagttca 420

gaaaatgaat agtaatgcta cattccttgg ataaagggaa attttaccgt gatttaggat 480

tgccgcttat ttaggaaagc tcaagattag tcccattcat ttctaaatcc gtaagtcact 540

tcatcttgct ctattgggtc aaatcctttc tttacatgaa taatgttagg gaaaatacac 600

aatgttttta catgttacta taccgtatag accaccatct tattttattt aaagttatct 660

agttgtaatt tattacgaaa gaggattcca taaaatgaac tgaaaataac atggagggaa 720

cgttggtctt tctgaattgg tcgctaacat tgtgttgtat tactcaacag tgttcgcacc 780

tacatgacta ccatatcttt ttatctgtgg atgtttaggt ttgtgaagtt agaattcagt 840

acggatacca ttcttgtgtt ctttctctct tttctgtgca acctgttctg tgtagtgatc 900

ggaccaagga atttaatttg caggacatat ggaacacaac atggtaccct aaggctgcag 960

atcatgtaac tactgagaag acatggtatg ttgttgatgc aacagacaag attctaggta 1020

ggcttgcatc caccattgca gtacacatca gaggaaagaa tgaggccaca tacactccaa 1080

gtgtggacat gggggctttt gttgttgtgg tatgtatgtt tcttgaaatt aatttataaa 1140

gttaaatagt gcacacaata agatcctctg tagtcccaca aaaggaaaag aggtttagca 1200

gcacatacaa ataagcacca aaaggtatct ggaagctgag gtccacctga aggcattttg 1260

aagctgattt catgtatata tatttatgtt actgtgtgct tttaatacta atgcatctct 1320

gaagagtaat tgctacgcat atactattgt aagttcctga actaccatgc tgaactctat 1380

gttcacatag gttaatgcag agaaggttgc tgtttctggc aaaaagcggt cacagaagct 1440

ctacaggagg cactctggac ggcctggtgg aatgaaagaa gaaacttttg atcagcttca 1500

gaaaaggatt ccggagagaa ttattgaaca tgcagtgcgt ggcatgcttc ctaagggcag 1560

agtaagacat catctcttag agctcttatc tagtcagttt catcaagtct ttttgacctt 1620

aagtcagcct acctgggtat acatatgctc ttatccttat ttttggtcaa tttctaatac 1680

atatctgaaa atgggtatcc tcgttctgtt ccattatact tcattattgt gtataattcc 1740

ccaactttat ataccctgtt catggaaata ttcgctctaa ttgaatgccg aaacggcgtg 1800

ggctaacgaa gtactagatg tattctccca aaactcctat gttgcctgta agacatctta 1860

tgattgccta aagcctttta cttatgccta agttcattta taaaaaaaaa aaacgtttac 1920

tatgtcaacc tctcaagttc tcatatgtta gtgacactga cacatgtaat ccgaccaact 1980

acagcggttg tacgtgctct atgtagcctt ctcaacattt tgaacatttt gcagctggga 2040

agaagactgt ttacccacct caaggtgtac aagggagcag aacatcccca tgaggctcaa 2100

aaacctgttc cactgcctat caaggataaa agaatacaga agtctgagaa gtagataatt 2160

cctgtggaga ctaagaaaga cacaacaatc tcacgtaaat tcctcccctc gagattttgt 2220

ccaatctttg gaatgtgatg catctgtctg tttggggaat ggagtgtaaa attttttgta 2280

atttacttcc tccaaaagtt tgtgtttcta agtcatagtt cttgttgatt acatatcatg 2340

tacctaatac cgtacgattt taagcaatcc gatatttcca tatccaattg agtagtgcaa 2400

tt 2402

<210> 2

<211> 702

<212> DNA

<213 > (paddy rice) Oryza sativa

<400> 2

atggctacgg ccatcgcagc ctccgcgttc ctctcctccg ccttcgccag ggacaggccg 60

ctcccccgcc agcggcgcgc ggcgaggccc gcgacccgcc gcgccgccgc ggggggcctg 120

tcggtgcggt gcgagcagag cgagaagcag aagaggcagc cgctctccgc gctcgtcccc 180

cgcgagcagc gattcatgtt cgaaggcgac gagctctgcg gccccgacat atggaacaca 240

acatggtacc ctaaggctgc agatcatgta actactgaga agacatggta tgttgttgat 300

gcaacagaca agattctagg taggcttgca tccaccattg cagtacacat cagaggaaag 360

aatgaggcca catacactcc aagtgtggac atgggggctt ttgttgttgt ggttaatgca 420

gagaaggttg ctgtttctgg caaaaagcgg tcacagaagc tctacaggag gcactctgga 480

cggcctggtg gaatgaaaga agaaactttt gatcagcttc agaaaaggat tccggagaga 540

attattgaac atgcagtgcg tggcatgctt cctaagggca gactgggaag aagactgttt 600

acccacctca aggtgtacaa gggagcagaa catccccatg aggctcaaaa acctgttcca 660

ctgcctatca aggataaaag aatacagaag tctgagaagt ag 702

<210> 3

<211> 228

<212> PRT

<213 > (paddy rice) Oryza sativa

<400> 3

Met Ala Thr Ala Ile Ala Ala Ser Ala Phe Leu Ser Ser Ala Phe Ala

1 5 10 15

Arg Asp Arg Pro Leu Pro Arg Gln Arg Arg Ala Ala Arg Pro Ala Thr

20 25 30

Arg Arg Ala Ala Ala Gly Gly Leu Ser Val Arg Cys Glu Gln Ser Glu

35 40 45

Lys Gln Lys Arg Gln Pro Leu Ser Ala Leu Val Pro Arg Glu Gln Arg

50 55 60

Phe Met Phe Glu Gly Asp Glu Leu Cys Gly Pro Asp Ile Trp Asn Thr

65 70 75 80

Thr Trp Tyr Pro Lys Ala Ala Asp His Val Thr Thr Glu Lys Thr Trp

85 90 95

Tyr Val Val Asp Ala Thr Asp Lys Ile Leu Gly Arg Leu Ala Ser Thr

100 105 110

Ile Ala Val His Ile Arg Gly Lys Asn Glu Ala Thr Tyr Thr Pro Ser

115 120 125

Val Asp Met Gly Ala Phe Val Val Val Val Ala Val Ser Gly Lys Lys

130 135 140

Arg Ser Gln Lys Leu Tyr Arg Arg His Ser Gly Arg Pro Gly Gly Met

145 150 155 160

Lys Glu Glu Thr Phe Asp Gln Leu Gln Lys Arg Ile Pro Glu Arg Ile

165 170 175

Ile Glu His Ala Val Arg Gly Met Leu Pro Lys Gly Arg Leu Gly Arg

180 185 190

Arg Leu Phe Thr His Leu Lys Val Tyr Lys Gly Ala Glu His Pro His

195 200 205

Glu Ala Gln Lys Pro Val Pro Leu Pro Ile Lys Asp Lys Arg Ile Gln

210 215 220

Lys Ser Glu Lys

225

<210> 4

<211> 24

<212> DNA

<213 > artificial sequence

<400> 4

gatgcagtag gaacaccaaa cagc

<210> 5

<211> 22

<212> DNA

<213 > artificial sequence

<400> 5

atcgagtacc aagtgcctgt gc

<210> 6

<211> 23

<212> DNA

<213 > artificial sequence

<400> 6

gtgggtttgt gtttggagag acg

<210> 7

<211> 23

<212> DNA

<213 > artificial sequence

<400> 7

gtgttggtga gcatagcagt tgg

<210> 8

<211> 23

<212> DNA

<213 > artificial sequence

<400> 8

cgatgaagag ccaatccttc agc

<210> 9

<211> 19

<212> DNA

<213 > artificial sequence

<400> 9

tgctcgtccc ttctacaaac agg

<210> 10

<211> 23

<212> DNA

<213 > artificial sequence

<400> 10

ggcagcgagt aagtgtagat tgg

<210> 11

<211> 24

<212> DNA

<213 > artificial sequence

<400> 11

tgttggtata agacaggtgc atgg

<210> 12

<211> 35

<212> DNA

<213 > artificial sequence

<400> 12

gcaggtcgac ggatcctatc cgataaccga taaac

<210> 13

<211> 35

<212> DNA

<213 > artificial sequence

<400> 13

gaattcccgg ggatcccata agcaggtttg agaag

<210> 14

<211> 35

<212> DNA

<213 > artificial sequence

<400> 14

tttctcgaga taaaccccct cccacactct ccac

<210> 15

<211> 35

<212> DNA

<213 > artificial sequence

<400> 15

tttgtcgagc caaatttgat attgcacaat ggga

Claims

1. the gene of regulation and control low temperature lower blade color of encoding it is characterized in that one of following nucleotide sequences:

1) it is the described nucleotide sequence of SEQ ID No.1;

2. a protein that regulates and controls low temperature lower blade color, is characterized in that this protein has the aminoacid sequence shown in SEQ ID No.3.

3. a transgenic cell line, is characterized in that containing just like the nucleotide sequence shown in SEQ ID No.1.

4. a transgenosis recombinant bacterium, is characterized in that containing just like the nucleotide sequence shown in SEQ ID No.1.

5. the application of gene in the transgenic plant of cultivating the Development of Chloroplasts changed condition of coding regulation and control low temperature lower blade color as claimed in claim 1.

6. the application of gene in the transfer-gen plant of cultivating the seedling leaf albefaction of coding regulation and control low temperature lower blade color as claimed in claim 1.